Search

Key message: Promoters of moso bamboo silicon transporter genes PeLsi1-1 and PeLsi1-2 contain elements in response to hormone, silicon, and abiotic stresses, and can drive the expression of PeLsi1-1 and PeLsi1-2 in transgene Arabidopsis. Low silicon 1 (Lsi1) transporters from different species have been shown to play an important role in influxing silicon from soil. In previous study, we cloned PeLsi1-1 and PeLsi1-2 from Phyllostachys edulis and verified that PeLsi1-1 and PeLsi1-2 have silicon uptake ability. Furthermore, in this study, the promoters of PeLsi1-1(1910 bp) and PeLsi1-2(1922 bp) were cloned. Deletion analysis identified the key regions of the PeLsi1-1 and PeLsi1-2 promoters in response to hormone, silicon, and abiotic stresses. RT-qPCR analysis indicated that PeLsi1-1 and PeLsi1-2 were regulated by hormones, salt stress and osmotic stress. In addition, we found that the driving activity of the PeLsi1-1 and PeLsi1-2 promoters was regulated by 2 mM K2SiO3 and PeLsi1-1-P3 ~ P4 and PeLsi1-2-P4 ~ 5 were the regions regulated by silicon. Overexpression of PeLsi1-1 or PeLsi1-2 driven by 35S promoter in Arabidopsis resulted in a threefold increase of Si accumulation, whereas transgenic plants showed deleterious symptoms and dwarf seedlings and shorter roots under 2 mM Si treatment. When the 35S promoter was replaced by PeLsi1-1 or PeLsi1-2 promoter, a similar Si absorption was achieved and the transgene plants grew normally. This study, therefore, demonstrates that the promoters of PeLsi1-1 and PeLsi1-2 are indeed effective in driving the expression of moso bamboo Lsi1 genes and leading to silicon uptake. [ABSTRACT FROM AUTHOR]

Promoters are powerful tools for breeding new varieties using transgenic technology. However, the low and unstable expression of target genes is still a limiting factor in Larix kaempferi (Lamb.) Carr (Japanese larch) genetic transformation. In this study, we analyzed L. kaempferi transcriptome data, screened out highly expressed genes, cloned their promoters, and constructed plant expression vectors containing the β-glucuronidase (GUS) reporter gene driven by these promoters. Recombinant vectors were introduced into the L. kaempferi embryogenic callus by means of the Agrobacterium-mediated transient or stable genetic transformation method, and the promoter activity was then determined by measuring GUS expression and its enzyme activity in the transformed materials. Four highly expressed genes were identified: L. kaempferi Zhang Chen Yi-1 (LaZCY-1), Zhang Chen Yi-2 (LaZCY-2), Translationally Controlled Tumor Protein (LaTCTP), and ubiquitin (LaUBQ). The 2000 bp fragments upstream of ATG in these sequences were cloned as promoters and named pLaZCY-1, pLaZCY-2, pLaTCTP, and pLaUBQ. Semi-quantitative and quantitative RT-PCR analyses of transient genetic transformation materials showed that all four promoters could drive GUS expression, indicating that they have promoter activities. Semi-quantitative and quantitative RT-PCR analyses and the histochemical staining of stable genetic transformation materials showed that the pLaUBQ promoter had higher activity than the other three L. kaempferi promoters and the CaMV35S promoter. Thus, the pLaUBQ promoter was suggested to be used in larch genetic transformation. [ABSTRACT FROM AUTHOR]

Eclipta alba (Linn.) Hassk. (Asteraceae) is a high value medicinal plant which possesses diverse medicinal properties. It is an important herb for the treatment of various disorders, and is primarily used as a hepatoprotectant. Its major biochemical constituents include wedelolactone and dimethyl-wedelolactone (coumestans), which possess anti-hepatotoxic properties. Due to its numerous medicinal properties, it is in high demand by the pharmaceutical industry and therefore requires urgent biotechnological interventions for its improvement. Therefore, the present study was constructed with the aim of developing an efficient genetic transformation protocol for E. alba, which will help in the mass production of the active compounds found in E. alba. Agrobacterium tumefaciens strain LBA 4404, containing vector pBI121, was used to genetically transform the plant, and the effect of various factors such as infection type, light cycle effect, effect of pH, among others, on the genetic transformation efficiency was analyzed. Regenerated transformed shoots were confirmed using the standard Polymerase Chain Reaction PCR method. Kanamycin-resistant and beta- glucurosidaseGUS-positive shoots indicated the development of transgenic shoots in E. alba. Amplification of nptll and uidA genes confirmed the integration of t-DNA transgenic shoots. In conclusion, various factors affecting the transformation efficiency were analyzed, and a reliable A. tumefaciens-mediated genetic transformation protocol was developed. [ABSTRACT FROM AUTHOR]

The Groundwater Ubiquity Score (GUS) is widely used to indicate the relative leachability of pesticides based on the soil half-life and the adsorption partition coefficient. In this manuscript, we derive mathematically the Theoretical Groundwater Ubiquity Score (TGUS) that, based on considerations of the preferential movement of pesticides to groundwater and a first-order pesticide degradation model, leads to a similar function as the GUS model. In the preferential flow model, movement to groundwater is fast, and the adsorption partition coefficient is thus not used for calculating the travel time to the groundwater (as it is in the advective-dispersive equation) but rather only determines the distribution of the pesticide between the water and soil phases. Both the GUS and TGUS models well predict the groundwater contamination of the originally studied pesticides for rainfall event(s) that caused pesticide leaching from 30 days after application. The theoretically derived Groundwater Ubiquity Score (TGUS) shows, in accordance with experimental evidence, that for leaching events shortly after spraying, the mass lost to (and resulting concentration in) groundwater is inversely related to the adsorption partition coefficient and not necessarily to the GUS index. [ABSTRACT FROM AUTHOR]

Abstract Background The UDP-glucuronosyltransferase 91D2 (SrUGT91D2) gene is a crucial element in the biosynthetic pathway of steviol glycosides (SGs) and is responsible for creating 1,2-β-D glucosidic bonds at the C19 and C13 positions. This process plays a vital role in the synthesis of rebaudioside M (RM) and rebaudioside D (RD). The promoter, which regulates gene expression, requires functional analysis to understand gene expression regulation. However, investigations into the function of the promoter of SrUGT91D2 (pSrUGT91D2) have not been reported. Results The pSrUGT91D2 was isolated from six S. rebaudiana lines, and subsequent multiple sequence comparisons revealed the presence of a 26 bp inDel fragment (pSrUGT91D2-B1188 type) in lines GP, GX, 110, 1114, and B1188 but not in the pSrUGT91D2 of line 023 (pSrUGT91D2-023 type). Bioinformatics analysis revealed a prevalence of significant cis-regulatory elements (CREs) within the promoter sequences, including those responsive to abscisic acid, light, anaerobic conditions, auxin, drought, low temperature, and MeJA. To verify the activity of pSrUGT91D2, the full-length promoter and a series of 5’ deletion fragments (P1–P7) and a 3’ deletion fragment (P8) from various lines were fused with the reporter β-glucuronidase (GUS) gene to construct the plant expression vector, pCAMBIA1300-pro∷GUS. The transcriptional activity of these genes was examined in tobacco leaves through transient transformation. GUS tissue staining analysis and enzyme activity assays demonstrated that both the full-length promoter and truncated pSrUGT91D2 were capable of initiating GUS expression in tobacco leaves. Interestingly, P8-pSrUGT91D2-B1188 (containing the inDel segment, 301 bp) exhibited enhanced activity in driving GUS gene expression. Transient expression studies of P8-pSrUGT91D2-B1188 and P8-pSrUGT91D2-023 in response to exogenous hormones (abscisic acid and indole-3-acetic acid) and light indicated the necessity of the inDel region for P8 to exhibit transcriptional activity, as it displayed strong responsiveness to abscisic acid (ABA), indole-3-acetic acid (IAA), and light induction. Conclusions These findings contribute to a deeper understanding of the regulatory mechanism of the upstream region of the SrUGT91D2 gene and provide a theoretical basis for future studies on the interaction between CREs of pSrUGT91D2 and related transcription factors.

Cassava, a crop of importance for subsistence farming in Africa, Asia, and Latin America, has the potential to benefit from global economic integration as a versatile industrial resource. Enhancing cassava productivity is not just a matter of agricultural competitiveness but a crucial step toward ensuring many communities' food security and livelihoods. Given its high performance in marginal environments, where climate change poses threats, ensuring food security and livelihoods relies on rapidly adapting cassava. This study aimed to develop a protocol that swiftly transitions cassava embryogenic short-period liquid suspension cultures, facilitating the regeneration of genetically stable in vitro plants. The resulting protocol, with its potential to be a foundational component in future technologies employing various genome editing or genetic modification techniques, holds promise for the advancement of cassava biotechnology.

Eclipta alba (Linn.) Hassk. (Asteraceae) is a high value medicinal plant which possesses diverse medicinal properties. It is an important herb for the treatment of various disorders, and is primarily used as a hepatoprotectant. Its major biochemical constituents include wedelolactone and dimethyl-wedelolactone (coumestans), which possess anti-hepatotoxic properties. Due to its numerous medicinal properties, it is in high demand by the pharmaceutical industry and therefore requires urgent biotechnological interventions for its improvement. Therefore, the present study was constructed with the aim of developing an efficient genetic transformation protocol for E. alba, which will help in the mass production of the active compounds found in E. alba. Agrobacterium tumefaciens strain LBA 4404, containing vector pBI121, was used to genetically transform the plant, and the effect of various factors such as infection type, light cycle effect, effect of pH, among others, on the genetic transformation efficiency was analyzed. Regenerated transformed shoots were confirmed using the standard Polymerase Chain Reaction PCR method. Kanamycin-resistant and beta- glucurosidaseGUS-positive shoots indicated the development of transgenic shoots in E. alba. Amplification of nptll and uidA genes confirmed the integration of t-DNA transgenic shoots. In conclusion, various factors affecting the transformation efficiency were analyzed, and a reliable A. tumefaciens-mediated genetic transformation protocol was developed.

Promoters are one of the most important components for many gene-based research as they can fine-tune precise gene expression. Many unique plant promoters have been characterized, but strong promoters with dual expression in both monocot and dicot systems are still lacking. In this study, we attempted to make such a promoter by combining specific domains from monocot-infecting pararetroviral-based promoters sugarcane bacilliform virus (SCBV) and banana streak virus (BSV) to a strong dicot-infecting pararetroviral-based promoter mirabilis mosaic virus (MMV). The generated chimeric promoters, MS, SM, MB, and BM, were tested in monocot and dicot systems and further validated in transgenic tobacco plants. We found that the developed chimeric promoters were species-specific (monocot or dicot), which depended on their respective core promoter (CP) region. Furthermore, with this knowledge, deletion-hybrid promoters were developed and evaluated, which led to the development of a unique dual-expressing promoter, MSD3, with high gene expression efficiency (GUS and GFP reporter genes) in rice, pearl millet, and tobacco plants. We conclude that the MSD3 promoter can be an important genetic tool and will be valuable in plant biology research and application. [ABSTRACT FROM AUTHOR]

The presence of undesired agrochemicals residues in soil and water poses risks to both human health and the environment. The behavior of pesticides in soil depends both on the physico‐chemical properties of pesticides and soil type. This study examined the adsorption–desorption and leaching behavior of the maize herbicide tembotrione in soils of the upper (UGPZ), trans (TGPZ) and middle Gangetic plain zones of India. Soil samples were extracted using acetone followed by partitioning with dichloromethane, whereas liquid–liquid extraction using dichloromethane was used for aqueous samples. Residues of tembotrione and its metabolite TCMBA, {2‐chloro‐4‐(methylsulfonyl)‐3‐[(2,2,2‐trifluoroethoxy) methyl] benzoic acid}, were quantified using liquid chromatography–tandem mass spectrometry. The data revealed that tembotrione adsorption decreased with increasing pH and dissolved organic matter but increased with salinity. The maximum adsorption occurred at pH 4, 0.01 m sodium citrate and 4 g/L NaCl, with corresponding Freundlich constants of 1.83, 2.28 and 3.32, respectively. The hysteresis index <1 indicated faster adsorption than desorption. Leaching studies under different flow conditions revealed least mobility in UGPZ soil and high mobility in TGPZ soil, consistent with groundwater ubiquity scores of 4.27 and 4.81, respectively. Soil amendments decreased tembotrione mobility in the order: unamended > wheat straw ash > wheat straw > farm yard manure > compost. The transformation of tembotrione to TCMBA and its mobility in soil columns were also assessed. [ABSTRACT FROM AUTHOR]

The AT-hook motif nuclear-localized (AHL) family is pivotal for the abiotic stress response in plants. However, the function of the cassava AHL genes has not been elucidated. Promoters, as important regulatory elements of gene expression, play a crucial role in stress resistance. In this study, the promoter of the cassava MeAHL31 gene was cloned. The MeAHL31 protein was localized to the cytoplasm and the nucleus. qRT-PCR analysis revealed that the MeAHL31 gene was expressed in almost all tissues tested, and the expression in tuber roots was 321.3 times higher than that in petioles. Promoter analysis showed that the MeAHL31 promoter contains drought, methyl jasmonate (MeJA), abscisic acid (ABA), and gibberellin (GA) cis-acting elements. Expression analysis indicated that the MeAHL31 gene is dramatically affected by treatments with salt, drought, MeJA, ABA, and GA3. Histochemical staining in the proMeAHL31-GUS transgenic Arabidopsis corroborated that the GUS staining was found in most tissues and organs, excluding seeds. Beta-glucuronidase (GUS) activity assays showed that the activities in the proMeAHL31-GUS transgenic Arabidopsis were enhanced by different concentrations of NaCl, mannitol (for simulating drought), and MeJA treatments. The integrated findings suggest that the MeAHL31 promoter responds to the abiotic stresses of salt and drought, and its activity is regulated by the MeJA hormone signal. [ABSTRACT FROM AUTHOR]

Genetic transformation is helpful in enhancing crops, utilising promoters that can be constitutive, inducible, or tissue-specific. However, the use of constitutive promoters may hinder plant growth due to energy consumption during cellular processes. To optimise transgene effects, tissue-specific promoters like root-specific ones prove valuable in addressing root-related issues and enhancing productivity. Yet, identified root-specific promoters in crop are limited. To address this gap, the expression pattern of the root-specific SlREO promoter was examined across various crops. Sequencing confirmed its identity and high homology (99%) with the NCBI database, distinct from other plants tested. Using the PLACE database, six motifs associated with root expression were identified, along with several other important elements. The 2.4 kb SlREO promoter was linked to a ß-glucuronidase (GUS) reporter gene alongside the CaMV35S promoter in pRI 201-AN- GUS vectors to study its expression. Histochemistry revealed strong root-specific expression in tomato (Solanum lycopersicum) root tissues and limited expression in stems. However, the SlREO promoter did not consistently maintain its root-specific expression in other plants. Conversely, the CaMV35S promoter exhibited constitutive expression across all tissues in various plants. This study underscores the potential of the SlREO promoter as a root-specific regulatory element, offering avenues for improving crops, particularly against environmental stresses. The improvement of tomato (Solanum lycopersicum) for various biotic and abiotic traits that affect the roots functions is vital, and root-specific promoters are tools to improve the gene expression of transgenes. SlREO is one tissue-specific promoters in tomato. This study cloned and characterised SlREO in Indian tomato cultivar, and evaluated its activity in various crops. Transgenic studies suggest that SlREO is a crop-dependent tissue-specific promoter that cannot be used to improve the expression of genes in other crops. This article belongs to the Collection Functional Genomics for Developing Climate Resilient Crops. [ABSTRACT FROM AUTHOR]

This article discusses the use of seed plastids as a novel platform for expressing recombinant proteins. The authors compare different expression platforms, such as protein bodies in seeds and chloroplasts in leaves, and highlight the advantages of expressing proteins in seed plastids, including high-level protein accumulation and long-term stability. The authors describe a two-component system using an engineered PPR10 RNA-binding protein for seed-specific expression in plastids. They successfully expressed GFP, mScarlet, and GUS proteins in transplastomic tobacco plants, with GFP remaining stable for at least 1 year. The authors suggest that seed-based bioreactors could enable long-term storage of stable proteins at ambient temperature and discuss potential applications for seed plastids in expressing bacterial vaccine antigens and new metabolic pathways. [Extracted from the article]

In this paper, we report the characterization of a genetically modified live-attenuated African swine fever virus (ASFV) field strain isolated from Vietnam. The isolate, ASFV-GUS-Vietnam, belongs to p72 genotype II, has six multi-gene family (MGF) genes deleted, and an Escherichia coli GusA gene (GUS) inserted. When six 6–8-week-old pigs were inoculated with ASFV-GUS-Vietnam oro-nasally (2 × 105 TCID50/pig), they developed viremia, mild fever, lethargy, and inappetence, and shed the virus in their oral and nasal secretions and feces. One of the pigs developed severe clinical signs and was euthanized 12 days post-infection, while the remaining five pigs recovered. When ASFV-GUS-Vietnam was inoculated intramuscularly (2 × 103 TCID50/pig) into four 6-8 weeks old pigs, they also developed viremia, mild fever, lethargy, inappetence, and shed the virus in their oral and nasal secretions and feces. Two contact pigs housed together with the four intramuscularly inoculated pigs, started to develop fever, viremia, loss of appetite, and lethargy 12 days post-contact, confirming horizontal transmission of ASFV-GUS-Vietnam. One of the contact pigs died of ASF on day 23 post-contact, while the other one recovered. The pigs that survived the exposure to ASFV-GUS-Vietnam via the mucosal or parenteral route were fully protected against the highly virulent ASFV Georgia 2007/1 challenge. This study showed that ASFV-GUS-Vietnam field isolate is able to induce complete protection in the majority of the pigs against highly virulent homologous ASFV challenge, but has the potential for horizontal transmission, and can be fatal in some animals. This study highlights the need for proper monitoring and surveillance when ASFV live-attenuated virus-based vaccines are used in the field for ASF control in endemic countries. [ABSTRACT FROM AUTHOR]

Industrial hemp Cannabis sativa L. is an economically important crop mostly grown for its fiber, oil, and seeds. Due to its increasing applications in the pharmaceutical industry and a lack of knowledge of gene functions in cannabinoid biosynthesis pathways, developing an efficient transformation platform for the genetic engineering of industrial hemp has become necessary to enable functional genomic and industrial application studies. A critical step in the development of Agrobacterium tumefaciens-mediated transformation in the hemp genus is the establishment of optimal conditions for T-DNA gene delivery into different explants from which whole plantlets can be regenerated. As a first step in the development of a successful Agrobacterium tumefaciens-mediated transformation method for hemp gene editing, the factors influencing the successful T-DNA integration and expression (as measured by transient β-glucuronidase (GUS) and Green Florescent Protein (GFP) expression) were investigated. In this study, the parameters for an agroinfiltration system in hemp, which applies to the stable transformation method, were optimized. In the present study, we tested different explants, such as 1- to 3-week-old leaves, cotyledons, hypocotyls, root segments, nodal parts, and 2- to 3-week-old leaf-derived calli. We observed that the 3-week-old leaves were the best explant for transient gene expression. Fully expanded 2- to 3-week-old leaf explants, in combination with 30 min of immersion time, 60 µM silver nitrate, 0.5 µM calcium chloride, 150 µM natural phenolic compound acetosyringone, and a bacterial density of OD600nm = 0.4 resulted in the highest GUS and GFP expression. The improved method of genetic transformation established in the present study will be useful for the introduction of foreign genes of interest, using the latest technologies such as genome editing, and studying gene functions that regulate secondary metabolites in hemp. [ABSTRACT FROM AUTHOR]

Promoters are one of the most important components for many gene-based research as they can fine-tune precise gene expression. Many unique plant promoters have been characterized, but strong promoters with dual expression in both monocot and dicot systems are still lacking. In this study, we attempted to make such a promoter by combining specific domains from monocot-infecting pararetroviral-based promoters sugarcane bacilliform virus (SCBV) and banana streak virus (BSV) to a strong dicot-infecting pararetroviral-based promoter mirabilis mosaic virus (MMV). The generated chimeric promoters, MS, SM, MB, and BM, were tested in monocot and dicot systems and further validated in transgenic tobacco plants. We found that the developed chimeric promoters were species-specific (monocot or dicot), which depended on their respective core promoter (CP) region. Furthermore, with this knowledge, deletion-hybrid promoters were developed and evaluated, which led to the development of a unique dual-expressing promoter, MSD3, with high gene expression efficiency (GUS and GFP reporter genes) in rice, pearl millet, and tobacco plants. We conclude that the MSD3 promoter can be an important genetic tool and will be valuable in plant biology research and application.

The rise of Islam-nationalist ideology in Indonesia's political contestation brings various Muslim figures to be involved. One of the most popular in the 2024 General Election is the appearance of ‘Gus’ as a representation of youth and religious politicians. This research focused on the construction of ‘Gus’ as a political image, and explored how their public relations team used visuals as an essential channel for storytelling, persuading, and image building. Adopting the agenda-setting theories and Burke’s dramatist pentad, this research draws the visual framing, answering ‘what is shown’ to the public and ‘how it is characterized’ as a presentation in social media. This research conducts the qualitative data analysis of four figures: Gus Muhaimin Iskandar, Gus Saifullah Yusuf, Gus Taj Yasin Maimoen, and Gus Ahmad Mudlor Ali. As a result, this research validates that the PR team used socially mediated images to build images based on “Islamic idealism”, the power of a local strongman, the leadership, and the point of view to legitimize their political position. To understand the political visual rhetoric, this research adopted the pentadic reading by looking at the element of social media post. It identifies the commodification goals of every figure, and shows where messaging priorities lies.

Promoters are powerful tools for breeding new varieties using transgenic technology. However, the low and unstable expression of target genes is still a limiting factor in Larix kaempferi (Lamb.) Carr (Japanese larch) genetic transformation. In this study, we analyzed L. kaempferi transcriptome data, screened out highly expressed genes, cloned their promoters, and constructed plant expression vectors containing the β-glucuronidase (GUS) reporter gene driven by these promoters. Recombinant vectors were introduced into the L. kaempferi embryogenic callus by means of the Agrobacterium-mediated transient or stable genetic transformation method, and the promoter activity was then determined by measuring GUS expression and its enzyme activity in the transformed materials. Four highly expressed genes were identified: L. kaempferi Zhang Chen Yi-1 (LaZCY-1), Zhang Chen Yi-2 (LaZCY-2), Translationally Controlled Tumor Protein (LaTCTP), and ubiquitin (LaUBQ). The 2000 bp fragments upstream of ATG in these sequences were cloned as promoters and named pLaZCY-1, pLaZCY-2, pLaTCTP, and pLaUBQ. Semi-quantitative and quantitative RT-PCR analyses of transient genetic transformation materials showed that all four promoters could drive GUS expression, indicating that they have promoter activities. Semi-quantitative and quantitative RT-PCR analyses and the histochemical staining of stable genetic transformation materials showed that the pLaUBQ promoter had higher activity than the other three L. kaempferi promoters and the CaMV35S promoter. Thus, the pLaUBQ promoter was suggested to be used in larch genetic transformation.

Multiple cis-acting elements are present in promoter sequences that play critical regulatory roles in gene transcription and expression. In this study, we isolated the cotton FDH (Fiddlehead) gene promoter (pGhFDH) using a real-time reverse transcription-PCR (qRT-PCR) expression analysis and performed a cis-acting elements prediction analysis. The plant expression vector pGhFDH::GUS was constructed using the Gateway approach and was used for the genetic transformation of Arabidopsis and upland cotton plants to obtain transgenic lines. Histochemical staining and a β-glucuronidase (GUS) activity assay showed that the GUS protein was detected in the roots, stems, leaves, inflorescences, and pods of transgenic Arabidopsis thaliana lines. Notably, high GUS activity was observed in different tissues. In the transgenic lines, high GUS activity was detected in different tissues such as leaves, stalks, buds, petals, androecium, endosperm, and fibers, where the pGhFDH-driven GUS expression levels were 3–10-fold higher compared to those under the CaMV 35S promoter at 10–30 days post-anthesis (DPA) during fiber development. The results indicate that pGhFDH can be used as an endogenous constitutive promoter to drive the expression of target genes in various cotton tissues to facilitate functional genomic studies and accelerate cotton molecular breeding. [ABSTRACT FROM AUTHOR]

Humic acids have been widely used for centuries to enhance plant growth and productivity. The beneficial effects of humic acids have been attributed to different functional groups and phytohormone-like compounds enclosed in macrostructure. However, the mechanisms underlying the plant growth-promoting effects of humic acids are only partially understood. We hypothesize that the bio-stimulatory effect of humic acids is mainly due to the modulation of innate pathways of auxin and cytokinin biosynthesis in treated plants. A physiological investigation along with molecular characterization was carried out to understand the mechanism of bio-stimulatory effects of humic acid. A gene expression analysis was performed for the genes involved in auxin and cytokinin biosynthesis pathways in wheat seedlings. Furthermore, Arabidopsis thaliana transgenic lines generated by fusing the auxin-responsive DR5 and cytokinin-responsive ARR5 promoter to ß-glucuronidase (GUS) reporter were used to study the GUS expression analysis in humic acid treated seedlings. This study demonstrates that humic acid treatment improved the shoot and root growth of wheat seedlings. The expression of several genes involved in auxin (Tryptophan Aminotransferase of Arabidopsis and Gretchen Hagen 3.2) and cytokinin (Lonely Guy3) biosynthesis pathways were up-regulated in humic acid-treated seedlings compared to the control. Furthermore, GUS expression analysis showed that bioactive compounds of humic acid stimulate endogenous auxin and cytokinin-like activities. This study is the first report in which using ARR5:GUS lines we demonstrate the biostimulants activity of humic acid. [ABSTRACT FROM AUTHOR]

Flavanone 3-hydroxylase (F3H) catalyzes trihydroxyflavanone formation into dihydroflavonols in the anthocyanin biosynthesis pathway, serving as precursors for anthocyanin synthesis. To investigate the CsF3Ha promoter's regulation in the 'Zijuan' tea plant, we cloned the CsF3Ha gene from this plant. It was up-regulated under various visible light conditions (blue, red, and ultraviolet (UV)) and using plant growth regulators (PGRs), including abscisic acid (ABA), gibberellic acid (GA3), salicylic acid (SA), ethephon, and methyl jasmonate (MeJA). The 1691 bp promoter sequence was cloned. The full-length promoter P1 (1691 bp) and its two deletion derivatives, P2 (890 bp) and P3 (467 bp), were fused with the β-glucuronidase (GUS) reporter gene, and were introduced into tobacco via Agrobacterium-mediated transformation. GUS staining, activity analysis, and relative expression showed that visible light and PGRs responded to promoter fragments. The anthocyanin content analysis revealed a significant increase due to visible light and PGRs. These findings suggest that diverse treatments indirectly enhance anthocyanin accumulation in 'Zijuan' tea plant leaves, establishing a foundation for further research on CsF3Ha promoter activity and its regulatory role in anthocyanin accumulation. [ABSTRACT FROM AUTHOR]

Pollen, as the male gametophyte of plants, plays a critical role in plant sexual reproduction. Investigating pollen-specific promoters not only helps to understand the regulatory mechanisms of pollen development but also provides tissue-specific promoters for plant genetic engineering. Previously, wheat promoter PSG076 was found to confer pollen-specific activity in tobacco. To determine the tissue-specific activity of PSG076 in wheat, a 1.4-kb promoter fragment was fused with the β-glucuronidase (GUS) reporter gene and stably introduced into wheat via particle bombardment. Histochemical analysis in T1 progeny plants showed that the activity of PSG076 promoter was detected specifically in mature pollen and pollen tube. No GUS activity was found in other floral and vegetable tissues. Weak GUS staining was also visible in pollen at 45 days post anthesis (DPA). Further analysis showed that GUS activity was found weakly in middle tricellular pollen grains and increased rapidly as pollen matured. These results indicated that PSG076 promoter has strong activity specifically at late pollen development stage and can be utilized in genetic engineering investigations for creating male sterility in wheat and other plant species for hybrid seed production. [ABSTRACT FROM AUTHOR]

An efficient multiple shoot induction, plant regeneration, and subsequent genetic transformation system for two locally adapted recalcitrant indica rice cultivars ASD16 and ADT43 using shoot apex explants were established. Three different plant growth regulators (PGRs) were tested for their efficacy in forming multiple shoots from shoot apices. Thidiazuron (TDZ) (5.0 mg/L) induced the highest frequencies of multiple shoot induction compared to Benzyl Amino Purine (BAP) and Kinetin (Kin). Shoot apices cultured on MS basal medium devoid of plant growth regulators formed single shoots. All tested PGRs produced multiple shoots at concentrations higher than 3.0 mg/L. Indole-3-Acetic Acid (IAA) and Indole-3-Butyric Acid (IBA) were supplemented to media containing TDZ (5.0 mg/L) for assessing the root induction efficiencies and it was found that media devoid of growth hormones were sufficient to produce better-rooting frequencies comparatively. Among the two tested cultivars, ASD16 responded with better shooting frequencies than ADT43. Further, genetic transformation experiments were carried out with the shoot apex explants of both cultivars. The putative transgenic plants were screened and confirmed by transient GUS expression, PCR, and Southern hybridization in both T0 and T1 generations, respectively. This rapid and efficient regeneration system amenable to Agrobacterium-mediated genetic transformation from shoot apices may be used for genetic manipulation of recalcitrant indica varieties for varietal crop improvement strategies. [ABSTRACT FROM AUTHOR]

The AT-hook motif nuclear-localized (AHL) family is pivotal for the abiotic stress response in plants. However, the function of the cassava AHL genes has not been elucidated. Promoters, as important regulatory elements of gene expression, play a crucial role in stress resistance. In this study, the promoter of the cassava MeAHL31 gene was cloned. The MeAHL31 protein was localized to the cytoplasm and the nucleus. qRT-PCR analysis revealed that the MeAHL31 gene was expressed in almost all tissues tested, and the expression in tuber roots was 321.3 times higher than that in petioles. Promoter analysis showed that the MeAHL31 promoter contains drought, methyl jasmonate (MeJA), abscisic acid (ABA), and gibberellin (GA) cis-acting elements. Expression analysis indicated that the MeAHL31 gene is dramatically affected by treatments with salt, drought, MeJA, ABA, and GA3. Histochemical staining in the proMeAHL31-GUS transgenic Arabidopsis corroborated that the GUS staining was found in most tissues and organs, excluding seeds. Beta-glucuronidase (GUS) activity assays showed that the activities in the proMeAHL31-GUS transgenic Arabidopsis were enhanced by different concentrations of NaCl, mannitol (for simulating drought), and MeJA treatments. The integrated findings suggest that the MeAHL31 promoter responds to the abiotic stresses of salt and drought, and its activity is regulated by the MeJA hormone signal.

Hepatocellular adenomas are benign endothelial tumors of the liver, mostly associated with female individual users of estrogen-containing medications. However, the precise factors underlying the selective development of hepatic adenomas in certain females remain elusive. Additionally, the conventional profile of individuals prone to hepatic adenoma is changing. Notably, male patients exhibit a higher risk of malignant progression of hepatocellular adenomas, and there are instances where hepatic adenomas have no identifiable cause. In this paper, we theorize the role of the human gastrointestinal microbiota, specifically, of bacterial species producing β-glucuronidase enzymes, in the development of hepatic adenomas through the estrogen recycling pathway. Furthermore, we aim to address some of the existing gaps in our knowledge of pathophysiological pathways which are not yet subject to research or need to be studied further. As microbial β-glucuronidases proteins recycle estrogen and facilitate the conversion of inactive estrogen into its active form, this process results in elevated levels of unbound plasmatic estrogen, leading to extended exposure to estrogen. We suggest that an imbalance in the estrobolome could contribute to sex hormone disease evolution and, consequently, to the advancement of hepatocellular adenomas, which are estrogen related. [ABSTRACT FROM AUTHOR]

Phosphorus (P) is an essential macro-nutrient for plant growth and development, and inorganic phosphate (Pi) is the primary form of P taken up by plants. Previous studies have shown that P deficiency influenced the accumulation of flavonoids in plants. However, the mechanisms underlying the interplay between P nutrition and flavonoid accumulation are still largely unclear thus far. In this study, we adopted tobacco plant (Nicotiana tabacum) to study how P nutrition regulates flavonoid biosynthesis and also to investigate whether application of certain flavonoids may in turn influence Pi uptake. We found that P deficiency increased the accumulation of total flavonoids in tobacco shoots, but not in roots, and the transcripts of four genes, NtCHS, NtF3H, NtDFR, and NtFLS, which are involved in flavonol biosynthesis, were significantly increased in leaves under P deficiency. Consistently, the NtCHS promoter could drive a much higher expression level of the GUS (β-Glucuronidase) reporter gene in tobacco leaves treated with low Pi than those treated with high Pi. External application of the flavonol, quercetin, reduced the soluble Pi concentration, but enhanced the Pi-starvation response in tobacco roots. Application of quercetin also weakened the DR5-GUS activity, a reporter for auxin response, in tobacco roots treated with low Pi. RNA sequencing analysis revealed that multiple genes encoding the putative Pi transporters and purple acid phosphatases were up-regulated in tobacco roots by quercetin application. Our results proposed that P deficiency promotes flavonoid biosynthesis in tobacco leaves, and flavonoids could also mediate the regulation of Pi uptake and Pi-starvation signaling, probably via the auxin signaling pathway. [ABSTRACT FROM AUTHOR]

Abiotic stresses, including drought and heavy metals, are detrimental to plant growth and development and enormously reduce agricultural yields. Plants may quickly change their transcriptome in response to various stressful conditions. Plants develop many defense mechanisms to respond to various stresses that can be classified into morphological, physiological, and biochemical responses. Polyphenol oxidases (PPOs) are one of the self-protective enzymes found in plants except for Arabidopsis. Currently, drought and heavy metals were applied exogenously to transgenic A. thaliana lines (transformed with Oryza sativa PPO promoter fused to the GUS reporter gene). The current study mainly focused on the systematic pathway by which plants respond to stressors. The aim of this study is to investigate the effect/expression of PPO and antioxidant defense system against abiotic stresses. A. thaliana was treated with different concentrations of polyethylene glycols. At 30% PEG, maximum fold induction (1.9) was seen after 12 h. Overall, various concentrations (5%, 20%, and 30%) induced PPO expression after 6, 12, and 24 h. Moreover, three different concentrations of Cu (50 µM, 100 µM, 200 µM) and Ni (50 µM, 100 µM, 200 µM) for 6, 12, and 24 h were also applied. It was observed that the expression profiling of the OsPPO promoter induced GUS gene expression in response to Cu and Ni treatments. The maximum fold induction (15.03) of GUS was observed in 100 µM of Cu after 24 h. In the case of Ni, maximum fold induction of (7.78) was observed at 100 µM after 24 h. So, both Cu and Ni showed a similar pattern of induction at 100 µM after 24 h. In conclusion, the efficiency of the PPOGUS promoter can be operated to assess the response of plants to various abiotic stimuli. [ABSTRACT FROM AUTHOR]

In this paper, we report the characterization of a genetically modified live-attenuated African swine fever virus (ASFV) field strain isolated from Vietnam. The isolate, ASFV-GUS-Vietnam, belongs to p72 genotype II, has six multi-gene family (MGF) genes deleted, and an Escherichia coli GusA gene (GUS) inserted. When six 6–8-week-old pigs were inoculated with ASFV-GUS-Vietnam oro-nasally (2 × 105 TCID50/pig), they developed viremia, mild fever, lethargy, and inappetence, and shed the virus in their oral and nasal secretions and feces. One of the pigs developed severe clinical signs and was euthanized 12 days post-infection, while the remaining five pigs recovered. When ASFV-GUS-Vietnam was inoculated intramuscularly (2 × 103 TCID50/pig) into four 6-8 weeks old pigs, they also developed viremia, mild fever, lethargy, inappetence, and shed the virus in their oral and nasal secretions and feces. Two contact pigs housed together with the four intramuscularly inoculated pigs, started to develop fever, viremia, loss of appetite, and lethargy 12 days post-contact, confirming horizontal transmission of ASFV-GUS-Vietnam. One of the contact pigs died of ASF on day 23 post-contact, while the other one recovered. The pigs that survived the exposure to ASFV-GUS-Vietnam via the mucosal or parenteral route were fully protected against the highly virulent ASFV Georgia 2007/1 challenge. This study showed that ASFV-GUS-Vietnam field isolate is able to induce complete protection in the majority of the pigs against highly virulent homologous ASFV challenge, but has the potential for horizontal transmission, and can be fatal in some animals. This study highlights the need for proper monitoring and surveillance when ASFV live-attenuated virus-based vaccines are used in the field for ASF control in endemic countries.

Right and timely expression of the stress regulatory genes is required for plants to compete against abiotic stresses; it necessitates the isolation and characterization of stress-responsive promoters for improving crops' tolerance to abiotic stresses. Dehydration Responsive Element Binding (DREB) regulates the expression of numerous stress-responsive genes in plants and leads an inevitable role in the adaptation of plants to abiotic stresses. In this study, the promoter region of Phoenix dactylifera (Date palm, a major fruit crop of the arid region) PdDREB1G gene was isolated and characterized for the first time. A comparison of the activity of two promoter fragments, 880 bp (DS) and 1.6 kb (DF) of PdDREB1G to AtRD29A was performed. Histochemical assay displayed remarkable GUS staining and RT-qPCR analysis confirmed the induction of GUS expression in T3 plants of transformed tobacco subjected to different abiotic stresses. Furthermore, compared with the widely used AtRD29A promoter, the relative expression of GUS in leaves by DS and DF was three and twofold higher under salt stress, respectively, while it was twofold in polyethylene glycol (PEG) and abscisic acid (ABA) for DS. Under SA stress, DF and DS displayed 1.5 and onefold expression in leaves, respectively. In the root, DS showed a fourfold increased expression in salt, threefold in PEG and ABA, and twofold in SA. Hence, the DS promoter characterized in the present study becomes a choice over RD29A for abiotic stress responses and is useful to develop stress-tolerant transgenic plants by inducing the expression of stress-inducible genes on stress. Key message: Novel inducible promoter DREB1G cloned from the Date palm, a major fruit crop of the arid region, exhibiting high fold expression over AtRD29A to drought and salinity stress is useful to develop stress-tolerant transgenic plants by inducing the expression of stress-inducible genes on stress. [ABSTRACT FROM AUTHOR]

Genetic transformation of plants has emerged as a core research tool for the functional characterization of genes and cultivar improvement in the field of plant biology. Effectually, high transformation efficiency is a prerequisite for accomplishing the stated targets. Aloe vera, a tropical cactus plant in distinction to the family Liliaceae, has seized a long history of secular acceptance as a therapeutic agent and is reasonably the most popular herbal remedy these days. However, the genetic transformation efficiency of Aloe vera is relatively low and seldom reported formerly. This study aims to optimize Agrobacterium-mediated transformation in Aloe vera by refining several parameters like explant selection, the extent of explant injury during infection, Agrobacterium concentration, co-cultivation pH, and duration and desiccation of plant tissue to improve the infection efficiency. The results showed that nearly 83% transient transformation efficiency was attained by suspending the Agrobacterium tumefaciens (AGL1 strain) cells at a concentration of OD600: 0.4 in co-cultivation media at pH-5.6 to infect the stem of aloe by desiccation, followed by 3 days of co-cultivation. Desiccation during infection had proved to enhance T-DNA delivery, whereas a higher extent of explant injury was found to curtail the infection efficiency. The molecular analysis of the putative transformants was carried out by following GUS histochemical assay and PCR. Thereupon, Southern blotting was used to substantiate the authentication of positive transgenic plants and analyze the copy number of the hptII gene in the Aloe vera genome. A transformation efficiency of over 2% was obtained, which is higher than the previous report. This study bestows an improved Agrobacterium-mediated transformation protocol based on desiccation in Aloe vera, which might help in facilitating various functional genomic studies and gene regulation in the aloe plant, eventually allowing the genetic modification of aloe species in an effective manner. Key message: This research deliberates a meliorated Agrobacterium-mediated transformation methodology for Aloe vera, which may facilitate various gene functional investigations and bioengineering of aloe species in an effective salutary way. [ABSTRACT FROM AUTHOR]

Chilling Tolerant Divergence 1 (COLD1) gene consists of Golgi pH Receptor (GPHR) as well as Abscisic Acid-linked G Protein-Coupled Receptor (ABA_GPCR), which are the major transmembrane proteins in plants. This gene expression has been found to be differentially regulated, under various stress conditions, in wild Saccharum-related genera, Erianthus arundinaceus, compared to commercial sugarcane variety. In this study, Rapid Amplification of Genomic Ends (RAGE) technique was employed to isolate the 5′ upstream region of COLD1 gene to gain knowledge about the underlying stress regulatory mechanism. The current study established the cis-acting elements, main promoter regions, and Transcriptional Start Site (TSS) present within the isolated 5′ upstream region (Cold1P) of COLD1, with the help of specific bioinformatics techniques. Phylogenetic analysis results revealed that the isolated Cold1P promoter is closely related to the species, Sorghum bicolor. Cold1P promoter-GUS gene construct was generated in pCAMBIA 1305.1 vector that displayed a constitutive expression of the GUS reporter gene in both monocot as well as dicot plants. The histochemical GUS assay outcomes confirmed that Cold1P can drive expression in both monocot as well as dicot plants. Cold1P's activities under several abiotic stresses such as cold, heat, salt, and drought, revealed its differential expression profile in commercial sugarcane variety. The highest activity of the GUS gene was found after 24 h of cold stress, driven by the isolated Cold1P promoter. The outcomes from GUS fluorimetric assay correlated with that of the GUS expression findings. This is the first report on Cold1P isolated from the species, E. arundinaceus. [ABSTRACT FROM AUTHOR]

Mango (Mangifera indica L.) is one of the most popular tropical fruits in the world owing to its rich taste, flavor, color, production volume and diverse end usage. Conventional mango breeding practices are unable to withstand the demand for improved varieties as it is time consuming and requires heavy investment. However, problems associated with traditional plant breeding can be curtailed through genetic transformation. Nevertheless, major limitation of transgenic development has been its recalcitrant nature toward tissue culture practices involving latent microbial infection, phenol exudation, etc. This opens wide scope for tissue culture-independent in planta transformation approaches These strategies have proved to be easy to execute and cost effective in producing large number of transformants. One such apical meristem targeted in planta approach was successfully exploited to demonstrate its utility in transforming a tree species. Mango variety Amrapali was transformed with two visual marker gene vectors GFP::hptII in pCAMBIA1302 and GUS::nptII in pCAMBIA2301 individually, to demonstrate its amenability. Preliminary confirmations identified 65.0% of GFP and 57.14% of GUS plants to be transformed. Further, molecular characterization of these primary transformants demonstrated transgene integration at genomic and transcript level in some of the plants. This established protocol holds good for functional gene validation and knock in/out studies and aid in mango improvement programs.

A promoter is a region in the genome sequence located upstream of the transcription start site comprising cis acting elements that initiates and regulates the transcription of an associated genes and restriction endonucleases. As the need for genetically engineered plants has widened, the requirement to develop methods to optimize the control of transgene expression has also increased. Therefore, analyzing the functionality of the promoter is very important in understanding the target gene expression. The widespread use of viral constitutive promoters (cauliflower mosaic virus, CaMV35) has raised concerns about the safety and containment of transgene in the environment. Hence isolation and characterization of novel promoters using fast and efficient genetic engineering tools is the need of the hour. The present study, for the first time, describes the isolation and characterization of a novel constitutive promoter driving ubiquitin E3 ligase from the plant Coleus amboinicus, a perennial herb, of the Lamiaceae family. The functionality of the isolated promoter was demonstrated using the β ‐glucuronidase as a reporter in tobacco var Petit havana. The development of blue color in the tobacco leaves indicated the presence of a functional promoter. [ABSTRACT FROM AUTHOR]

Generation of crops with broad-spectrum tolerance to biotic and abiotic stress conditions depends upon availability of genetic elements suitable for varied situations and diverse genotypes. Here, we characterize the 5′-upstream regulatory region of flavonoid 3′5′-hydroxylase-1 (F3′5′H-1) gene from banana and analyzed its tissue-specific and stress-mediated activation in genetic background of tobacco plants. MusaF3′5′H-1 is a stress-responsive gene as its expression is induced in banana after application of salicylic acid and methyl jasmonate while its transcript levels were drastically reduced in response to drought, high salinity and abscisic acid. PMusaF3′5′H-1 harbours cis-elements associated with stress conditions and those responsible for tissue-specific expression. Transgenic lines harbouring PMusaF3′5′H-1-GUS displays strong GUS expression in guard cells of stomata indicating guard cell preferred activity of PMusaF3′5′H-1 while its activity was undetectable in roots. Drought and high salinity induce strong expression of GUS in transgenic tobacco lines and exposure to abscisic acid, salicylic acid and methyl jasmonate revealed distinct profiles of GUS expression in transgenic lines confirming involvement of F3′5′H-1 in plant stress responses. Fluorescent β-galactosidase assay revealed induction profiles of PMusaF3′5′H-1 at different time points in transgenic lines exposed to salicylic acid and abscisic acid while strong suppression in GUS expression was observed after application of methyl jasmonate. The guard cell preferred activity of PMusaF3′5′H-1 and stress-mediated expression profiles of MusaF3′5′H-1 indicated the suitability of PMusaF3′5′H-1 for generating stress-enduring crops and analyzing guard cell functions. [ABSTRACT FROM AUTHOR]

Industrial hemp Cannabis sativa L. is an economically important crop mostly grown for its fiber, oil, and seeds. Due to its increasing applications in the pharmaceutical industry and a lack of knowledge of gene functions in cannabinoid biosynthesis pathways, developing an efficient transformation platform for the genetic engineering of industrial hemp has become necessary to enable functional genomic and industrial application studies. A critical step in the development of Agrobacterium tumefaciens-mediated transformation in the hemp genus is the establishment of optimal conditions for T-DNA gene delivery into different explants from which whole plantlets can be regenerated. As a first step in the development of a successful Agrobacterium tumefaciens-mediated transformation method for hemp gene editing, the factors influencing the successful T-DNA integration and expression (as measured by transient β-glucuronidase (GUS) and Green Florescent Protein (GFP) expression) were investigated. In this study, the parameters for an agroinfiltration system in hemp, which applies to the stable transformation method, were optimized. In the present study, we tested different explants, such as 1- to 3-week-old leaves, cotyledons, hypocotyls, root segments, nodal parts, and 2- to 3-week-old leaf-derived calli. We observed that the 3-week-old leaves were the best explant for transient gene expression. Fully expanded 2- to 3-week-old leaf explants, in combination with 30 min of immersion time, 60 µM silver nitrate, 0.5 µM calcium chloride, 150 µM natural phenolic compound acetosyringone, and a bacterial density of OD600nm = 0.4 resulted in the highest GUS and GFP expression. The improved method of genetic transformation established in the present study will be useful for the introduction of foreign genes of interest, using the latest technologies such as genome editing, and studying gene functions that regulate secondary metabolites in hemp.

Flavanone 3-hydroxylase (F3H) catalyzes trihydroxyflavanone formation into dihydroflavonols in the anthocyanin biosynthesis pathway, serving as precursors for anthocyanin synthesis. To investigate the CsF3Ha promoter’s regulation in the ‘Zijuan’ tea plant, we cloned the CsF3Ha gene from this plant. It was up-regulated under various visible light conditions (blue, red, and ultraviolet (UV)) and using plant growth regulators (PGRs), including abscisic acid (ABA), gibberellic acid (GA3), salicylic acid (SA), ethephon, and methyl jasmonate (MeJA). The 1691 bp promoter sequence was cloned. The full-length promoter P1 (1691 bp) and its two deletion derivatives, P2 (890 bp) and P3 (467 bp), were fused with the β-glucuronidase (GUS) reporter gene, and were introduced into tobacco via Agrobacterium-mediated transformation. GUS staining, activity analysis, and relative expression showed that visible light and PGRs responded to promoter fragments. The anthocyanin content analysis revealed a significant increase due to visible light and PGRs. These findings suggest that diverse treatments indirectly enhance anthocyanin accumulation in ‘Zijuan’ tea plant leaves, establishing a foundation for further research on CsF3Ha promoter activity and its regulatory role in anthocyanin accumulation.

Polyamine oxidases (PAOs) have been correlated with numerous physiological and developmental processes, as well as responses to biotic and abiotic stress conditions. Their transcriptional regulation is driven by signals generated by various developmental and environmental cues, including phytohormones. However, the inductive mechanism(s) of the corresponding genes remains elusive. Out of the five previously characterized Arabidopsis PAO genes, none of their regulatory sequences have been analyzed to date. In this study, a GUS reporter-aided promoter deletion approach was used to investigate the transcriptional regulation of AtPAO3 during normal growth and development as well as under various inductive environments. AtPAO3 contains an upstream open reading frame (uORF) and a short inter-cistronic sequence, while the integrity of both appears to be crucial for the proper regulation of gene expression. The full-length promoter contains several cis-acting elements that regulate the tissue-specific expression of AtPAO3 during normal growth and development. Furthermore, a number of TFBS that are involved in gene induction under various abiotic stress conditions display an additive effect on gene expression. Taken together, our data indicate that the transcription of AtPAO3 is regulated by multiple environmental factors, which probably work alongside hormonal signals and shed light on the fine-tuning mechanisms of PAO regulation. [ABSTRACT FROM AUTHOR]

Main conclusion: We characterized an efficient chimeric sub-genomic transcript promoter from Horseradish Latent Virus, FHS4, active in both dicot and monocot plants, and it could be a potential tool for plant biotechnology. Plant pararetroviruses are a rich source of novel plant promoters widely used for biotechnological applications. Here, we comprehensively characterized a unique sub-genomic transcript (Sgt) promoter of Horseradish Latent Virus (HRLV) and identified a fragment (HS4; − 340 to + 10; 351 bp) that showed the highest expression of reporter genes in both transient and transgenic assays as evidenced by biochemical, histochemical GUS reporter assay and transcript analysis of uidA gene by qRT-PCR. Phylogenetic analysis showed that the HSgt promoter was closely related to the sub-genomic promoter of the Cauliflower Mosaic Virus (CaMV19S). We found that the as-1 element and W-box played an important role in the transcriptional activity of the HS4 promoter. Furthermore, the HS4 promoter was also induced by salicylic acid. Alongside, we enhanced the activity of the HS4 promoter by coupling the enhancer region from Figwort Mosaic Virus (FMV) promoter to the upstream region of it. This hybrid promoter FHS4 was around 1.1 times stronger than the most commonly used promoter, 35S (Cauliflower Mosaic Virus full-length transcript promoter), and was efficient in driving reporter genes in both dicot and monocot plants. Subsequently, transgenic tobacco plants expressing an anti-microbial peptide BrLTP2.1 (Brassica rapa lipid transport protein 2.1), under the control of the FHS4 promoter, were developed. The in vitro anti-fungal assay revealed that the plant-derived BrLTP2.1 protein driven by an FHS4 promoter manifested increased resistance against an important plant fungal pathogen, Alternaria alternata. Finally, we concluded that the FHS4 promoter can be used as an alternative to the 35S promoter and has a high potential to become an efficient tool in plant biotechnology. [ABSTRACT FROM AUTHOR]

Chimeric editing is often reported in gene editing. To assess how the general chimeric editing is, we created a transgenic tobacco line carrying a marker, beta-glucuronidase gene (gusA), introduced a CRISPR-Cas9 editing vector into the transgenic tobacco line for knocking out gusA, and then investigated the gusA editing efficiencies in T0 and subsequent generations. The editing vector carried a Cas9 gene, which was driven by the cauliflower mosaic virus 35S promoter, and two guide RNAs, gRNA1 and gRNA2, which were driven by Arabidopsis U6 (AtU6) and U3 (AtU3) promoter, respectively. The two gRNAs were designed to knock out a 42-nucleotide fragment of the coding region of gusA. The editing vector was transformed into gusA-containing tobacco leaves using Agrobacterium tumefaciens-mediated transformation and hygromycin selection. Hygromycin-resistant, independent T0 transgenic lines were used to evaluate gusA-editing efficiencies through histochemical GUS assays, polymerase chain reactions (PCR), and next-generation sequencing of PCR amplicons. Profiles of targeted sequences of 94 T0 transgenic lines revealed that these lines were regenerated from non-edited cells where subsequent editing occurred and created chimeric-edited cells in these lines during or after regeneration. Two of them had the target fragment of 42 bp pairs of nucleotides removed. Detail analysis showed that on-target mutations at the AtU6-gRNA1 site and the AtU3-gRNA2 site were found in 4.3% and 77.7% of T0 transgenic lines, respectively. To overcome the issue of extremely low editing efficiencies in T0 lines, we conducted a second round of shoot induction from the chimeric line(s) to enhance the success of obtaining lines with all or most cells edited. The mutation profiles in T0 transgenic lines provide valuable information to understand gene editing in plant cells with constitutively expressed CRISPR-Cas9 and gRNAs. [ABSTRACT FROM AUTHOR]

Hepatocellular adenomas are benign endothelial tumors of the liver, mostly associated with female individual users of estrogen-containing medications. However, the precise factors underlying the selective development of hepatic adenomas in certain females remain elusive. Additionally, the conventional profile of individuals prone to hepatic adenoma is changing. Notably, male patients exhibit a higher risk of malignant progression of hepatocellular adenomas, and there are instances where hepatic adenomas have no identifiable cause. In this paper, we theorize the role of the human gastrointestinal microbiota, specifically, of bacterial species producing β-glucuronidase enzymes, in the development of hepatic adenomas through the estrogen recycling pathway. Furthermore, we aim to address some of the existing gaps in our knowledge of pathophysiological pathways which are not yet subject to research or need to be studied further. As microbial β-glucuronidases proteins recycle estrogen and facilitate the conversion of inactive estrogen into its active form, this process results in elevated levels of unbound plasmatic estrogen, leading to extended exposure to estrogen. We suggest that an imbalance in the estrobolome could contribute to sex hormone disease evolution and, consequently, to the advancement of hepatocellular adenomas, which are estrogen related.

Tonoplast intrinsic proteins (TIPs), a sub-family of aquaporins (AQPs), are known to play important roles in plant abiotic stress responses. However, evidence for the promoters of TIPs involvement in abiotic stress processes remains scarce. In this study, the promoter of the vegetable soybean GmTIP1;6 gene, which had the highest similarity to TIP1-type AQPs from other plants, was cloned. Expression pattern analyses indicated that the GmTIP1;6 gene was dramatically induced by drought, salt, abscisic acid (ABA), and methyl jasmonate (MeJA) stimuli. Promoter analyses revealed that the GmTIP1;6 promoter contained drought, ABA, and MeJA cis-acting elements. Histochemical staining of the GmTIP1;6 promoter in transgenic Arabidopsis corroborated that it was strongly expressed in the vascular bundles of leaves, stems, and roots. Beta-glucuronidase (GUS) activity assays showed that the activities of the GmTIP1;6 promoter were enhanced by different concentrations of polyethylene glycol 6000 (PEG 6000), NaCl, ABA, and MEJA treatments. Integrating these results revealed that the GmTIP1;6 promoter could be applied for improving the tolerance to abiotic stresses of the transgenic plants by promoting the expression of vegetable soybean AQPs. [ABSTRACT FROM AUTHOR]

We developed transgenic Nicotiana plumbaginifolia hairy roots with sucrose-inducible minimal promoter (Spomin)-β-glucuronidase (GUS) gene–fused constructs with signal sequences for sorting to cytosol, apoplast, and ER, and we analyzed the GUS activities of hairy roots after sucrose treatment. Induced GUS activities by Spomin were about 10 times higher than those by the CaMV 35S promoter. GUS activities in hairy roots induced with a Spomin-UTR-GUS construct after 6% sucrose treatment were higher than those with either Spomin-UTR-GUS construct after 10% sucrose treatment, Spomin-apoplast or ER-GUS constructs after sucrose treatment. High GUS activities in hairy roots with Spomin constructs were induced during 20 wk by culturing hairy roots in LS liquid medium containing 6% sucrose in 300 ml conical flasks. Hairy roots in Linsmaier and Skoog (LS) liquid medium showed the increase of fresh weight (FW) for 16 wk. Total yield (μg) of GUS by the hairy roots with Spomin-UTR-GUS construct using 5 l culture container was calculated to about 6742 μg after 8-wk culture. Productive efficiencies of GUS were over 3.0% of total soluble protein after 1–2 wk 6% sucrose treatment. Productive efficiencies of GUS in transgenic N. plumbaginifolia hairy roots were higher than that in transgenic N. plumbaginifolia leaves, stems, and roots. And growth speeds of transgenic N. plumbaginifolia hairy roots were faster than transgenic N. plumbaginifolia plants. These results showed that N. plumbaginifolia hairy roots with Spomin-heterologous construct systems and sucrose treatment would be useful tools to develop protein production system. [ABSTRACT FROM AUTHOR]

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant. [ABSTRACT FROM AUTHOR]

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

To study the morphogenesis mechanism of leaf primordium differentiation, we used Liriodendron tulipifera to clone 2 001 bp upstream region of LtAGO1 CDS as the promoter by RT-PCR and RACE technology and predicted its function, and we also used real-time PCR to investigate expression patterns in Liriodendron, obtained the transgenic Arabidopsis thaliana of ProAGO1∷GUS by resistance screening and DNA dentification, and then monitored phenotype and GUS histochemical staining. The results were as follows:（1） The LtAGO1 gene included an open reading frame for 3 300 bp, encoding 1 100 amino acid, the molecular weight was 122.14 kD and theoretical isoelectric point（pI） was 9.36.（2）Amino acid sequence analysis showed that LtAGO1 consisted of Gly-rich-AGO1 and Piwi conserved domains of AGO family. Phylogenetic trees revealed that LtAGO1 was closed to Cinnamomum micranthum（RWR84608.1） in evolutional relationship.（3）The specific tissue expression analysis demonstrated that the expression order was stamen>floral bud>petal>calyx>leaf>pistil>leaf bud>stem among tissues, the expression order was leaf bud sprouting stage >young leaf stage>senescence stage >mature stage among stages, it was highly expressed in the leaf margin of Liriodendron L., and LtAGO1 gene expression in leaf tooth sinus was higher than that in leaf tooth tip of Liriodendron tulipifera.（4）The transgenic strains leaf polarity of the medio-lateral and proximo-distal axis were absent with serrated leaf margin and double petal flower. It was found that GUS staining was stably detected at the tip of leaf bud of transgenic seedlings, and higher GUS activity was observed at newly differentiated petioles. ProAGO1 promoter drove GUS gene to accumulate specifically in the vascular bundle of Arabidopsis thaliana leaf, flower, pod and stem, and GUS activity intensity order was leaf tip bud> flower>vascular bundle among tissues, which was in accordance with the real-time PCR results. Therefore, the LtAGO1 gene is predominantly expressed in apical meristem and is regulated by various pathways during the development of leaf and flower. The results provide a theoretical basis for further functional research of the LtAGO1 gene in Liriodendron tulipifera and regulation mechanism of leaf shape development. [ABSTRACT FROM AUTHOR]

A reliable and stable Agrobacterium-mediated genetic transformation system for Artemisia pallens has been developed using cell suspension cultures derived from cotyledon explants. Cotyledon, attached cotyledon, and compound leaves were found to be suitable for the induction of callus among five different types of explants tested. The yellow friable callus derived from attached cotyledon was used to initiate suspension cultures in Suspension Culture Medium (SCM) which was supplemented with 2,4-dichlorophenoxyacetic acid (2,4-D) at 2.0 mg L−1 and in combination with different concentrations of Zeatin (ZEA) at 0.25 mg L−1. Two different shock treatments, cold shock (at 4 ℃) for 20 min and heat shock (at 45 ℃) treatment for 5 min, heat shock treatment increased the transformation efficiency. The supplementation of Pluronic F-68 (0.05%) significantly enhanced the transformation efficiency of suspension cultures, whereas Silwet L-77 (0.05%) leads to more browning of the cells and reduced the transformation efficiency. The maximum GUS intensity was recorded with an optimal intensity of blue spots in the transformed cells. The highest GUS fluorometric activity measured was 879.4 ± 113.7 nmol 4MU/mg/min in transformed cell suspension cultures. The hygromycin-resistant calli showed intense blue color in GUS histochemical assay. The transgene integration into the plant genome was confirmed by polymerase chain reaction (PCR) using uidA specific primers in six hygromycin-resistant cell lines. The partial coding sequence of three candidate reference genes, i.e., ADP-ribosylation factor (Arf), β-actin (Act), and ubiquitin (Ubi), and carotenoid biosynthesis pathway gene, i.e., Phytoene desaturase (Pds) were cloned, sequenced, and submitted to NCBI for the first time. The quantitative mRNA expression of the transgene (uidA) and internal ApPds gene were evaluated in transgenic callus lines. The present Agrobacterium-mediated genetic transformation protocol could help in better understanding of the metabolic pathways of this medicinally important plant and its genetic improvement. [ABSTRACT FROM AUTHOR]