Search

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and blackskinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different redskinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of longterm interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish. [ABSTRACT FROM AUTHOR]

The back-reef depressions, or lagoons, of Reunion Island (western Indian Ocean) host a high abundance of organisms living amongst the coral reefs and are critical sites for artisanal fishing, tourism, and shoreline stability for the island. Over time, increasing degradation of Reunionese reefs has been observed due to overexploitation, beach erosion and eutrophication. Efforts to mitigate the impact of these pressures on aquatic organisms include biodiversity surveys primarily performed through visual censuses that can be logistically complex and may unintentionally overlook organisms. Surveys integrating environmental DNA (eDNA) collections have provided rapid biodiversity assessments, while helping to circumvent some limitations of visual surveys. The present study describes the results of an exploratory eDNA survey, which aims to characterize metazoan communities of four Reunionese lagoons located along the west coast of the island. As eDNA surveys first require deliberate study design and optimization for each new context, we sought to establish a modernized workflow implementing specialized equipment to collect and preserve samples to facilitate future studies in these lagoons. During the austral summer of 2023, samples were pumped directly from surface and bottom depths at each site through self-preserving filters which were then processed for DNA metabarcoding using regions of the 12S ribosomal RNA (12S), small ribosomal subunit 18S (18S) and Cytochrome Oxidase I (COI) genes. The survey detected high species richness that varied by site, and in a single collection period, recovered the presence of 60 teleost families and numerous invertebrate taxa, including members of the coral faunal community that are less studied in Reunion. Distinct biological communities were observed at each site, and within a single lagoon, suggesting that these differences are due to site-specific factors (e.g., environmental variables, geographic distance, etc.). Although continued protocol optimization is needed, the present findings demonstrate the successful application of an eDNA-based survey for biodiversity assessment within Reunionese lagoons. [ABSTRACT FROM AUTHOR]

Coral reef ecosystems show fluctuations in their prevailing light environment in response to both regular (e.g. between seasons) and more prevalent stochastic events (e.g. human‐induced sediment runoff). In these shifting environments, phenotypic plasticity provides an essential mechanism for coral reef fishes to adjust their visual capability to meet changing sensory requirements. Here, we evaluate the growing area of research that highlights the many genetic and ecological mechanisms that affect the plastic responses of coral reef fish vision to environmental cues. With an increasing number of disturbances in the marine environment, it is critical to understand the extent and limits of visual plasticity under natural and disturbed conditions. With our current knowledge and drawing upon a large body of work in freshwater fishes, we speculate whether coral reef fishes can adapt to the changes to their visual environment and where the limitations could lie. Whilst coral reef fishes have shown visual adaptations under different light environments, the degree of plasticity is inconsistent between species. Thus, plasticity may not only be functionally significant in maintaining the performance of visually guided behaviours for single species but, more broadly, is likely key to sustaining ecosystem function. Read the free Plain Language Summary for this article on the Journal blog. [ABSTRACT FROM AUTHOR]

This article, titled "Shortened Food Chain Length in a Fished vs. Unfished Coral Reef," explores the impact of fishing on the trophic architecture of coral reef ecosystems. The study conducted in two high-diversity coral reef ecosystems found that moderate intensity fishing pressure led to significant reductions in the trophic position of top predators, but not in lower level consumers. There were also no changes in basal resource consumption, indicating a compression in overall food chain length. The article includes photographs illustrating the impact of fishing on coral reefs. [Extracted from the article]

Metamorphosis is a critical aspect of coral reef fish ecology. This developmental milestone marks changes in form and function that permit successful transition of pelagic larvae to the demersal lifestyle on coral reefs. However, we know very little about the physiological changes that occur during this period, specifically potential changes in energetics associated with swimming. This is critical, as swimming is the mechanism by which pelagic larvae find a suitable reef on which to settle. Coral grouper larvae (Serranidae: Plectropomas leopardus) were collected at night as they came into the vicinity of a fringing reef to settle, and their physiological metamorphosis was characterized. Larvae and 24 h-settled juveniles were exposed to an endurance swimming test at ecologically relevant swimming speeds, and oxygen uptake rates were measured during activity. To describe how aerobic and anaerobic properties of tissues change during metamorphosis, we also measured whole body citrate synthase and lactate dehydrogenase activity, respectively, as well as mitochondrial density in the trunk and pectoral fins. Our approach accurately measures the oxygen uptake rates these life stages need during the recruitment process, with larvae having a 74% higher mass-specific oxygen uptake rate (ṀO2) than settled juveniles despite swimming at speeds that are only 1.5 body-lengths per second (BLs−1) faster. Citrate synthase activity significantly decreased upon settlement; as larvae had 3.7 times higher activities than juveniles, suggesting that rapid changes in aerobic metabolism of tissues may be an important process during metamorphosis in this species. In contrast, lactate dehydrogenase did not significantly differ upon settlement. These findings highlight some physiological modifications that pelagic coral grouper larvae undertake within 24 h that contribute to successfully settling onto a coral reef. [ABSTRACT FROM AUTHOR]

Interpreting and responding to environmental cues from different modalities has survival value. In fish, the role of multimodal perception has been studied in regard to both foraging and risk assessment, with modalities including vision, olfaction, and mechanoreception via lateral lines. We studied reef fish boldness by placing novel objects that obstructed vision, lateral line use, or both into a coral reef environment with native algal samples inside, and then quantifying exploration as a function of obstruction type and as a function of functional diet groups (herbivores, omnivores, carnivores). Fish were more neophobic with more sensory obstructions, displaying longer latencies to visitation across all novel objects. Fish were also less likely to pass by objects that blocked multiple perceptual modalities. Across diets, there is early evidence that different functional groups respond differently to novelty. However, this conclusion requires further study. Overall, our findings provide key insights into perceptual ecology. In turn, this knowledge can be applied to understanding the effects of novel anthropogenic modifications in the marine environment. Such modifications may include positive activities like the construction of substrates to restore coral reefs, coral transplantation to restore reefs, as well as the negative consequences of construction and pollution. [ABSTRACT FROM AUTHOR]

Identification of fish larvae based on morphology is typically limited to higher taxonomic ranks (e.g., family or order), as larvae possess few morphological diagnostic characters for precise discrimination to species. When many samples are presented at any one time, the use of morphology to identify such specimens can be laborious and time‐consuming. Using a reverse workflow for specimen sorting and identification leveraging high‐throughput DNA sequencing, thousands of fish larvae can be DNA barcoded and sorted into molecular operational taxonomic units (mOTUs) in a single sequencing run with the nanopore sequencing technology (e.g., MinION). This process reduces the time and financial costs of morphology‐based sorting and instead deploys experienced taxonomists for species taxonomic work where they are needed most. In this study, a total of 3022 fish larval specimens from plankton tows across four sites in Singapore were collected and sorted based on this workflow. Eye tissue from individual samples was used for DNA extraction and sequencing of cytochrome c oxidase subunit I. We generated a total of 2746 barcodes after quality filtering (90.9% barcoding success), identified 2067 DNA barcodes (75.3% identification success), and delimited 256 mOTUs (146 genera, 52 families). Our analyses identified specific challenges to species assignment, such as the potential misidentification of publicly available sequences used as reference barcodes. We highlighted how the conservative application and comparison of a local sequence database can help resolve identification conflicts. Overall, this proposed approach enables and expedites taxonomic identification of fish larvae, contributing to the enhancement of reference barcode databases and potentially better understanding of fish connectivity. [ABSTRACT FROM AUTHOR]

Simple Summary: Coral reef fish diversity forms the foundation of their adaptability. A comprehensive understanding of coral reef fish diversity is crucial for the conservation of both coral reefs and their associated fish species. In this study, we employed three taxonomic diversity indices to analyze the characteristics and changes in taxonomic diversity within a representative coral reef (Meiji Reef) located in the South China Sea from 1998 to 2018. Fish species richness played a significant role in shaping the diversity of coral reef fish families and genera within the South China Sea region. Contrary to findings from 1998–1999, there had been a relative increase in fish family diversity at Meiji Reef during 2017–2018. Distribution patterns among different coral reef fish communities across taxonomic levels exhibited varying degrees of unevenness within the South China Sea region. The changes observed in the taxonomic distinctness index between 1998–1999 and 2016–2018 indicated greater dissimilarity among species relationships and reduced taxonomic uniformity. Coral reef fish are important groups of coral reefs, which have great economic and ecological value. Meiji Reef is a representative tropical semi-enclosed atoll in the South China Sea, with rich fish resources. Based on the data from hand-fishing, line-fishing, and gillnet surveys of fish in Meiji Reef from 1998 to 2018, this study summarized the fish species list of Meiji Reef and analyzed the species composition, inclusion index at the taxonomic level (TINCL), genus–family diversity index (G–F index), average taxonomic distinctness index (Δ+), and variation in taxonomic distinctness (Λ+) and their changes. The results revealed that from 1998 to 2018, there were 166 reef-dwelling fish species on Meiji Reef, belonging to 69 genera, 33 families, and 11 orders, of which 128 species were from 20 families of Perciformes, accounting for 77.10% of the total cataloged species. Regarding the dependence of fish on coral reefs, there were 155 reef-dependent species or resident species (accounting for 93.37%) and 11 reef-independent species or wandering species (accounting for 6.63%). The TINCL of the order, families, and genus of fish in Meiji Reef were very high. The genus diversity index (G index), family diversity index (F index), and G–F index of fish in Meiji Reef were very high, and the G index of fish in Meiji Reef in 1998–1999 was higher than that in 2016–2018. The Δ+ and Λ+ values of fish in Meiji Reef from 1998 to 2018 were 56.1 and 148.5, respectively. Compared with 1998–1999, Δ+ and Λ+ of fish increased during 2016–2018, reflecting that the relatives of fish in Meiji Reef became further distant, and the uniformity of taxonomic relationships among species decreased. The research findings indicated that fish exhibited a high taxonomic diversity in Meiji Reef; however, it also revealed significant fluctuations in the fish diversity of Meiji Reef over an extended period, emphasizing the urgent need for timely protection measures. This investigation significantly contributes to our comprehension of the intricate dynamics governing fish species within Meiji Reef and holds broader implications for biodiversity conservation in tropical marine ecosystems. [ABSTRACT FROM AUTHOR]

There has been substantial research on the factors that structure reef fish assemblages, but this has mostly focused on nearshore or continental reefs. This study examines patterns of abundance and species composition for two iconic groups of coral reef fishes, angelfishes (family Pomacanthidae) and butterflyfishes (family Chaetodontidae) at two isolated, oceanic reefs in the Indian Ocean: Christmas Island and the Cocos (Keeling) Islands. Six explanatory variables were investigated to determine whether large-scale physical factors are more important than fine-scale biotic factors in structuring reef fish communities on oceanic islands. For angelfishes, depth was the factor that most explained patterns in abundance (explaining 46.5% of the variation), species richness (44.8%) and composition (15.3%), with both abundance and species richness being greater at 20 m than at 5 m. Differences in species composition were greater between depths than between islands. For butterflyfishes, variation in abundance and species richness was best explained by the difference in aspect or exposure among sites, though abundance and composition also differed significantly between Christmas Island and the Cocos (Keeling) Islands. Large-scale variation in the structure of these reef fish assemblages could not be explained based on differences in habitat diversity, or coral and algal cover. This study indicates that large-scale physical factors (island location, exposure, depth) are more important than fine-scale biotic factors in structuring reef fish assemblages on oceanic islands. [ABSTRACT FROM AUTHOR]

Microhabitat associated fishes are expected to be negatively affected by coral reef degradation, given that many species are coral dwellers. However, the factors underlying this negative impact and the spatial scale(s) at which it occurs are poorly understood. We explored how habitat quality metrics and host preferences influence fish abundance across multiple spatial scales, using the functionally important cleaner fish Elacatinus evelynae as a study species. We surveyed fish at 10 sites in Curaçao that varied in coral cover and health. At the microhabitat scale, we found that E. evelynae group size increases on large, healthy corals and on some coral host species, namely Montastraea cavernosa. We also found that, although E. evelynae can occupy at least 10 coral host species, it selectively inhabits just three corals: M. cavernosa, Colpophyllia natans, and Diploria labrynthiformis. Scaling up to explore goby abundance along 30‐m transects, we did not find a clear relationship between live coral cover and goby abundance. However, goby abundance was substantially higher at one location with elevated coral cover and a high relative abundance of E. evelynae host species. Collectively, these results confirm that E. evelynae abundance is impacted by reef health. They also indicate that the species' long‐term persistence may depend on both the maintenance of healthy coral hosts and the gobies' plasticity in host preferences on changing reefscapes. Cryptobenthic fishes such as E. evelynae play a vital role in the ecosystem and understanding drivers of their abundance is important as reefs face increased degradation. [ABSTRACT FROM AUTHOR]

Division of roles was observed during group hunting by the false cleanerfish, Aspidontus taeniatus (Blenniidae), when they raid the nests of the damselfish (Pomacentridae) and eat their guarded eggs. In this paper, we provide the first description of the collaborative group egg-eating behavior by the false cleanerfish. When raiding the nests of the three-spot dascyllus, Dascyllus trimaculatus, whose eggs are guarded by parents, the false cleanerfish divided roles as follows: "decoy" or "watcher" to draw attention and attract attacks from the parents, and "hider" or "intruder" to avoid detection by the parents and invade the nest. The potential differential costs associated with each role are unique among examples of group hunting strategies in fishes. However, once any individual in the group successfully invaded the nest, all individuals quickly achieved successful predation of the eggs and gained immediate shared benefit. We propose that the group egg-eating behavior of the false cleanerfish not only reinforces the evidence that fish can collaborate with other individuals but also suggests the hypothesis that collaborative hunting can evolve through mutualism even in fishes. Digital video images related to the article are available at http://www.momo-p.com/showdetail-e.php?movieid=momo240411at01a, and http://www.momo-p.com/showdetail-e.php?movieid=momo240411at02a. [ABSTRACT FROM AUTHOR]

Diet has been identified as a major driver of reef fish lineage diversification, producing one of the most speciose vertebrate assemblages today. Yet, there is minimal understanding of how, when and why diet itself has evolved. To address this, we used a comprehensive gut content dataset, alongside a recently developed phylogenetic comparative method to assess multivariate prey use across a diverse animal assemblage, coral reef fishes. Specifically, we investigated the diversification, transitions and phylogenetic conservatism of fish diets through evolutionary time. We found two major pulses of diet diversification: one at the end-Cretaceous and one during the Eocene, suggesting that the Cretaceous–Palaeogene mass extinction probably provided the initial ecological landscape for fish diets to diversify. The birth of modern families during the Eocene then provided the foundation for a second wave of dietary expansion. Together, our findings showcase the role of extinction rebound events in shaping the dietary diversity of fishes on present-day coral reefs. [ABSTRACT FROM AUTHOR]

Coral reefs rely heavily on reef fish for their health, yet overfishing has resulted in their decline, leading to an increase in fast-growing algae and changes in reef ecosystems, a phenomenon described as the phase-shift. A clearer understanding of the intricate interplay between herbivorous, their food, and their gut microbiomes could enhance reef health. This study examines the gut microbiome and isotopic markers (δ13C and δ15N) of four key nominally herbivorous reef fish species (Acanthurus chirurgus, Kyphosus sp., Scarus trispinosus, and Sparisoma axillare) in the Southwestern Atlantic's Abrolhos Reef systems. Approximately 16.8 million 16S rRNA sequences were produced for the four fish species, with an average of 317,047 ± 57,007 per species. Bacteria such as Proteobacteria, Firmicutes, and Cyanobacteria were prevalent in their microbiomes. These fish show unique microbiomes that result from co-diversification, diet, and restricted movement. Coral-associated bacteria (Endozoicomonas, Rhizobia, and Ruegeria) were found in abundance in the gut contents of the parrotfish species Sc. trispinosus and Sp. axillare. These parrotfishes could aid coral health by disseminating such beneficial bacteria across the reef. Meanwhile, Kyphosus sp. predominantly had Pirellulaceae and Rhodobacteraceae. Four fish species had a diet composed of turf components (filamentous Cyanobacteria) and brown algae (Dictyopteris). They also had similar isotopic niches, suggesting they shared food sources. A significant difference was observed between the isotopic signature of fish muscular gut tissue and gut contents, pointing to the role that host genetics and gut microbes play in differentiating fish tissues. [ABSTRACT FROM AUTHOR]

Animal gut microbiomes are critical to host physiology and fitness. The gut microbiomes of fishes—the most abundant and diverse vertebrate clade—have received little attention relative to other clades. Coral reef fishes, in particular, make up a wide range of evolutionary histories and feeding ecologies that are likely associated with gut microbiome diversity. The repeated evolution of herbivory in fishes and mammals also allows us to examine microbiome similarity in relationship to diet across the entire vertebrate tree of life. Here, we generate a large coral reef fish gut microbiome dataset (n = 499 samples, 19 species) and combine it with a diverse aggregation of public microbiome data (n = 447) to show that host diet drives significant convergence between coral reef fish and mammalian gut microbiomes. We demonstrate that this similarity is largely driven by carnivory and herbivory and that herbivorous and carnivorous hosts exhibit distinct microbial compositions across fish and mammals. We also show that fish and mammal gut microbiomes share prominent microbial taxa, including Ruminoccocus spp. and Akkermansia spp., and predicted metabolic pathways. Despite the major evolutionary and ecological differences between fishes and mammals, our results reveal that their gut microbiomes undergo similar dietary selective pressures. Thus, diet, in addition to phylosymbiosis must be considered even when comparing the gut microbiomes of distantly related hosts. [ABSTRACT FROM AUTHOR]

Coral reefs are biodiverse marine ecosystems that are undergoing rapid changes, making monitoring vital as we seek to manage and mitigate stressors. Healthy reef soundscapes are rich with sounds, enabling passive acoustic recording and soundscape analyses to emerge as cost-effective, long-term methods for monitoring reef communities. Yet most biological reef sounds have not been identified or described, limiting the effectiveness of acoustic monitoring for diversity assessments. Machine learning offers a solution to scale such analyses but has yet to be successfully applied to characterize the diversity of reef fish sounds. Here we sought to characterize and categorize coral reef fish sounds using unsupervised machine learning methods. Pulsed fish and invertebrate sounds from 480 min of data sampled across 10 days over a 2-month period on a US Virgin Islands reef were manually identified and extracted, then grouped into acoustically similar clusters using unsupervised clustering based on acoustic features. The defining characteristics of these clusters were described and compared to determine the extent of acoustic diversity detected on these reefs. Approximately 55 distinct calls were identified, ranging in centroid frequency from 50 Hz to 1,300 Hz. Within this range, two main sub-bands containing multiple signal types were identified from 100 Hz to 400 Hz and 300 Hz-700 Hz, with a variety of signals outside these two main bands. These methods may be used to seek out acoustic diversity across additional marine habitats. The signals described here, though taken from a limited dataset, speak to the diversity of sounds produced on coral reefs and suggest that there might be more acoustic niche differentiation within soniferous fish communities than has been previously recognized. [ABSTRACT FROM AUTHOR]

Lunar rhythms shape spawning phenology and subsequent risks and rewards for early life-history stages in the sea. Here, we consider a perplexing spawning phenology of the sixbar wrasse (Thalassoma hardwicke), in which parents spawn disproportionately around the new moon, despite the low survival of these larvae. Because primary sex determination in this system is highly plastic and sensitive to social environments experienced early in development, we ask whether this puzzling pattern of spawning is explained by fitness trade-offs associated with primary sexual maturation. We used otoliths from 871 fish to explore how spawning on different phases of the moon shapes the environments and phenotypes of settling larvae. Offspring that were born at the new moon were more likely to settle (i) before other larvae, (ii) at a larger body size, (iii) at an older age, (iv) to the best quality sites, and (v) as part of a social group—all increasing the likelihood of primary maturation to male. Selection of birthdates across life stage transitions suggests that the perplexing spawning phenology of adults may reflect an evolutionarily stable strategy that includes new moon spawning for compensatory benefits later in life, including preferential production of primary males at certain times. [ABSTRACT FROM AUTHOR]

Throughout the world, anthropogenic pressure on natural ecosystems is intensifying, notably through urbanisation, economic development, and tourism. Coral reefs have become exposed to stressors related to tourism. To reveal the impact of human activities on fish communities, we used COVID-19-related social restrictions in 2021. In French Polynesia, from February to December 2021, there was a series of restrictions on local activities and international tourism. We assessed the response of fish populations in terms of changes in the species richness and density of fish in the lagoon of Bora-Bora (French Polynesia). We selected sites with varying human pressures—some dedicated to tourism activities, others affected by boat traffic, and control sites with little human presence. Underwater visual surveys demonstrated that fish density and richness differed spatially and temporally. They were lowest on sites affected by boat traffic regardless of pandemic-related restrictions, and when activities were authorised; they were highest during lockdowns. Adult fish density increased threefold on sites usually affected by boat traffic during lockdowns and increased 2.7-fold on eco-tourism sites during international travel bans. Human activities are major drivers of fish density and species richness spatially across the lagoon of Bora-Bora but also temporally across pandemic-related restrictions, with dynamic responses to different restrictions. These results highlight the opportunity provided by pauses in human activities to assess their impact on the environment and confirm the need for sustainable lagoon management in Bora-Bora and similar coral reef settings affected by tourism and boat traffic. [ABSTRACT FROM AUTHOR]

As global heating and other anthropogenic influences alter tropical marine environments, it is unclear how marine bird populations will be impacted and whether their current roles in tropical marine ecosystems will change. Although marine birds roost and breed on tropical islands in large numbers, the direct trophic interactions between these birds and their prey across the tropics are poorly documented. We present a first framework for evaluating the dependence on and contributions of marine birds to tropical coral reef ecosystems and use it to examine the evidence for different kinds of interaction, focusing primarily on avian diets. We found 34 publications between 1967 and 2023 that presented a total of 111 data sets with enough detail for quantitative dietary analysis of tropical marine birds. Only two bird species out of 37 (5.4%) had diets of >50% coral reef fishes and only one, the Pacific Reef Egret, appeared to depend almost entirely on reef‐based production. Marine birds are also prey for other marine organisms, but insufficient data are available for quantitative analysis. Evidence for indirect effects of birds in tropical marine environments is stronger than for direct dependence on coral reefs, particularly in relation to nutrient concentration and the fertilisation impacts of guano on corals. Dispersal of propagules (e.g. seeds, spores, invertebrate eggs) by bathing, drinking, resting or foraging birds is under‐studied and poorly documented. Although the degradation of coral reefs appears unlikely to have a significant direct impact on food availability for most marine bird populations, indirect effects involving marine birds may be disrupted by global environmental change. [ABSTRACT FROM AUTHOR]

Coral reef fishes are usually assumed to be most strongly associated with reef-building corals. However, sponges can be a significant structural component of coral reef ecosystems and their framework can enhance the local abundance and biodiversity of fish assemblages. Little is known regarding the range of fish species using complex sponges as either shelter or feeding substrata. Here we use a combination of stationary video cameras and focal animal sampling to document fish species positively associated with complex sponges in Kimbe Bay, Papua New Guinea. Stationary cameras identified 45 fish species using the sponges for either shelter, feeding substrata or as sites for ambush predation. A guild of 10 individual fish species from five families (Blenniidae, Chaetodontidae, Gobiidae, Labridae and Pomacentridae) were observed to quantify sponge and other habitat use and compared with habitat availability to determine the level of sponge selectivity. One species, Pleurosicya elongata (the Slender Spongegoby), lived in obligate association with Ianthella basta (Elephant Ear sponge), and there was a positive relationship between sponge size and number of resident fish, however this was not significant for all life stages. Five other fish species appeared to preferentially select sponges as habitat (Amblyglyphidodon aureus, Chaetodon kleinii, Coradion chrysozonus, Escenius prooculis and Pomacentrus nigromanus), while for others, sponge use appeared incidental. When selectivity indices were calculated for specific sponge species it was apparent that some fishes exhibited preferences for particular sponge species or growth forms. These results suggest more fish species may be reliant on sponges than is widely appreciated. [ABSTRACT FROM AUTHOR]

Climate change stressors are progressively simplifying biogenic habitats in the terrestrial and marine realms, and consequently altering the structure of associated species communities.Here, we used a volcanic CO2 seep in Papua New Guinea to test in situ if altered reef architecture due to ocean acidification reshuffles associated fish assemblages.We observed replacement of branching corals by massive corals at the seep, with simplified coral architectural complexity driving abundance declines between 60% and 86% for an assemblage of damselfishes associated with branching corals. An experimental test of habitat preference for a focal species indicated that acidification does not directly affect habitat selection behaviour, with changes in habitat structural complexity consequently appearing to be the stronger driver of assemblage reshuffling. Habitat health affected anti‐predator behaviour, with P. moluccensis becoming less bold on dead branching corals relative to live branching corals, irrespective of ocean acidification.We conclude that coral reef fish assemblages are likely to be more sensitive to changes in habitat structure induced by increasing pCO2 than any direct effects on behaviour, indicating that changes in coral architecture and live cover may act as important mediators of reef fish community structures in a future ocean. [ABSTRACT FROM AUTHOR]

Coral reefs in the Florida Reef Tract have seen protracted loss of coral over the past several decades due to a variety of disturbances from marine heat waves, cold snaps, and disease events. Corals have not recovered despite abundant herbivorous fishes and relatively low macroalgal cover, two factors thought to facilitate resilience of corals. Thus, factors affecting the replenishment of coral populations may be hindering the recovery of corals. To study the potential factors affecting coral recovery in reefs of the Florida Reef Tract, we assessed benthic abiotic variables (substrate slope, depth, structural complexity, and abundance of sediment), fish assemblages, and benthic composition in three different reef habitats (groove, spur wall, spur top) located on three low-relief reefs and three high-relief spur-and-groove reefs. Herbivorous fish biomass ranged (44.7–107 g m−2), which is above average for the Caribbean. Yet there was low coral cover (~ 1%) and low density (~ 1 coral m2) of small adult corals, which likely reflects the cumulative effects of years of disturbances. The presence and density of juvenile corals were negatively correlated with the depth of the sediment layer trapped within long, sediment-laden algal turfs (LSAT), which are particularly abundant (> 50% cover) in low complexity reef habitats (low-relief groove, low-relief spur top, and high-relief groove). Our results indicate that current unsuitable habitat conditions (high sediment load) for early life stage corals may be an important factor preventing coral recovery. Consequently, the abundance of herbivorous fishes and coral cover trajectories appear decoupled in the region, and additional management initiatives considering LSAT composition are required to aid reef resilience. [ABSTRACT FROM AUTHOR]

One of the least understood trophic pathways on coral reefs is the linkage between highly productive cryptic motile invertebrates (herein: cryptofauna) and the predatory vertebrates that underpin reef fisheries. As cryptofauna are difficult to observe and quantify, particularly in coral rubble where they proliferate, the diets of invertivores that forage in rubble have largely been determined through relative gut content analyses. Without congruent quantification of prey diversity, biomass, and rates of predation specific to rubble, it remains challenging to develop models of productivity and energy transfer. We calculated bite rates of six wrasses (Labridae) and a goatfish (Mullidae) commonly found foraging in rubble, using in situ videography on a coral reef in Palau, Western Micronesia. Consumption rates (i.e. individuals consumed) and prey preferences were determined using tank-based feeding experiments, where individual fish were presented with a diverse rubble community characterised before and after 2 h feeding trials. The motile cryptofauna community and invertivore diet consisted predominantly of Arthropoda (83% and > 58%, respectively), with calanoid copepods and mysids positively selected and harpacticoids, decapods and ostracods negatively selected. The interspecific mean (± standard error) rate of consumption was 3.5 ± 0.2 ind. min−1 from rubble, estimated to equal 9.5 ± 0.9 mg min−1 of invertebrate biomass consumed per fish, with biased uptake of small fauna. Bite and consumption rates varied among species with the greatest efficiency in biomass uptake evident in Halichoeres melanurus. This study provides a first attempt at characterising diverse cryptofauna communities pre- and post-trial to identify feeding rates and preferences of coral reef invertivores from the rubble benthos, and highlights the importance of addressing the bioavailability of lower trophic entities in energy pathways. [ABSTRACT FROM AUTHOR]

Copyright of South China Fisheries Science is the property of South China Fisheries Science Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Mesophotic Coral Ecosystems (MCEs) represent unique ecological habitats that range from 30 to 150 m deep, harbouring phylogenetically distinct species and offering refuge for many taxa during times of environmental stress. Yet owing to inaccessibility of ecosystems at these depths, most MCEs remain unexplored, with quantifications of ecological communities in these habitats lacking across many regions. Here, using open- and closed-circuit technical diving, we quantified benthic and fish community composition at four mesophotic reef sites (45 m depth) in Grand Cayman. We show significant differences in benthic community composition over a small spatial scale driven by disparate coverage of sponges, crustose coralline algae, and sand/rubble, yet consistent patterns of macroalgal dominance representing >50% coverage at each site and low hard coral cover at an average of 2.4%. Reef fish species richness, biomass, and density was consistent across sites, however the relative contribution of individual species to community composition differed significantly. Macrocarnivores were found to be the dominant contributors to biomass, with invertivores the most speciose, and omnivores and planktivores at the highest densities, consistent with previous descriptions of mesophotic fish assemblages in other regions. Similarly, the low hard coral cover and high macroalgae and sponge cover of the benthic communities also appear ecologically similar to several described mesophotic reefs yet is not uniform across the Caribbean. The ecological organisation of Grand Cayman's MCEs may result from a variety of factors such as isolation from other major land masses, geology, local geography, and anthropogenic activity at both the local and global scale and highlight the importance of continued exploration and documentation of MCE communities. [ABSTRACT FROM AUTHOR]

Assessments of ecosystem functioning are a fundamental ecological challenge and an essential foundation for ecosystem‐based management. Species trophic position (TP) is essential to characterize food web architecture. However, despite the intuitive nature of the concept, empirically estimating TP is a challenging task due to the complexity of trophic interaction networks. Various methods are proposed to assess TPs, including using different sources of organic matter at the base of the food web (the 'baseline'). However, it is often not clear which methodological approach and which baseline choices are the most reliable. Using an ecosystem‐wide assessment of a tropical reef (Marquesas Islands, with available data for 70 coral reef invertebrate and fish species), we tested whether different commonly used TP estimation methods yield similar results and, if not, whether it is possible to identify the most reliable method. We found significant differences in TP estimates of up to 1.7 TPs for the same species, depending on the method and the baseline used. When using bulk stable isotope data, the choice of the baseline significantly impacted TP values. Indeed, while nitrogen stable isotope (δ15N) values of macroalgae led to consistent TP estimates, those using phytoplankton generated unrealistically low TP estimates. The use of a conventional enrichment factor (i.e. 3.4‰) or a 'variable' enrichment factor (i.e. according to feeding guilds) also produced clear discrepancies between TP estimates. TPs obtained with δ15N values of source amino acids (compound‐specific isotope analysis) were close to those assessed with macroalgae. An opposite seasonal pattern was found, with significantly lower TPs in winter than in summer for most species, with particularly pronounced differences for lower TP species. We use the observed differences to discuss possible drivers of the diverging TP estimates and the potential ecological implications. Based on a case study from a remote coral reef ecosystem in the Pacific Ocean, this work analyses how several potential sources of organic matter (i.e. 'baselines') and calculation methods strongly affect assessments of trophic positions. We also demonstrated that seasonal temporality and feeding guild are important parameters to be considered. [ABSTRACT FROM AUTHOR]

In both terrestrial and marine ecosystems, prey species exhibit various reactions to predators, including avoidance, fighting and freezing. Acoustic communication associated with mobbing has been depicted in numerous tetrapod species. This sonic behaviour remains however largely unknown in fish although mobbing has been shown in different coral reef fish as a response to predation risk. This study focused on the communication strategy of prey species in the presence of predators. We tested the reaction of the holocentrid Sargocentron caudimaculatum when facing a moray eel and compared the sounds they produced against the predator with sounds produced when the fish are hand-held, recorded in standardized conditions. When introduced in mesocosms to a moray eel, S. caudimaculatum produced distinct distress sounds, resembling staccato calls, and swam towards the predator with their heads pointed in its direction and their dorsal fin erected. This observation supports a mobbing behaviour with specimens shifting from an escape behaviour to an aggressive response in presence of predator. Moreover, these sounds are different from those emitted during manual handling. This difference in acoustic signal suggests the coexistence of multiple warning/alarm sounds in this species. Holocentrids can produce different kinds of sounds witnessing their ability to provide graded information based on the perceived predation risk. We suggest that species of this family would be a suitable and promising group with which to test the hypothesis of acoustic coordination where individuals could inform their conspecifics about an increase in the immediate predation risk through appropriate alarm calls and trigger an escape response of the group if needed. [ABSTRACT FROM AUTHOR]

A list of coral reef fish species of Huaguang Reef was compiled in 2023 using hand fishing, diving fishing, underwater video, and eDNA detection, combined with historical data from 1979 and archival records from the South China Sea Fisheries Research Institute of the Chinese Academy of Fisheries Sciences for the years of 1998, 1999, 2003, and 2005. Successional characteristics of coral reef fishes through time were also explored. The findings revealed: (1) A total of 299 coral reef fish species were identified in Huaguang Reef, categorized into 2 classes, 16 orders, and 56 families, with Perciformes exhibiting the highest species count (234), constituting 78.26% of all species. (2) In comparison to the period of 1979-2005, there was a reduction in the number of species at the order and family levels in 2023 at Huaguang Reef. Both the average taxonomic distinctness (Δ+) and the variation in taxonomic distinctness (Δ+) exhibited a declining trend, indicating disturbances in the fish ecosystem. (3) The proportion of herbivorous fish at Huaguang Reef remained relatively stable in 2023 compared to the 1979-2005 period. Notably, the similarity coefficient of herbivorous fish was the highest among different feeding types, signifying a degraded state of the Huaguang Reef habitat. (4) In contrast to the 1979-2005 period, a significant decline was observed in large-sized and carnivorous fish species at Huaguang Reef in 2023. The low similarity coefficients for both categories, with undiscovered fish species accounting for 58.49% and 45.76% of their respective taxa in the total list, respectively, suggested a notable impact of overfishing on coral reef fishes. The succession patterns revealed in this study provide a theoretical foundation for advancing the sustainable development of coral reef fish resources in the Xisha Islands and offer valuable insights for the protection and management of coral reef fishes. [ABSTRACT FROM AUTHOR]

Dr. Tetsuo Kuwamura, a renowned researcher in fish behavioral ecology, passed away in January 2024. He made significant contributions to the field, particularly in the areas of mating systems, sex change in hermaphroditic fishes, and parental care in reef fishes. Dr. Kuwamura was actively involved in various academic societies and served on the editorial boards of scientific journals. His research on individual identification of fish species and his groundbreaking studies on bidirectional sex change in coral-dwelling gobies and cleaner wrasse have had a lasting impact. Dr. Kuwamura's dedication to sharing his research extended to mentoring students and organizing symposia. His legacy will continue to inspire future generations of researchers. [Extracted from the article]

Due to disturbance-driven phase shifts on coral reefs, sponges are an increasingly important microhabitat for reef-dwelling organisms, particularly throughout the Caribbean. The abundance of sponge-dwelling species is expected to be heavily influenced by their degree of habitat specialization, as well as the distribution and morphology of potential host sponges. We conducted surveys along the fringing reefs of Curaçao to test how host sponge community composition and morphology drive occupancy patterns of the yellowline goby (Elacatinus horsti). The assemblage of goby-occupied sponges varied across the island, representing habitat heterogeneity across surveyed sites. We found E. horsti to be a sponge generalist, commonly occupying three species: Aplysina lacunosa, Aplysina archeri, and Neofibularia nolitangere, though all host species had some unoccupied sponges. A variable related to overall sponge size—maximum sponge height—significantly influenced the likelihood of goby occupancy. Goby group size in a sponge was also influenced by maximum sponge height along with the number of oscula and the species of host sponge. Specifically, group sizes were bigger in larger sponges with more openings, and the noxious sponge N. nolitangere hosted groups that were estimated to be 2.6–9.0 times larger than groups in other sponges when accounting for host morphology. Therefore, for these site-attached fish, the opportunity for conspecific interactions varies across different hosts. Collectively, our findings lay the groundwork for future investigations into the ecological trade-offs and fitness consequences of occupying distinct host species and examining the nature of fish-sponge symbioses. [ABSTRACT FROM AUTHOR]

Although numerous coral reef fish species utilize substrates with high structural complexities as habitats and refuge spaces, quantitative analysis of nocturnal fish substrate associations has not been sufficiently examined yet. The aims of the present study were to clarify the nocturnal substrate associations of 17 coral reef fish species (nine parrotfish, two surgeonfish, two grouper and four butterflyfish) in relation to substrate architectural characteristics. Substrate architectural characteristics were categorized into seven types: (1) eave-like space, (2) large inter-branch space, (3) overhang by protrusion of fine branching structure, (4) overhang by coarse structure, (5) uneven structure without large space or overhang, (6) flat and (7) macroalgae. Overall, fishes were primarily associated with three architectural characteristics (eave-like space, large inter-branch space and overhang by coarse structure). The main providers of these three architectural characteristics were tabular and corymbose Acropora, staghorn Acropora, and rock. Species-specific significant positive associations with particular architectural characteristics were found as follows. For the nine parrotfish species, Chlorurus microrhinos with large inter-branch space and overhang by coarse structure; Ch. spilurus with eave-like space and large inter-branch space; Hipposcarus longiceps with large inter-branch space; Scarus ghobban with overhang by coarse structure; five species (Scarus forsteni, S. niger, S. oviceps, S. rivulatus and S. schlegeli) with eave-like space. For the two surgeonfish species, Naso unicornis with overhang by coarse structure; N. lituratus with eave-like space. For the two grouper species, Plectropomus leopardus with eave-like space; Epinephelus ongus with overhang by coarse structure. For the four butterflyfish species, Chaetodon trifascialis with eave-like space and large inter-branch space; C. lunulatus and C. ephippium with large inter-branch space; C. auriga showed no significant associations with any architectural characteristics. Four species (Ch. microrhinos, H. longiceps, S. niger and N. unicornis) also showed clear variations in substrate associations among the different fish size classes. Since parrotfishes, surgeonfishes and groupers are main fisheries targets in coral reefs, conservation and restoration of coral species that provide eave-like space (tabular and corymbose Acropora) and large inter-branch space (staghorn Acropora) as well as hard substrates with coarse structure that provide overhang (rock) should be considered for effective fisheries management in coral reefs. For butterflyfishes, coral species that provide eave-like space (tabular Acropora) and large inter-branch space (staghorn Acropora) should also be conserved and restored for provision of sleeping sites. [ABSTRACT FROM AUTHOR]

Anthropogenic stressors like overfishing, land based runoff, and increasing temperatures cause the degradation of coral reefs, leading to the loss of corals and other calcifiers, increases in competitive fleshy algae, and increases in microbial pathogen abundance and hypoxia. To test the hypothesis that corals would be healthier by moving them off the benthos, a common garden experiment was conducted in which corals were translocated to midwater geodesic spheres (hereafter called Coral Reef Arks or Arks). Coral fragments translocated to the Arks survived significantly longer than equivalent coral fragments translocated to Control sites (i.e., benthos at the same depth). Over time, average living coral surface area and volume were higher on the Arks than the Control sites. The abundance and biomass of fish were also generally higher on the Arks compared to the Control sites, with more piscivorous fish on the Arks. The addition of Autonomous Reef Monitoring Structures (ARMS), which served as habitat for sessile and motile reef-associated organisms, also generally significantly increased fish associated with the Arks. Overall, the Arks increased translocated coral survivorship and growth, and exhibited knock-on effects such as higher fish abundance. [ABSTRACT FROM AUTHOR]

Simple Summary: Marine aquarium keeping is a popular hobby that fuels a global industry that still heavily relies on the sourcing of wild organisms, mostly from tropical coral reefs. The European Union (EU) is one of the largest import markets for marine ornamental fish. Despite being mandatory and already fully digital, the record-keeping of what species are imported in what numbers from which exporting countries remains blurry. The present work presents curated and consolidated data reporting the value, the exporting and importing countries, and the number of specimens, species, and families of marine ornamental fish imported to the EU between 2014 and 2021. A 24-million-euro annual trade value was recorded, and 26 million specimens were imported from more than 60 countries (mostly Indonesia, the Philippines, and Sri Lanka). A watchlist is presented to provide guidance to stakeholders on which marine ornamental fish species being traded most likely require closer monitoring due to their potential impact through trade. The European TRAde Control and Expert System (TRACES) requires some minor tunning to enable authorities to easily monitor the imports of marine ornamental fish into the EU, thus allowing an unprecedented insight into this and other trade activities targeting wildlife. Wild-caught fish from coral reefs, one of the most threatened ecosystems on the planet, continue to supply the marine aquarium trade. Despite customs and veterinary checks during imports, comprehensive data on this global industry remain scarce. This study provides consolidated data on the largest import market by value, the European Union (EU): a 24-million-euro annual trade value, detailing the main exporting and importing countries, as well as the species and families of the 26 million specimens imported between 2014 and 2021. A watchlist alert system based on the number of specimens traded, import trends, and vulnerability index according to FishBase and the IUCN Red List conservation status is presented, providing key information on which species should require closer scrutiny by authorities. While the European TRAde Control and Expert System (TRACES) electronically monitors the movement of live animals to respond quickly to biosecurity risks, one-third of marine ornamental fish imported lack species-level information. With minor adjustments, TRACES holds the potential to significantly enhance data granularity and the monitoring of wildlife trade, with marine ornamental fish being an interesting case study to validate this approach. [ABSTRACT FROM AUTHOR]

Clownfish (subfamily Amphiprioninae) are an iconic group of coral reef fish that evolved a mutualistic interaction with sea anemones, which triggered the adaptive radiation of the clade. Within clownfishes, the "skunk complex" is particularly interesting. Besides ecological speciation, interspecific gene flow and hybrid speciation are thought to have shaped the evolution of the group. We investigated the mechanisms characterizing the diversification of this complex. By taking advantage of their disjunct geographical distribution, we obtained whole‐genome data of sympatric and allopatric populations of the three main species of the complex (Amphiprion akallopisos, A. perideraion and A. sandaracinos). We examined population structure, genomic divergence and introgression signals and performed demographic modelling to identify the most realistic diversification scenario. We excluded scenarios of strict isolation or hybrid origin of A. sandaracinos. We discovered moderate gene flow from A. perideraion to the ancestor of A. akallopisos + A. sandaracinos and weak gene flow between the species in the Indo‐Australian Archipelago throughout the diversification of the group. We identified introgressed regions in A. sandaracinos and detected in A. perideraion two large regions of high divergence from the two other species. While we found that gene flow has occurred throughout the species' diversification, we also observed that recent admixture was less pervasive than initially thought, suggesting a role of host repartition or behavioural barriers in maintaining the genetic identity of the species in sympatry. [ABSTRACT FROM AUTHOR]

Incidents of parasitic infections of coastal (0-40m deep) fish species were investigated to assess ecosystem health and stability along Jordan's Gulf of Aqaba (GoA). The aim was to compare sites of probable anthropogenic impacts using the extent of infections and species richness indices. A total of 828 fish belonging to 60 species were collected and examined from 7 sites. Fish were brought to laboratory and examined for skin and gill lesions and/or parasites. Fish necropsy was undertaken to assess organ-specific parasitic infections. The infection prevalence (IV) of 8 disease agents pooled from all sites was Psuedodactylogyrus sp., Dactylogyrus sp., Copepod (Gnathia sp.), Ergasilus sp., Maxillopoda, Nematodes (Anisakis sp), Isopods and Platy helminthes. The highest IV was reported in fish gills by Flukes (helminthes), and Isopods and monogeneans were recorded in 88% of the examined fish. However, the highest % of infection was the copepods, Ergasilus sp. and Psuedodactylogyrus sp., while the lowest % was the helminthes (fish flukes). The gut parasites pseudodactylogyrus sp. and dactelogyrus sp. prevailed highest in fish collected at northern sits of GoA. These together with one nematode dominated sites of increasing urban activities. By comparing species richness indices of heteroxenous vs. monoxenous parasites in some fish, results suggest increased incidents of monoxenous parasite in fish collected at areas likely impacted by human activities along the coast. [ABSTRACT FROM AUTHOR]

A habitat's structural complexity is a key determinant of the recruitment and composition of associated communities. While the influence of the physical structure of corals on coral reef fish recruitment is well studied, the significance of other benthic components, like macroalgae, remains unclear. We used experimental patches of the canopy-forming macroalga Sargassum to assess the influence of macroalgal complexity, which was manipulated by altering thallus density and biomass, on coral reef fish recruitment. We established twenty-five 75 × 75 cm patches on the reef flat of Orpheus Island, (inshore, central Great Barrier Reef) during austral summer. Patches were randomly divided into five treatments of varying Sargassum thallus density (3–9 thalli) and/or biomass (177–779 g per patch) and surveyed daily for recruiting fishes for 18 d. We recorded 35 fish species recruiting to our patches, with Sargassum biomass having the greatest influence on fish recruits' abundance and species richness. Comparisons between treatments with equal thallus density but varying biomass revealed a positive association between Sargassum biomass and fish species richness and abundance (up to ~ 2.5-fold differences). Additionally, treatments with similar total Sargassum biomass but different density revealed a negative relationship between density and fish species richness and abundance (20–30% reduction). These positive associations with Sargassum thallus biomass suggest that recruiting fishes favour the fine-scale complexity of intra-thallus spaces, rather than the larger, inter-thallus gaps. This study highlights that fine-scales of complexity within tropical macroalgal beds may influence the reef fish recruitment value of these often-underappreciated areas. [ABSTRACT FROM AUTHOR]

Site-attached fish that form social groups may face a trade-off between the advantages of group living and the disadvantages related to intra-group competition for food. A possible solution for the latter is space partitioning among group members. Technological limitations related to individual tagging and underwater tracking hindered such spatial studies in grouping fishes. Here, using underwater video cameras and recent developments in deep learning tools, we successfully tracked the 3D movements of individually tagged fish in 4 groups of the damselfish Dascyllus marginatus in the coral reef of Eilat, Red Sea. Our findings, based on tracking sessions lasting 3–11 min that were recorded during a period of > 1 month, show that the individual fish kept separate foraging spaces with minimal overlap and that this separation was stable in time. When the tidally driven current reversed, the separation was kept, and a corresponding reversal was found in the positions of each fish relative to the coral and its neighbors. We propose that the stable spatial partitioning observed in our study is a primary mechanism through which site-attached species can organize themselves in order to reduce intra-group competition. [ABSTRACT FROM AUTHOR]

The health of coral reef benthic and fish communities is implicitly connected, yet typically studied and managed separately. By developing a coupled reef population model that connects coral populations and reef fish biomass through the habitat complexity that corals build and fish live among, we aim to address this gap by holistically quantifying ecological feedbacks and responses to ecological stressors. We explored the impacts of fishing effort in conjunction with three types of ecological disturbances as they propagated through a coral reef ecosystem: (1) a disturbance that disproportionately affected small, bio‐energetically vulnerable colonies, (2) a disturbance that predominantly affected large, mechanically vulnerable colonies, and (3) a disturbance that affected colonies of all sizes randomly. We found that joint coral and fish population recovery was fastest and most complete under events affecting small colonies, followed by recovery from disturbances affecting random sizes, and lastly large‐colony disturbances. These results suggest that the retention versus loss of large coral colonies with high reproductive potential critically influenced population recovery. Low fishing levels maintained fish and coral populations and allowed for recovery after disturbances, whereas high fishing levels prevented recovery due to greater fish‐dependent coral mortality. Finally, we tested various formulations of the relationship between coral size and habitat complexity (i.e., exponential, linear, logarithmic) that constrain fish carrying capacity. All formulations led to similar population projections in most disturbance scenarios, but there were exceptions where the timing and trajectory of recovery differed, such as faster and greater recovery potential when complexity is logarithmic with respect to coral size. These findings suggest that fishing and habitat complexity mediate the recovery of coral reef populations, emphasizing the importance of describing linkages between coral size distribution and reef habitat structure. Furthermore, our results highlight the utility of the coupled‐model framework for understanding and managing the impact of disturbances at ecosystem scales. [ABSTRACT FROM AUTHOR]

An understanding of the mechanistic drivers of animal‐microbial symbiosis and associations generally requires experiments that manipulate specific symbionts or microbial communities. As part of an ongoing study of the mechanisms that drive microbial communities in coral reef fishes, and specifically the role of cleanerfish in microbial transmission, we tested the effects of the commonly used antibiotics Enrofloxacin and Nitrofurazone on the skin microbiome of three ornamental reef fish species: the four‐eyed butterflyfish, Chaetodon capistratus (Chaetodontidae), the cleanerfish neon goby Elacatinus oceanops (Gobiidae) and the beaugregory damselfish Stegastes leucostictus (Pomacentridae). Our main aim was to characterize dysbiosis prompted by the delivery of the two antibiotics and understand whether both could be used to establish good starting points for microbial transmission experiments. We bathed the fish in antibiotic (or no exposure in the controls), sampled the skin microbiota via swabbing at zero (before treatment) and 3 and 7 days during the treatments, and examined the microbial community using a 16S rRNA gene sequencing approach. Nitrofurazone reduced skin‐associated microbial diversity in all species, whereas the same effect for Enrofloxacin was only seen in S. leucostictus. Although each antibiotic had its own, unique impact in microbial community, all treatments showed positive and negative shifts in the most abundant microbial taxa over time. Moreover, soon after the delivery of both antibiotics, increases in the abundance of opportunistic bacteria or potential pathogens, such as Alteromonas and Vibrio, were observed. Although both antibiotics are effective, Nitrofurazone more successfully reduces microbial diversity and therefore may be more ideal for experiments seeking to disrupt fish microbiomes. [ABSTRACT FROM AUTHOR]

Population and species persistence in a rapidly warming world will be determined by an organism's ability to acclimate to warmer conditions, especially across generations. There is potential for transgenerational acclimation but the importance of ontogenetic timing in the transmission of environmentally induced parental effects remains mostly unknown. We aimed to disentangle the effects of two critical ontogenetic stages (juvenile development and reproduction) to the new-generation acclimation potential, by exposing the spiny chromis damselfish Acanthochromis polyacanthus to simulated ocean warming across two generations. By using hepatic transcriptomics, we discovered that the post-hatching developmental environment of the offspring themselves had little effect on their acclimation potential at 2.5 months of life. Instead, the developmental experience of parents increased regulatory RNA production and protein synthesis, which could improve the offspring's response to warming. Conversely, parental reproduction and offspring embryogenesis in warmer water elicited stress response mechanisms in the offspring, with suppression of translation and mitochondrial respiration. Mismatches between parental developmental and reproductive temperatures deeply affected offspring gene expression profiles, and detrimental effects were evident when warming occurred both during parents' development and reproduction. This study reveals that the previous generation's developmental temperature contributes substantially to thermal acclimation potential during early life; however, exposure at reproduction as well as prolonged heat stress will likely have adverse effects on the species' persistence. [ABSTRACT FROM AUTHOR]

We studied the topography of retinal ganglion cells (GCs) and estimated spatial resolving power (SRP) in the pajama cardinalfish Sphaeramia nematoptera (Bleeker, 1856), a relatively small brightly colored fish inhabiting coral reefs and lagoons in the Western Pacific. S. nematoptera is an active night predator feeding on near‐bottom animal plankton and benthos. DAPI staining was used to label nuclei of GCs and non‐GCs in the inner plexiform and ganglion cell layers. Non‐GCs were distinguished from GCs in Nissl‐stained retinal wholemounts based on cell size, shape, and staining intensity. The proportion of displaced amacrine cells (DACs) varied from 15.46 ± 1.12 (visual streak [VS]) to 17.99 ± 1.06% (dorsal periphery) (mean ± S.E.M., N = 5); the respective proportions of glial cells were 6.61 ± 0.84 and 5.89 ± 0.76%. Thus, 76%–78% of cells in the ganglion cell layer and inner plexiform layer were GCs. The minimum spatial coverage of GCs (3600–4600 cells/mm2) was detected in the dorsal and ventral periphery. It gradually increased toward the central retina to form a moderate VS. The maximum GC density (11,400–12,400 cells/mm2) was registered in the central portion of the VS. No pronounced concentric retinal specializations were found. The total number of GCs ranged within 595.2–635.9 × 103. The anatomical spatial resolving power was minimum in the ventral periphery (4.91–5.53 cpd) and maximum in the central portion of the VS (8.47–9.07 cpd). The respective minimum separable angles were 0.18–0.20° and 0.11–0.12°. The relatively high spatial resolving power and presence of the VS in the pajama cardinalfish are in line with its highly visual behavior. [ABSTRACT FROM AUTHOR]

Animal transport of energy and nutrients through food webs and across ecosystem boundaries is highly dynamic in time and space, challenging our ability to quantify ecological processes. Energy and nutrient flux in individual animals can be measured with data on growth, biochemistry, and trophic ecology, but scaling individual processes up to entire animal communities is inherently difficult. On coral reefs, new frameworks have been developed to predict growth rates, nutrient cycling, micronutrient concentrations, and energy sources in fishes, helping to uncover ecosystem functions and services. Filling data gaps and comparing flux frameworks with existing ecosystem tools will improve quantitative predictions and help ecologists trace energy and nutrient flux in other aquatic systems. The movement of energy and nutrients through ecological communities represents the biological 'pulse' underpinning ecosystem functioning and services. However, energy and nutrient fluxes are inherently difficult to observe, particularly in high-diversity systems such as coral reefs. We review advances in the quantification of fluxes in coral reef fishes, focusing on four key frameworks: demographic modelling, bioenergetics, micronutrients, and compound-specific stable isotope analysis (CSIA). Each framework can be integrated with underwater surveys, enabling researchers to scale organismal processes to ecosystem properties. This has revealed how small fish support biomass turnover, pelagic subsidies sustain fisheries, and fisheries benefit human health. Combining frameworks, closing data gaps, and expansion to other aquatic ecosystems can advance understanding of how fishes contribute to ecosystem functions and services. [ABSTRACT FROM AUTHOR]

Sandy beaches have experienced substantial human modifications worldwide for centuries. Yet, sandy beaches are known as nursery areas for coral reef fishes. Due to global and local stressors, the degradation of nurseries such as the sandy beaches may have wide reaching consequences for the resilience of reef fishes. In our study, the impact of erosion vs. accretion phenomena was highlighted on coral reef fish community in Guadeloupe in comparing the abundance and diversity of juvenile fish between two nearby beach sites (one that undergoes accretion and the other one that undergoes erosion since the 1950s). The main result showed that a significant retreat of sandy beach along the entire coastline, by bringing out an old reef, could create new habitats, favorable to the settlement of fish juveniles. This result is surprising when considering that erosion negatively affects coral reefs through the sedimentation, deterioration of water quality, and loss of habitat. [ABSTRACT FROM AUTHOR]

Damselfishes (Pomacentridae) are one of the most behaviourally diverse, colourful and species‐rich reef fish families. One remarkable characteristic of damselfishes is their communication in ultraviolet (UV) light. Not only are they sensitive to UV, they are also prone to have UV‐reflective colours and patterns enabling social signalling. Using more than 50 species, we aimed to uncover the evolutionary history of UV colour and UV vision in damselfishes. All damselfishes had UV‐transmitting lenses, expressed the UV‐sensitive SWS1 opsin gene, and most displayed UV‐reflective patterns and colours. We find evidence for several tuning events across the radiation, and while SWS1 gene duplications are generally very rare among teleosts, our phylogenetic reconstructions uncovered two independent duplication events: one close to the base of the most species‐rich clade in the subfamily Pomacentrinae, and one in a single Chromis species. Using amino acid comparisons, we found that known spectral tuning sites were altered several times in parallel across the damselfish radiation (through sequence change and duplication followed by sequence change), causing repeated shifts in peak spectral absorbance of around 10 nm. Pomacentrinae damselfishes expressed either one or both copies of SWS1, likely to further finetune UV‐signal detection and differentiation. This highly advanced and modified UV vision among damselfishes, in particular the duplication of SWS1 among Pomacentrinae, might be seen as a key evolutionary innovation that facilitated the evolution of the exuberant variety of UV‐reflectance traits and the diversification of this coral reef fish lineage. [ABSTRACT FROM AUTHOR]

Because they serve as the main architects of coral reefs, the distribution and abundance of stony coral species have major impacts on other associated community members. Thus, coral diseases can have significant cascading effects throughout the ecosystem. Stony coral tissue loss disease (SCTLD) is the most recent of many diseases documented to impact Caribbean stony corals. SCTLD is known to impact over 20 species of reef-building corals and can cause complete colony mortality of large corals in only one month. Among the coral species impacted are those occupied as cleaning stations by Caribbean cleaner gobies. This study examined the persistence of these gobies on living coral cleaning stations where SCTLD was most recently or not yet affected (emergent), recently established (epidemic), and well-established (endemic),. Timed surveys were conducted at nine reefs in the U.S. Virgin Islands between October 2019 and March 2021. Study sites were surveyed both before and after the outbreak/ establishment of SCTLD where possible. Monitoring sites were established at six reefs by tagging 25 live coral cleaning stations at each of two endemic and two epidemic sites and 50 cleaning stations at each of two emergent sites. Goby abundance at each site was monitored at least five times from March 2020 to April 2021. Timed surveys found cleaner goby abundance was 50% lower in the endemic zone compared to epidemic and emergent zones. Overall, goby abundance declined on tagged cleaning stations throughout the course of this study at all sites. However, overall goby density within monitored areas remained stable across most sites from the beginning to the end of the study. One emergent site experienced a two-fold increase in goby density and one epidemic site experienced a decline in goby density. This suggests that gobies are remaining at the site but may be abandoning live coral cleaning stations as the individual colonies are affected by SCTLD. Given the benefit cleaner gobies have on local coral reef fishes, changes in cleaning activity associated with coral disease have the potential to negatively impact Caribbean reef fish communities. [ABSTRACT FROM AUTHOR]

This article proposes a mechanism that triggers first maturation and spawning in coral reef (bony) fish, which allows for predicting their length at first maturity. Thus, mean lengths at first maturity (Lm) and the corresponding maximum lengths (Lmax) in 207 populations of 131 species of coral reef fish were assembled and used to test the hypotheses that (a) there is, in coral reef fish, a single value of a size-related parameter acting as a trigger for their maturation and eventual spawning, and (b) that this single value is statistically the same as that published previously for other bony fish. The results, based on the assembled Lm and Lmax data and on estimates of the parameter D, which link the length of fish with the relative surface of their gills, covered 44 families and Lmax values ranging from 1.8 to 181.6 cm and confirmed that the threshold in (a) exists. Also, we assessed (in b) that this threshold value, i.e., LmaxD/LmD = 1.35 (±0.02), is not statistically different from similar estimates for other groups of teleosts, notably semelparous salmonids, cichlids, sturgeons and Chinese and Turkish freshwater and marine fish. One implication is that given ocean warming and deoxygenation, coral reef fish will not only be smaller than they currently are, but also mature and spawn at smaller sizes, and thus produce fewer, smaller eggs. [ABSTRACT FROM AUTHOR]

While benthic characteristics of coral reef habitats are a major driver of the structure of coral reef fish assemblages, non-reef habitats adjacent to coral reefs (e.g., mangroves, seagrass beds, and macroalgal beds) can affect reef fish assemblages. Here, we investigate how reef fish assemblages respond to local-scale benthic habitats within a coral reef and larger-scale adjacent seascape features (habitats within 500 m of coral reefs) on Siquijor Island in the Philippines. We examined an abundance of species for the entire reef fish assemblage and within the assemblages of parrotfishes (subfamily Scarinae) and wrasses (family Labridae). Five distinct habitat types were identified in a cluster analysis, which incorporated benthic characteristics within coral reefs and habitats adjacent to coral reefs. We found that the diversity and structure of coral reef fish assemblages were affected by benthic characteristics within coral reefs and also by benthic habitat types adjacent to coral reefs. Individual species responses and juveniles of certain species demonstrated uniquely high abundances in habitat clusters characterized by the non-reef habitats surrounding coral reefs. Considering coral reef habitats and adjacent non-reef habitats as a holistic, interconnected seascape will provide better estimations of the drivers of the structures of coral reef fish assemblages. [ABSTRACT FROM AUTHOR]

Species‐to‐species and species‐to‐environment interactions are key drivers of community dynamics. Disentangling these drivers in species‐rich assemblages is challenging due to the high number of potentially interacting species (the 'curse of dimensionality'). We develop a process‐based model that quantifies how intraspecific and interspecific interactions, and species' covarying responses to environmental fluctuations, jointly drive community dynamics. We fit the model to reef fish abundance time series from 41 reefs of Australia's Great Barrier Reef. We found that fluctuating relative abundances are driven by species' heterogenous responses to environmental fluctuations, whereas interspecific interactions are negligible. Species differences in long‐term average abundances are driven by interspecific variation in the magnitudes of both conspecific density‐dependence and density‐independent growth rates. This study introduces a novel approach to overcoming the curse of dimensionality, which reveals highly individualistic dynamics in coral reef fish communities that imply a high level of niche structure. [ABSTRACT FROM AUTHOR]