Search

Iron overload results in lipid peroxidation (LPO) and the oxidative modification of circulating lipoproteins, which contributes to cardiovascular complications in patients with β-thalassemia. Investigating LPO may provide opportunities for the development of novel therapeutic strategies; however, the chemical pathways underlying iron overload-induced LPO in β-thalassemia lipoproteins remain unclear. In this study, we identified various species of lipid radicals (L • ), the key mediators of LPO, and oxidized cholesteryl esters (oxCE) derived from the in vitro oxidation of major core lipids, cholesteryl linoleate (CE18:2) and cholesteryl arachidonate (CE20:4); the levels of these radical products in low-density lipoproteins (LDL) and high-density lipoproteins (HDL) were measured and compared between β-thalassemia patients and healthy subjects by using a specific fluorescent probe for L • with a liquid chromatography-tandem mass spectrometric method. Our results demonstrated that iron overload substantially decreased the levels of CE18:2 and CE20:4 substrates and α-tocopherol, resulting in higher levels of full-length and short-chain truncated L • and oxCE products. In particular, CE epoxyallyl radicals ( • CE-O) were observed in the lipoproteins of β-thalassemia, revealing the pathological roles of iron overload in the progression of LPO. In addition, we found that intermission for two weeks of iron chelators can increase the production of these oxidized products; therefore, suggesting the beneficial effects of iron chelators in preventing LPO progression. In conclusion, our findings partly revealed the primary chemical pathway by which the LPO of circulating lipoproteins is influenced by iron overload and affected by iron chelation therapy. Moreover, we found that • CE + O shows potential as a sensitive biomarker for monitoring LPO in individuals with β-thalassemia., Competing Interests: Declaration of competing interest The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

Despite several existing laboratory-based studies of hemoglobin (Hb) E (HBB:c.79 G > A)/ β (nucleotide (NT) -28 A > G) (HBB:c.-78 A > G) -thalassemia, no reports have ever provided clinical severity information as well as dependency of blood transfusion. Previously, a comparative study of community- and hospital-recruited Hb E/β-thalassemia subjects was conducted in the lower northern Thailand between June 2020 and December 2021. A mobile medical team visited each community hospital on-site, collecting clinical severity parameters, and conducting Hb and DNA analyses. The control included Hb E/β-thalassemia patients undergoing transfusions. Subgroup study of adult Hb E/β (NT -28 A > G) -thalassemia subjects was subsequently conducted. Additional pediatric individuals were recruited from prenatal diagnosis databases. Twenty adult and nine pediatric subjects were enrolled; all were classified as having mild disease severity. Twenty-two individuals (75.9 %) were asymptomatic. Six adults (20.7 %) required blood transfusion. The mean Hb level of subjects without transfusion (23 [79.3 %]) was 10.77 ± 1.10 g/dL. Hb analysis revealed a distinct EFA pattern with low Hb F fraction. The positive impact of genetic modifiers could not be statistically demonstrated except rs7482144-XmnI. These findings could provide essential information for parents carrying fetuses with Hb E/β (NT -28 A > G) -thalassemia., Competing Interests: Declaration of competing interest None., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Transfusion dependent β-thalassemia is a genetic blood disorder characterized by chronic anaemia. Blood transfusion is lifesaving but comes at a cost. Iron overload emerges as a prime culprit as a free radicals damage endothelial cells. Chronic anaemia further disrupts oxygen delivery, exacerbating the oxidative stress. Increased levels of met-haemoglobin and malondialdehyde compromise endothelial function. This research sheds light on the impact of met-haemoglobin and oxidative stress on endothelial function in 50 patients with transfusion dependent β-thalassemia major compared to 50 healthy individuals as control. Blood samples were collected & subjected to CBC, biochemical analysis including creatinine, ferritin, CRP, LDH, and HCV antibodies. Oxidative stress was assessed using met-haemoglobin & malondialdehyde. Endothelial dysfunction was evaluated by endothelial activation and stress index (EASIX). EASIX, met-haemoglobin and malondialdehyde were significantly increased in patients (1.44 ± 0.75, 2.07 ± 0.2, 4.8 ± 0.63; respectively) compared to the control (0.52 ± 0.24,0.88 ± 0.34,0.8 ± 0.34; respectively). Significant strong positive correlation was found between EASIX and met-haemoglobin, malondialdehyde, serum ferritin and CRP (P = 0.00, r = 0.904, P = 0.00, r = 0.948, P = 0.00, r = 0.772, P = 0.00, r = 0.971; respectively. Met-haemoglobin as well as EASIX should be routinely estimated to assess endothelial function especially before the decision of splenectomy. Antioxidant drugs should be supplemented., (© 2024. The Author(s).)

Recent research highlights the significant impact of the gut microbiota on health and disease. Thalassemia, a hereditary blood disorder, requires regular blood transfusions, leading to an accumulation of iron in the body. Such changes could potentially alter the intestinal microbiota, thereby increasing the susceptibility of thalassemic patients to infection. In this study, we analyzed the fecal microbiota of 70 non-transfusion-dependent (NTDT) β-thalassemia/HbE patients and 30 healthy controls. Our findings indicate that iron chelation intervention had no detectable effect on the microbiome profile of thalassemic patients. However, the cross-sectional analysis revealed that the bacterial diversity and community structure in patients were significantly less diverse and distinct compared to those of healthy subjects. Using reference frames, we were also able to demonstrate that bacterial taxa that are known to produce short chain fatty acids, from the genera Alistipes, Coprococcus, and Oscillospira, and those from the family Ruminococcaceae, were less prevalent in the patients. In contrast, bacterial taxa associated with an unhealthy gut, including the genus Clostridium and those from the families Fusobacteriaceae, Enterobacteriaceae, and Peptostrptococcaceae, were more prevalent in patients and found to be correlated with higher levels of ferritin. Collectively, these changes in the microbiota could be regarded as markers of raised ferritin levels, and therefore, awareness should be exercised as they could interfere, albeit indirectly, with the treatment of the co-morbidities of thalassemia., (© 2024. The Author(s).)

Neutrophil dysfunction is a form of immune suppression in patients with β-thalassemia (Beta-thal), although data on this are limited. In this study, blood from patients and healthy volunteers was analyzed. Flow cytometry analysis demonstrated an increase in immature neutrophils (CD16- CD62L+) and aged (senescent) neutrophils (CD16+ CD62L-) in Beta-thal patients compared to healthy volunteers. The Beta-thal neutrophils demonstrated less prominent chemotaxis and phagocytosis than healthy neutrophils at the baseline. With phorbol myristate acetate (PMA) or lipopolysaccharide (LPS) stimulations, some of the indicators, including the flow cytometry markers (CD11b, CD62L, CD66b, CD63, apoptosis, and reactive oxygen species) and neutrophil extracellular traps (NETs; detected by anti-citrullinated histone 3 immunofluorescence), were lower than the control. Additionally, low-density neutrophils (LDNs), which are found in the peripheral blood mononuclear cell (PBMC) fraction, were observed in Beta-thal patients but not in the control group. The expression of CD11b, CD66b, CD63, arginase I, and ROS in LDNs was higher than the regular normal-density neutrophils (NDNs). The proliferation rate of CD3+ T cells isolated from the PBMC fraction of healthy volunteers was higher than that of the cells from patients with Beta-thal. The incubation of red blood cell (RBC) lysate plus ferric ions with healthy NDNs transformed the NDNs into the aged neutrophils (decreased CD62L) and LDNs. In conclusion, iron overload induces neutrophil diversity along with some dysfunctions.

Background: Beta-thalassemia major (β-TM) patients are more likely to experience blood glucose intolerance and to date; the blood markers that could evaluate this are debatable. So, this study aimed to assess the roles of glycated hemoglobin A1c (HbA1c) and fructosamine in evaluating glucose intolerance in children with β-TM and figuring out role of insulin resistance in these patients., Methods: One hundred children diagnosed with β-TM and 100 age and sex-matched controls were enrolled. Fasting plasma glucose (FPG), 2-h post-prandial blood glucose (2-h PG), HbA1c, fructosamine, fasting insulin level (FINS), insulin resistance index (HOMA-IR), and insulin sensitivity index (HOMA-IS) were evaluated., Results: FPG and 2-h PG revealed glucose intolerance in 51 patients (51%), 19 of them had diabetes mellitus. HbA1c, fructosamine, FINS, and HOMA-IR showed a high statistically significant increase in patients compared to controls, (P < 0.001). Results revealed fructosamine was more specific in detecting prediabetes state and more sensitive in identifying diabetes mellitus in our patients when compared to HbA1c., Conclusions: Despite controversies on HbA1c in children with β-TM, it is still valuable in glucose intolerance detection. Fructosamine showed more sensitivity and specificity. Furthermore, insulin resistance was prevalent in children with β-TM highlighting the necessity of regular glycemic state evaluation., Impact: Glucose intolerance is a common complication in beta thalassemia patients. Conflicting data was reported about the role of HbA1c and fructosamine in evaluating glucose intolerance in thalassemic patients. Fructosamine does not yet have a threshold that may be used to distinguish between patients who have diabetes mellitus and those who do not. Fructosamine was more specific in detecting blood glucose intolerance compared to HbA1c and was more sensitive for diagnosing diabetes mellitus. Insulin resistance was common in patients with beta-thalassemia and often present before the onset of overt diabetes., (© 2024. The Author(s).)

Background: Cardiac injury caused by iron overload is the leading cause of mortality and morbidity in patients with beta-thalassemia, owing to frequent blood transfusion, increased iron overload, and blood hemolysis., Objective: This research aimed to assess several novel cardiac biomarkers in the blood samples of children and adult patients with beta-thalassemia major (βTM), along with their respective control groups. These biomarkers included endothelin 1 (ET-1), N-terminal pro-brain natriuretic peptide (NT-proBNP), atrial natriuretic peptide (ANP), growth differentiation factor-15 (GDF-15), and renalase (RNLS)., Methods: This case-control study was done on 46 patients with βTM (23 children <18 years, and 23 adults ≥18 years) from the Genetic Hematology Center in Thi-Qar province, Iraq, and 42 comparable controls in 2 groups (21 for each group) in the period from February to April 2023., Results: Levels of ET-1, NT-proBNP, ANP, GDF-15, RNLS, and ferritin were higher in the children and adults with βTM than in the control subjects., Conclusion: Elevations of the novel cardiac biomarkers ET-1, NT-proBNP, ANP, GDF-15, and RNLS in the sera of children and adult patients with βTM when compared with comparable control subjects confirm that the majority of patients with βTM are at risk of cardiac and cardiovascular complications even when there are no obvious symptoms, especially in children, which gives suitable predictive biomarkers., (© The Author(s) 2024. Published by Oxford University Press on behalf of American Society for Clinical Pathology. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.)

Background: Excessive expression of hemoglobin F (HbF) is a characteristic feature and important diagnostic marker of β 0 -thalassemia/HbE disease. However, some patients may exhibit low-HbF levels, leading to misdiagnosis and precluding genetic counseling. The genetic factors influencing these differences in HbF expression in this atypical disease are not completely understood., Aims: To investigate determinants contributing to the non-elevation of HbF expression in β 0 -thalassemia/HbE disease., Methods: We studied 231 patients with β 0 -thalassemia/HbE confirmed by DNA analysis; classified them into the low-HbF (n = 62) and high-HbF (n = 169) groups; analyzed hematological parameters and hemoglobin levels in both groups; and characterized mutations in β- and α-globin genes and genetic variants in γ-globin promoters., Results: Both groups showed similar rates of type β 0 -thalassemia mutations but significantly different proportions of α-globin mutations: approximately 88.7% (95% confidence interval [CI] = 66.8-115.5) and 39.1% (95% CI = 30.2-49.7) in the low- and high-HbF groups, respectively. The results revealed single-nucleotide polymorphisms (SNPs) at -158 (C>T) in the G γ-globin promoters and novel SNPs at the 5' untranslated region position 25 (G>A) in A γ-globin promoters. The distribution of CC genotypes of the G γ-globin promoter in the low-HbF group was significantly higher than that in the high-HbF group., Conclusions: Cases with HbE predominance with low-HbF levels and undetectable HbA may not be as conclusive as those with homozygous HbE until DNA analysis is performed. Concomitant inheritance of α-thalassemia is an important inherent factor modifying HbF expression in a typical β 0 -thalassemia/HbE, and SNPs with the CC genotype in the G γ-globin promoter may indicate unelevated HbF expression in patients with this disease., (Copyright © 2024 Instituto Mexicano del Seguro Social (IMSS). Published by Elsevier Inc. All rights reserved.)

Background: Hemoglobinopathies are among the most prevalent inherited disorders globally, with carrier prevalence varying significantly across regions. In Saudi Arabia, high rates of consanguineous marriages amplify the risk of these disorders., Aim: This study aims to assess the burden of hemoglobinopathies by evaluating the prevalence and regional distribution of beta-hemoglobin variants, including rare variants, among couples participating in the national premarital screening program., Methods: Data were collected from the premarital genetic screening program and entered into the SEHA platform, covering the 13 administrative regions of Saudi Arabia. Blood samples underwent various screening tests for infectious and genetic diseases. Hemoglobin electrophoresis samples were analyzed using capillary electrophoresis, High-Performance Liquid Chromatography (HPLC), or a combination of both methods., Results: From 2011 to 2018, 1,871,184 individuals were included in the study, with 49.8% male and 50.2% female. The average age was 30.2 years. Hemoglobin S (HbS) was identified in 88,431 individuals (4.7% of the tested population and 78.5% of abnormal screening results), primarily as a sickle cell trait. β-thalassemia was the second most common disorder, identified in 22,420 individuals (1.2% of the population and 19.9% of hemoglobin disorders). HbC and HbD were each detected in 0.04% of cases, while HbO-Arab was identified in 0.007% and HbG in 0.006%. Hemoglobin E and hemoglobin Lepore were found to be extremely rare., Conclusion: The study demonstrates regional variation in the prevalence of hemoglobin genetic variants in Saudi Arabia. To effectively mitigate this risk, it is imperative to strengthen public education and awareness, particularly focusing on genetic screening and counseling., (© 2024. The Author(s).)

Introduction: Ineffective erythropoiesis and subsequent anemia as well as primary and secondary (transfusional) iron overload are key drivers for morbidity and mortality outcomes in patients with β-thalassemia., Areas Covered: In this review, we highlight evidence from observational studies evaluating the association between measures of anemia and iron overload versus outcomes in both non-transfusion-dependent and transfusion-dependent forms of β-thalassemia., Expert Opinion: Several prognostic thresholds have been identified with implications for patient management. These have also formed the basis for the design of novel therapy clinical trials by informing eligibility and target endpoints. Still, several data gaps persist in view of the challenge of assessing prospective long-term outcomes in a chronic disease. Pooling insights on the prognostic value of different measures of disease mechanism will be key to design future scoring systems that can help optimize patient management.

Adipocyte fatty acid-binding protein (A-FABP; FABP4) plays a significant role in the pathogenesis and progression of metabolically driven low-grade inflammation and organ damage. This study aimed to evaluate the performance of circulating FABP4 as a predictive and diagnostic biomarker for thalassemia-associated cardiometabolic events. This case-control study enrolled 50 adults with β-thalassemia and 30 age-, sex-, and body mass index-matched controls. Participants underwent a comprehensive evaluation, including complete blood count, liver and kidney function tests, serum blood glucose, lipid profile, and ferritin levels, pelviabdominal ultrasound, ECG, and echocardiography after taking a full medical history and conducting a clinical examination. Serum levels of FABP4 were measured using an Enzyme-Linked-Immunosorbent-Assay. The diagnostic performance of FABP4 was assessed using receiver operator characteristic (ROC) curve analysis to determine optimal values for excluding and confirming cardiometabolic metflammation. The thalassemia cohort exhibited a statistically significant higher concentration of FABP4 compared to the control group (p-value < 0.001). Positive correlations were found between FABP4 and ferritin serum levels above 800 or 1000 ug/L, as well as with ALT, TGS, and LDL (p-value < 0.05). Circulating FABP4 was identified as a statistically significant risk factor for thalassemia-associated cardiometabolic comorbidities (OR = 84.00, 95%CI:18.6-378.6, p-value < 0.001). ROC analysis determined that the FABP4 exclusionary cut-off value > 2.30 ng/ml could effectively discriminate between thalassemia-associated adverse metaflammation and controls, while the FABP4 confirmatory cut-off value was > 2.58 ng/ml. In conclusion, circulating FABP4 appears to be a potential risk factor for predicting progression to cardiometabolic events in thalassemia-associated adverse metaflammation. FABP4 holds promise as a diagnostic and prognostic biomarker for disease monitoring and risk stratification. Further validation through large-scale, multicenter, prospective studies is warranted., (© 2024. The Author(s).)

Background: Thalassemia is a prevalent monogenic blood disorder, clinically classified into alpha- and beta-thalassemia, characterized by the imbalance of the alpha- and beta-globin chains that constitute adult hemoglobin. Copy number variations (CNVs) and single nucleotide variants in globin genes are the primary genetic defects causing thalassemia., Case Report: During a prenatal examination, a pregnant woman was suspected to be a carrier of thalassemia, exhibiting microcytic hypochromic anemia and abnormal hemoglobin constituents. Gap-polymerase chain reaction (Gap-PCR) and reverse dot blot (PCR-RDB) techniques did not detect any common thalassemia mutations. We conducted hematological examination and further genetic analyses on the proband's family with three generations. Multiplex ligation-dependent probe amplification (MLPA) was employed to identify CNVs, targeted next-generation sequencing was used to screen for potential pathogenic variants, which were subsequently validated by Sanger sequencing. The hematological parameters of the proband, her father and her son all indicated they were beta-thalassemia carriers. MLPA results revealed a large deletion in beta-globin cluster. Further investigation confirmed the presence of a novel 8.2 kb deletion (NC&#95;000011.10:g.5224208&#95;5232469del) in the proband, her father, and her son, specifically covering the entire HBB gene while not impacting other globin genes., Conclusion: We found a novel 8.2 kb deletion leading to beta-thalassemia in a Chinese family in which three generations had been affected. This novel deletion may broaden the spectrum of known mutations in thalassemia and provide a reference for clinically suspected cases., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.)

β-Thalassemia is a prevalent type of severe inherited chronic anemia, primarily identified in developing countries. The identification of single nucleotide polymorphisms (SNPs) plays a vital role in the early diagnosis of genetic diseases. Here, we reported the development of an amplification-free fiber optic nanogold-linked sorbent assay method using a fiber optic particle plasmon resonance (FOPPR) biosensor for rapid and ultrasensitive detection of SNPs. Herein, MutS protein was selected as the biorecognition capture probe and immobilized on the sensing region to capture the target mutant DNA, which was hybridized with a single-base mismatched single-stranded DNA labeled by a gold nanoparticle (AuNP). The AuNP acts as a signaling agent to be detected by the FOPPR biosensor when it is bound on the fiber core surface. The method effectively differentiates mismatched double-stranded DNA by MutS protein from perfectly matched/complementary dsDNA. It exhibits an impressively low detection limit for the detection of SNPs at approximately 10 -16 M using low-cost sensor chips and devices. By determination of the ratio of mutant DNA to normal DNA in cell-free genomic DNA from blood samples, this method is promising for diagnosing β-thalassemia in fetuses without invasive testing techniques.

Background & objectives Timely detection of population with β-thalassemia trait (BTT) followed by genetic counselling is an advocated method of preventing the birth of a child with β-thalassemia major. In this study we aim to assess the diagnostic accuracy of Gazelle, a point-of-care (POC) testing device, in screening for BTT in hospital laboratory setting. Methods Standards for Reporting Diagnostic Accuracy (STARD) guidelines were followed in developing study design, recruiting study participants and sample size calculation for the current research. A consecutive sample of 446 participants was recruited for this study and was tested for the reference test Gazelle as well as the gold standard cation exchange high performance liquid chromatography (CE-HPLC). Low serum ferritin levels are known to interfere with the production of HbA2 and in turn lead to false negative results. Hence, the study population was divided into two categories with respect to a cut off value of 15ng/dl of serum ferritin and the results were analyzed. Results Overall diagnostic accuracy of Gazelle for detecting BTT was found to be 95.3 per cent with a confidence interval (CI) of (92.9 - 97.1) and the sensitivity was 94.5 per cent with a 95% CI of (84.8 - 98.8). When analyzed by the serum ferritin level the diagnostic accuracy was found to be 94.7 per cent (91.1% - 97.1%) and 95.7 per cent (91.8% - 98.1%) for participants with serum ferritin level as > 15 ng/ml and < 15 ng/ml, respectively. Interpretation & conclusions This study found Gazelle to be a good screening tool for β-thalassemia trait with high sensitivity, specificity and accuracy. However, it is recommended that the final confirmation of the diagnosis done by a diagnostic test like HPLC or Capillary Zone Electrophoresis (CZE).

Objective: The objective of this study was to investigate the therapeutic efficacy of thalidomide across various genotype presentations of β-thalassemia so as to facilitate the early screening of thalidomide-sensitive thalassemia cases and to understand the impact of iron overload on thalidomide., Methods: From our initial sample of 52 patients, we observed 48 patients with β-thalassemia for two years after administration of thalidomide. This cohort included 34 patients with transfusion-dependent thalassemia (TDT) and 14 patients with non-transfusion-dependent thalassemia (NTDT). We recorded the values of hemoglobin (Hb), fetal hemoglobin (HbF), and serum ferritin (SF) in the baseline period and at 1, 3, 6, 12, 18, and 24 months after enrollment, as well as the pre- and post-treatment blood transfusion volume in all 48 cases. According to the increase in Hb levels from baseline during the 6-month observation period, the response to thalidomide was divided into four levels: main response (MaR), minor response (MiR), slow response (SLR), and no response (NR). A decrease in serum ferritin levels compared to baseline was considered alleviation of iron overload. We calculated the overall response rate (ORR) as follows: ORR = MaR + MiR + SLR/number of observed cases., Results: The ORR was 91.7% (44/48 cases), and 72.9% showed MaR (35/48 cases). Among the 34 patients with TDT, 21 patients (61.8%) were free of blood transfusion, and the remaining 13 patients still required blood transfusion, but their total blood transfusion volume reduced by 31.3% when compared to the baseline. We found a total of 33 cases with 10 combinations of advantageous genes, which included 5 cases with βCD41-42/βCD17 and 6 cases with βCD41-42/β-28. Based on the treatment outcomes among the 48 cases in the observation group, there were 33 cases in the MaR group and 15 cases in the SLR/NR group. There was a difference in HbF between the two groups at baseline (P = 0.041). There were significant differences between the two groups in Hb and HbF at the time points of 6 and 12 months, respectively (P < 0.001). Compared to the baseline measurement, there was a significant decrease in the level of SF at months 12 and 24 (P < 0.001)., Conclusion: In this study, we identified 10 β-thalassemia gene combinations that were sensitive to thalidomide. These gene combinations can be used for initial screening and to predict the therapeutic effect of thalidomide in clinical practice. We examined the therapeutic response to thalidomide and found that the administration of thalidomide in combination with standardized iron removal was more beneficial in reducing iron overload., (© 2024. The Author(s).)

β-Thalassemia especially transfusion-dependent thalassemia (TDT) associates with a hypercoagulable state, which is the main cause of thromboembolic events (TEE). Plasma viscosity and rheological parameters could be essential markers for determining hypercoagulable state in β-thalassemia patients. The traditional methods for measuring viscosity are often limited by large sample volumes and are impractical for routine clinical monitoring. The compact differential dynamic microscopy-based device (cDDM), an optical microscopy for quantitative rheological assessment, was developed and applied for prognosis of the hypercoagulable state in β-TDT with and without splenectomy. The device was performed plasma viscosity measurement using low plasma volume (8 μL) and revealed a value as modulus of complex viscosity |η(ω)| in 7 min. We also parallelly demonstrated the correlation of the viscosity and related-coagulable parameters: complete blood count, prothrombin time (PT), activated partial thromboplastin time (APTT), protein C (PC), protein S (PS), CD62P and CD63 expression, and platelet aggregation test. The thalassemia plasma exhibited a higher value of |η(ω)| than healthy plasma, which can represent a different viscoelastic property among the groups. Even all related-coagulable parameters indicated hypercoagulable state in both nonsplenectomies and splenectomies β-TDT patients when compared to control, only high platelet numbers significantly correlated to high plasma viscosity in the splenectomy group. However, the other coagulable parameters have shown a trend of positive relationship with high plasma viscosity in all β-1thalassemia TDT patients. The relative results suggested that our device would be an approach tool for early detection of hypercoagulable state in transfusion-dependent-β-thalassemia patients, which can help to prevent TEE and the critical consequent-complications.

Genome-Wide Association Studies (GWASs) have identified a huge number of variants associated with different traits. However, their validation through in vitro and in vivo studies often lags well behind their identification. For variants associated with traits or diseases of biomedical interest, this gap delays the development of possible therapies. This issue also impacts beta-hemoglobinopathies, such as beta-thalassemia and sickle cell disease (SCD). The definitive cures for these diseases are currently bone marrow transplantation and gene therapy. However, limitations regarding their effective use restrict their worldwide application. Great efforts have been made to identify whether modulators of fetal hemoglobin (HbF) and, to a lesser extent, hemoglobin A2 (HbA 2 ) are possible therapeutic targets. Herein, we performed the post-GWAS in vivo validation of two genes, cyclin D3 ( CCND3 ) and nuclear factor I X ( NFIX ), previously associated with HbF and HbA 2 levels. The absence of Ccnd3 expression in vivo significantly increased g (HbF) and d (HbA 2 ) globin gene expression. Our data suggest that CCND3 is a possible therapeutic target in sickle cell disease. We also confirmed the association of Nfix with γ-globin gene expression and present data suggesting a possible role for Nfix in regulating Kruppel-like transcription factor 1 ( Klf1 ), a master regulator of hemoglobin switching. This study contributes to filling the gap between GWAS variant identification and target validation for beta-hemoglobinopathies.

Data on iron overload status and change thresholds that can predict mortality in patients with transfusion-dependent β-thalassemia (TDT) are limited. This was a retrospective cohort study of 912 TDT patients followed for up to 10 years at treatment centers in Italy (median age 32 years, 51.6% female). The crude mortality rate was 2.9%. Following best-predictive threshold identification through receiver operating characteristic curve analyses, data from multivariate Cox-regression models showed that patients with Period Average Serum Ferritin (SF) > 2145 vs ≤ 2145 ng/mL were 7.1-fold (P < 0.001) or with Absolute Change SF > 1330 vs ≤ 1330 ng/mL increase were 21.5-fold (P < 0.001) more likely to die from any cause. Patients with Period Average Liver Iron Concentration (LIC) > 8 vs ≤ 8 mg/g were 20.2-fold (P < 0.001) or with Absolute Change LIC > 1.4 vs ≤ 1.4 mg/g increase were 27.6-fold (P < 0.001) more likely to die from any cause. Patients with Index (first) cardiac T2* (cT2*) < 27 vs ≥ 27 ms were 8.6-fold (P < 0.001) more likely to die from any cause. Similarly, results at varying thresholds were identified for death from cardiovascular disease. These findings should support decisions on iron chelation therapy by establishing treatment targets, including safe iron levels and clinically meaningful changes over time., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Introduction: Major Thalassemia patients suffer from iron overload and organ damage, especially heart and liver damage. Early diagnosis and treatment with a chelator can reduce the complications and mortality of iron overload. Therefore, we aimed to investigate the biochemical and hematological predictors as an alternative and indirect indicator of iron deposition in heart and liver cells in comparison with the MRI T2* method as the gold standard., Material and Method: MRI T2* was evaluated in the heart and liver tissues of 62 major beta-thalassemia patients undergoing regular transfusion and chelator therapy. Biochemical and hematological factors were also measured, including serum ferritin, serum electrolytes, liver enzymes, hemoglobin, blood glucose, and serum magnesium. The correlation between these factors was assessed using statistical evaluations., Result: Serum ferritin had a positive and significant correlation with liver siderosis based on MRI T2* ( p -value = .015), and no significant association was observed with cardiac siderosis ( p -value = .79). However, there was a significant positive correlation between cardiac iron deposition and fasting blood sugar level ( p -value = -.049), and plasma level of liver enzymes (alanine aminotransferase (ALT) ( p -value = .001), aspartate aminotransferase (AST (( p -value = .01)). Moreover, there was a significant negative correlation between cardiac iron overload and plasma magnesium level ( p -value = .014). According to MRI T2*, there was no significant correlation between cardiac and hepatic iron overload ( p value = .36)., Conclusion: An increase in blood sugar or liver enzymes and a decrease in serum magnesium was associated with an increase in cardiac iron overload based on MRI T2*. Liver iron overload based on MRI T2* had a significant correlation with serum ferritin.

Purpose: Patients with beta-thalassemia major (BTM) often develop several endocrine disorders due to chronic iron overload. They are also prone to osteoporosis and vertebral fractures. Plasmatic insulin-like growth factor-1 (IGF-1) levels are often low in subjects with BTM, which origin is multifactorial. The aim of this study was to evaluate a possible relationship between serum IGF-1 levels and the presence of osteoporosis and/or vertebral fractures., Methods: We retrospectively evaluated the occurrence of vertebral fractures in 30 adult male patients affected by BTM (mean age 43.3 ± 7.9 years) with low serum IGF-1 (median value 52.4 ng/ml, 38.5-83.4). Only 6 of them (20.0%) were diagnosed with GH deficiency (GHD) after GHRH/arginine stimulation test, while 23 (76.7%) had osteoporosis and 12 (40.0%) had known vertebral fractures. All patients except one also showed at least one endocrine disorder., Results: Serum IGF-1 was significantly lower in BTM patients with vertebral fractures compared to patients without vertebral fractures (U = 41.0, p = 0.005) while it was not significantly different between patients with low bone mass compared to patients without low bone mass. The diagnosis of GHD was significantly associated with lower serum IGF-1 (p = 0.001) and vertebral fractures (p = 0.002) but not with low bone mass. After ROC analysis, we found that very low IGF-1 (≤ 50.0 ng/dl) was associated with vertebral fractures (sensitivity 83.3%, specificity 75.0%) and was also predictive of GHD (sensitivity 75.0%, specificity 100.0%)., Conclusion: Our study shows that, in male patients with BTM, serum IGF-1 ≤ 50.0 ng/dl is a marker of vertebral fractures and it is predictive of a diagnosis of GHD., (© 2024. The Author(s), under exclusive licence to Italian Society of Endocrinology (SIE).)

The blood counts of α thalassemia carriers (α-thal) are similar to those of β thalassemia carriers, except for Hemoglobin A 2 (Hb A 2 ), which is not elevated. The objective of this study was to determine whether mathematical formulas are effective for detecting suspected α-thal. The data were obtained from the database of the prevention program for detecting couples at risk for having a child with hemoglobinopathy. Red Blood Cells (RBC) indices were analyzed using mathematical formulas, and the sensitivity and negative predictive value (NPV) were calculated. Among 1334 blood counts suspected of α-thal analyzed, only the Shine and Lal and the Support Vector Machine formulas revealed high sensitivity and NPV. Sensitivity was 85.54 and 99.33%, and NPV was 98.93 and 99.93%, respectively. Molecular defects were found in 291, and 81 had normal α genes. Molecular analysis was not performed in 962 of the samples. Based on these results, mathematical formulas incorporating one of these reliable formulas for detecting suspected α or β thalassemia carriers in the program of the automatic analyzers can flag these results, increase the awareness of the primary physicians about the carrier risk, and send an alert with a recommendation for further testing.

Objective: To explore the distribution and hematological characteristics of rare thalassemia-associated mutations in Chenzhou region of Hunan Province with an aim to provide a basis for genetic counseling and effective prevention., Methods: A total of 37 370 individuals enrolled from January 2015 to December 2021 were screened by routine blood test and hemoglobin electrophoresis. The genotypes were determined with high-throughput sequencing., Results: A total of 8 455 thalassemia mutations (including 185 rare ones) were detected, which had involved 27 mutational types. Rare type α-Thalassemia --THAI and CD31 (AGG>AAG) have the typical microcytic hypochromic hematological features, whilst SEA-HPFH, CD14 (CTG>-TG), CD37 (TGG>TAG), -90(C>T), Codon 15 (G>A), IVS-I-128 (T>G), CD86 (GCC>GC-) and Chinese Gγ+(Aγδβ)0 had typical microcytic hypochromic and β-thalassemia-associated hematological features of elevated HbA2 or HbF. In addition, the -50（G>A）heterozygotes of β-thalassemia had normal or slightly decreased MCV and MCH without an increase in HbA2., Conclusion: Various forms of thalassemia-associated mutations have been identified in the Chenzhou region of Hunan Province. Above finding has facilitated development of preventive and control strategies for thalassemia as well as birth health programs.

Background/objectives: CD71 + erythroid cells (CECs) are immature red blood cells (proerythroblasts, erythroblasts, and reticulocytes). CECs play an important role in the development of sepsis and cancer by causing immunosuppression. We examined the CEC levels in the peripheral blood of beta thalassemia (βThal) patients and investigated the relationship between CECs and the clinical status of the patients, especially splenectomy., Methods: Sixty-eight patients with βThal (46 splenectomized and 22 nonsplenectomized) and 15 healthy controls were included in this study. The hemogram parameters, ferritin, and CECs (flow cytometry method) were measured., Results: It was observed that the CEC level in the patient group was significantly higher than the control group (p < 0.05). CEC levels were found to be significantly higher in patients with splenectomy than in patients with nonsplenectomy (p < 0.05). CEC levels were higher in patients with nontransfusion-dependent βT (NTD-βThal) than in patients with transfusion-dependent βT (TD-βThal) (p < 0.05). CEC levels were found to be significantly higher in patients with splenectomy than in patients with nonsplenectomy in both TD-βThal and NTD-βThal groups (p < 0.05). There was a moderate-negative correlation was detected between CECs and Hb levels (r = -0.467; p < 0.05)., Conclusions: High CEC levels in βThal patients develop as a result of ineffective erythropoiesis. We think that keeping CEC levels under control is important for prognosis, especially in patients with splenectomy., (© 2024 The Author(s). Journal of Clinical Laboratory Analysis published by Wiley Periodicals LLC.)

Background and Aim: Frequent administration of blood in β-thalassemia patients can lead to over-loaded iron, a reduction in the levels of antioxidant activities in the body, and oxidative stress. This study was done to evaluate the antioxidant and protective effect of aqueous oak (Quercus brantii) extract supplementation on these patients., Methods: This clinical trial was performed on 60 major β thalassemia patients dividing them into intervention and control groups. In addition to taking desferrioxamine (DFO), the control and intervention groups received respectively placebo capsule supplementation and aqueous Quercus extract capsules (300 mg/day) for 3 months. Serum lipid profiles (LDL-c, HDL-c, triglyceride), Total Antioxidant Capacity (TAC), Glucose, Uric acid, urea nitrogen (BUN), Creatinine, LFT (Liver Function Tests) such as SGOT, SGPT, ALP, Total bilirubin, Direct bilirubin, ferritin, MDA and carbonyl protein (CO) levels were measured before and after the period. In addition, the activity of catalase (CAT), and superoxide dismutase (SOD) was measured in the red blood cell. Furthermore, antioxidant activity and total phenolic content of aqueous Quercus were recorded to standardize capsule formulation., Results: Mean serum MDA, and protein CO, significantly decreased in the intervention group with β-TM after 3 months of treatment with Quercus extract. In addition, the superoxide dismutase (SOD) enzyme and Total antioxidant capacity (TAC) significantly increased in comparison with the control group. Changes in serum creatinine, BUN, and alanine transferase were not significant. In the study, Quercus extract capsules contain 48/56 mg gallic acid/g (dry extract) total phenol, 58/6 mg/g (dry extract), and flavonoids of 63/8 μg/ml antioxidant power which by GC/MS analysis has been measured. At the end of the study, serum MDA decreased from 48.65 ± 8.74 to 43.94 ± 10.39 μ mol/l after administration of oak extract and protein CO dropped from 2.44 ± 0.38 to 1.2 ± 0.31 nmol DNPH/mg protein after administration of the oak extract. At the end of the study serum, TAC increased in patients interventional group from 907 ± 319 to 977 ± 327 μmol FeSO4/l compared to the control group 916 ± 275 to 905.233 ± 233 μmol FeSO4/l with placebo, and SOD increased from 1577 ± 325 to 2079 ± 554 U/l (compared to 1687 ± 323 U/l with placebo). The treatment effect of Quercus was measured using a mixed-effects model of variance analysis for changes in MDA, protein CO, TAC, and SOD, with significant effects being demonstrated for each laboratory parameter (P = 0.15, P = 0.001, P = 0.02, and P < 0.003, respectively)., Conclusions: Aqueous Quercus extract, due to its high antioxidant potential, reduced MDA, serum carbonyl protein, and increased superoxide dismutase activity effectively decreased serum OS and enhanced serum antioxidant capacity in patients with β-thalassemia major. oak given as an adjuvant therapy to standard iron chelators may provide an improvement in the OS measurements obtained in these patients., Registration Information: This study was submitted, evaluated, and approved by the Iranian Registry of Clinical Trials (IRCT: http://www.irct.ir; IRCT2015101411819N4), which was established for national medical schools in Iran., Competing Interests: Declaration of competing interest The authors declared no conflict of interest., (Copyright © 2024 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.)

Hemoglobin (Hb) Malay is a common β hemoglobinopathy in Malaysia caused by A > G mutation in codon 19 leading to β+-thalassemia phenotype. However, screening for Hb Malay is challenging as it is undetectable by routine capillary electrophoresis (CE) or high-performance liquid chromatograpy (HPLC) methods. This study aimed to determine the Hb Malay phenotypes. The study was done on 521 cases with presumed β thalassemia from UKMMC and Hospital Selayang as well as confirmed Hb Malay cases from Hospital Sultanah Bahiyah, Kedah in over a 5-year period. Hb analysis using CE or HPLC followed by multiplex amplification refractory mutation system polymerase chain reaction and DNA sequencing were performed. Significant differences in mean values of haematological parameters among Hb Malay carriers against β thalassemia carriers were determined using one-way ANOVA and ROC analysis. A total of 482/521 cases of β globin mutations were identified. Among these, 54 Hb Malay cases were identified whereby 21 Hb Malay cases were from UKMMC and Hospital Selayang whilst 33 Hb Malay cases were from Hospital Sultanah Bahiyah, Kedah. Fifty-two were Hb Malay carriers whereas two cases were compound heterozygotes. The mean hemoglobin, mean cell volume, mean cell hemoglobin, and HbA of Hb Malay carriers were significantly higher than β° thalassemia carriers. The HbA 2 range of Hb Malay carriers was wider (3.5-5.5%) with median value of 3.9%. A new HbA 2 cutoff value ≤4.6% (AUC 0.717, p  < 0.001) was proposed. Compound heterozygous Hb Malay/IVS1-5(G > C) showed transfusion-dependent thalassemia phenotype. Hb Malay carriers have different red cell and electrophoretic parameters than classical β° thalassemia carriers with wider HbA 2 range. HbA 2 of ≤4.6% should prompt a molecular confirmation for Hb Malay carrier status.

Background: Hyperthyroidism can lead to diverse hematological disorders, such as microcytosis and a mild increase in hemoglobin A2 fraction., Methods: This study reported a 31-year-old woman of Moroccan origin recently diagnosed with Graves' disease. Her blood tests revealed microcytosis, hypochromia, and a normal ferritin level. A phenotypic analysis of hemo-globin was performed using two techniques: capillary electrophoresis and reversed-phase high performance liquid chromatography., Results: Both techniques indicated a slight increase in hemoglobin A2 level. These results initially suggested het-erozygous beta-thalassemia, eventually correlating with the concurrent presence of Graves' disease, as evidenced by the normalization of hemoglobin A2 level following treatment., Conclusions: This case highlights the importance of having clinical, biological, and therapeutic data for a relevant interpretation of a phenotypic hemoglobin study.

Aim: In this study, we investigated how splenectomy affects natural killer (NK) cell levels in patients with β-thalassemia major (β-TM)., Materials and Methods: Seventy patients with β-TM (38 splenectomized and 32 nonsplenectomized) and 25 healthy controls were included in this study. The hemogram parameters, ferritin, T lymphocyte, T-helper cell, T-suppressor cell, and NK cell numbers, were measured., Results: The T lymphocyte (CD3 + ) level was found to be significantly higher in the patient group (p < 0.05). CD3 + /CD4 + T lymphocytes were detected to be significantly higher in the patient group (p < 0.05). Although the CD3 + /CD4 + T lymphocyte level was significantly higher in the nonsplenectomy group (p < 0.05), this was not the case in the splenectomy group. When the patient and control groups were compared, no significant difference was detected regarding CD3 + /CD8 + T lymphocyte levels. CD3 - /CD16 + CD56 + NK cell level was found to be significantly lower only in the splenectomy group than in the control group (p < 0.05). We found that there was a significant negative correlation between serum ferritin levels and both total lymphocyte (r = -0.617) and CD3 + lymphocyte (r = -0.718) levels in the control group (p < 0.05). A significant negative correlation was detected between serum ferritin levels and CD3 - /CD16 + CD56 + NK cell levels in the patient group (r = -0.410) (p < 0.05)., Conclusion: Splenectomy reduces NK cell levels in patients with β-TM. The negative relationship between ferritin levels and NK cells indicates that ferritin levels should be kept under control in patients with β-TM., (© 2024 The Author(s). Journal of Clinical Laboratory Analysis published by Wiley Periodicals LLC.)

Splenectomised β-thalassaemia/haemoglobin E (HbE) patients have increased levels of circulating microparticles or medium extra-cellular vesicles (mEVs). The splenectomised mEVs play important roles in thromboembolic complications in patients since they can induce platelet activation and endothelial cell dysfunction. However, a comprehensive understanding of the mechanism of mEV generation in thalassaemia disease has still not been reached. Thalassaemic mEVs are hypothesised to be generated from cellular oxidative stress in red blood cells (RBCs) and platelets. Therefore, a proteomic analysis of mEVs from splenectomised and non-splenectomised β-thalassaemia/HbE patients was performed by liquid chromatography with tandem mass spectrometry. A total of 171 proteins were identified among mEVs. Interestingly, 72 proteins were uniquely found in splenectomised mEVs including immunoglobulin subunits and cytoskeleton proteins. Immunoglobulin G (IgG)-bearing mEVs in splenectomised patients were significantly increased. Furthermore, complement C1q was detected in both mEVs with IgG binding and mEVs without IgG binding. Interestingly, the percentage of mEVs generated from RBCs with IgG binding was approximately 15-20 times higher than the percentage of RBCs binding with IgG. This suggested that the vesiculation of thalassaemia mEVs could be a mechanism of RBCs to eliminate membrane patches harbouring immune complex and may consequently prevent cells from phagocytosis and lysis., (© 2024 The Authors. British Journal of Haematology published by British Society for Haematology and John Wiley & Sons Ltd.)

Hemoglobin (Hb) Lepore is a rare deletional δβ-thalassemia caused by the fusion between delta-beta genes, and cannot be identified by traditional thaltassemia gene testing technology. The aim of this study was to conduct molecular diagnosis and clinical analysis of Hb Lepore in four unrelated Chinese families using third generation sequencing. Decreased levels of mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and an abnormal Hb band were observed in the probands of the four families. However, no common α and β-thalassemia variants were detected in the enrolled families using polymerase chain reaction-reverse dot blot hybridization based traditional thalassemia gene testing. Further third-generation sequencing revealed similar Hb Lepore-Boston-Washington variants in all the patients, which were resulted from partial coverage of the HBB and HBD globin genes, leading to the formation of a delta-beta fusion gene. Specific gap-PCR and Sanger sequencing confirmed that all the patients carried a similar Hb Lepore-Boston-Washington heterozygote. In addition, decreased levels of MCH and Hb A2 were observed in the proband's wife of family 2, an extremely rare variant of Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) was identified by third-generation sequencing and further confirmed by Sanger sequencing. This present study was the first to report the similar Hb Lepore-Boston-Washington in Chinese population. By combining the utilization of Hb capillary electrophoresis and third-generation sequencing, the screening and diagnosis of Hb Lepore can be effectively enhanced., (© 2024. The Author(s).)

We report a case of Hb S/β 0 -thalassemia (Hb S/β 0 -thal) in a patient who is a compound heterozygote for the Hb Sickle mutation ( HBB :c.20A > T) and a mutation of the canonical splice acceptor sequence of IVS1 (AG > TG, HBB :c.93-2A > T). This is the fifth mutation involving the AG splice acceptor site of IVS1, all of which prevent normal splicing and cause β 0 -thal.

Thalassemia is a group of genetic hematological conditions characterized by the defective synthesis of one or more hemoglobin chains. This genetic anomaly alters globin chain balance, causing hemolysis, ineffective erythropoiesis, and chronic inflammatory diseases. The proinflammatory adipocytokine visfatin is predominantly produced in visceral adipose tissue. Its evaluation in individuals with thalassemia may provide valuable insights into the assessment of disease severity. The aim of this study was to investigate the potential role of visfatin in the development of β-thalassemia and its association with the severity of the illness. The study included 40 patients with β-thalassemia and ten healthy individuals matched by age and sex. Serum visfatin level was measured using ELISA. We found that individuals with β-thalassemia major had significantly higher levels of serum visfatin than those with β-thalassemia minor and the control group ( P < 0.001). A receiver operating characteristic curve revealed that serum visfatin levels were different in the three groups. Our results suggest that the serum level of visfatin is significantly correlated with the severity of β-thalassemia., Competing Interests: The authors declare no conflict of interest., (© 2024 by the authors.)

Kruppel-like factor 1 (KLF1) is an essential erythroid-specific transcription factor. Several reports have shown that KLF1 gene mutations are associated with increased levels of Hb F and Hb A 2 . However, scarce population studies have analysed common KLF1 variations. This study examines the potential association with Hb F and Hb A 2 levels in β-thalassemia (β-thal) carriers of Portugueseancestry of the four common KLF1 gene variants: -251C>G (rs3817621) and -148G>A (rs79334031), in the promoter region; and c.115A>C (p.Met39Leu) (rs112631212) and c.304T>C (p.Ser102Pro) (rs2072597), in exon 2. Ninety-two Portuguese β-thal carriers (43 males and 49 females) aged 2 to 77 years old (mean 32.55 years) were engaged in the study. Hb F levels range from 0.2 to 12.5% and Hb A 2 was above the normal level, ranging from 3.6 to 6%. The Hb A 2 and Hb F levels were determined by high-performance liquid chromatography. Single-nucleotide polymorphisms were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Minor allele frequencies for SNPs rs3817621 (G), rs79334031 (A), rs112631212 (C) and rs2072597 (C) were 0.196, 0.016, 0.011 and 0.169, respectively. Basic simple linear regression in the total population showed no significant associations with the levels of Hb F ( P >0.05). For the low-frequency variant -148A, a statistically significant association was found with increased levels of Hb A 2 (β = 0.855; P = 0.017). In conclusion, an association signal with Hb A 2 levels was observed for the variant -148A>G (rs79334031). The complex pattern of SNP interactions related to their influence on the KLF1 transcriptional activity mayexplain the absence of association with Hb F levels.

GDF15, a hormone acting on the brainstem, has been implicated in the nausea and vomiting of pregnancy, including its most severe form, hyperemesis gravidarum (HG), but a full mechanistic understanding is lacking 1-4 . Here we report that fetal production of GDF15 and maternal sensitivity to it both contribute substantially to the risk of HG. We confirmed that higher GDF15 levels in maternal blood are associated with vomiting in pregnancy and HG. Using mass spectrometry to detect a naturally labelled GDF15 variant, we demonstrate that the vast majority of GDF15 in the maternal plasma is derived from the feto-placental unit. By studying carriers of rare and common genetic variants, we found that low levels of GDF15 in the non-pregnant state increase the risk of developing HG. Conversely, women with β-thalassaemia, a condition in which GDF15 levels are chronically high 5 , report very low levels of nausea and vomiting of pregnancy. In mice, the acute food intake response to a bolus of GDF15 is influenced bi-directionally by prior levels of circulating GDF15 in a manner suggesting that this system is susceptible to desensitization. Our findings support a putative causal role for fetally derived GDF15 in the nausea and vomiting of human pregnancy, with maternal sensitivity, at least partly determined by prepregnancy exposure to the hormone, being a major influence on its severity. They also suggest mechanism-based approaches to the treatment and prevention of HG., (© 2023. The Author(s).)

Background: Excess iron deriving from a chronic transfusion and dietary intake increases the risk for cardiac complications in β-thalassemia major patients. Deferiprone and deferasirox are commonly prescribed to thalassemic patients who are at risk of iron overload. This study aimed to compare the performance and toxicity of deferiprone and deferasirox in β-thalassemia major patients., Methods: A cross-sectional observation was performed on 102 patients with β-thalassemia major. Serum ferritin along with total, indirect, and direct bilirubin levels were measured. Levels of liver enzymes, transaminase (ALT), and aspartate transaminase (AST), were also determined. Ferritin correlations with serum ALT, AST, and total bilirubin were constructed based on Spearman's rank correlation. Statistical differences based on the serum parameters were analyzed between deferiprone and deferasirox groups. The differences of iron chelators' effects between those receiving short-term (≤7 years) and long-term (>7 years) blood transfusion were also analyzed., Results: The averaged levels of bilirubin, ALT, AST, and ferritin were found to be high. Ferritin was positively correlated with ALT (r=0.508 and p <0.001) and AST ((r=0.569; p<0.001). There was no statistical difference in ferritin levels between the deferiprone and deferasirox groups ( p =0.776). However, higher total bilirubin and ALT were observed in the deferasirox group than in the deferiprone group ( p =0.001 and 0.022, respectively). Total ( p <0.001), indirect ( p <0.001), and direct bilirubin levels ( p =0.015) were significantly higher in patients with long-term transfusions than those receiving short-term transfusions. Higher ferritin was found with a statistical significance of p =0.008 in the long-term transfusions group., Conclusions: Ferritin is high in people with transfusion-dependent β-thalassemia major and positively correlated with ALT and AST. Deferasirox might pose a higher risk of developing hepatic injury as compared with deferiprone. Yet, no significant change of deferasirox efficacy (based on ferritin level) was found between those receiving short-term and long-term transfusions., Competing Interests: No competing interests were disclosed., (Copyright: © 2023 Yusuf S et al.)

Thalassaemia is a typically monogenic disease caused by mutations or deletions in the globin gene and has a high prevalence in southern China. Prenatal screening for thalassaemia can be effective in reducing the incidence of thalassaemia. Haematologic parameters of pregnant thalassaemia carriers are diverse and potentially valuable for identifying different types of genotypes. By comparing and evaluating haematological parameters, formulas in the literature, we tried to reveal differences between pregnant women carrying different types of thalassaemia genes. The Mentzer formula (MCV/RBC) showed a strong ability to differentiate thalassaemia genotypes in pregnant women. In addition, combined with haemoglobin electrophoresis HbA2 can further distinguish the -α/αα, α T α/αα, -/αα, β + /N and β 0 /N groups. HbA2 divides them into two groups. Based on the Mentzer formula, we can further decide which type of thalassaemia to screen (α/β and the subgroups) for genotyping. Therefore, this simpler and more cost-effective workflow has great potential for application in screening pregnant women for thalassaemia carriers.Impact Statement What is already known on this subject? Currently, it is known that thalassaemia gene carriers have abnormal blood indicators. Many findings describe their important values in distinguishing thalassaemia and other blood diseases. They combined different metrics as an algorithm to distinguish thalassaemia and iron deficiency anaemia. Prenatal screening is an effective method to reduce the incidence of thalassaemia. The current main method is PCR. Due to technical and financial constraints, many backward places cannot use this technology. The necessity for prenatal screening for thalassaemia has been overlooked. What the results of this study add? Among these algorithms, Mentzer formula revealed differences in haematological parameters during pregnancy between normal individuals and thalassaemia carriers. Combining the HbA2, thalassaemia carriers can be distinguished from normal individuals, including -α/αα, α T α/αα, -/αα, β 0 /N and β + /N. What are the implications of these findings for clinical practice and/or further research? We provide another tool for these hospitals that donot have Hb electrophoresis test and PCR. Then the clinical doctor can get some evidence and suggest women go to another big hospital for essential tests. It is an excellent suggestion. In the future, we will collect more specific gene types and further investigate their potential relationship using these formulas.

Introduction: To the best of our knowledge, the present study is the first in the literature to assess distal femoral cartilage thickness and its relationship with ferritin levels in adult patients with beta thalassaemia major (BTM)., Materials and Methods: 45 patients with BTM and 45 healthy controls were included in the study. Ferritin and haemoglobin levels of the patient and healthy groups were determined by blood analysis and distal femoral cartilage thicknesses were measured via ultrasound. Then, the patient group was divided into subgroups according to whether their ferritin levels were below or above 2500 µg/L. They were then compared among themselves and with the healthy control group using the available data., Results: Distal femoral cartilage thickness values were statistically significantly lower in the BTM group compared to the healthy control group (p values < 0.001). Patients with a ferritin level below 2500 µg/L had statistically significantly higher right and left average distal femoral cartilage thickness values than the patients with a ferritin level above 2500 µg/L (p = 0.029 and p = 0.019, respectively). The right and left average distal femoral cartilage thickness values of the patient subgroup with low ferritin levels were statistically similar to the control group (p = 0.146 and p = 0.164, respectively)., Conclusion: Our study showed that thalassaemia patients are more likely to develop osteoarthritis (OA) than the normal population and possible OA development can be prevented by keeping the ferritin levels of these patients in the optimum range., (© 2022. The Japanese Society Bone and Mineral Research.)

This study was conducted to assess the level of proteins C and S in patients with thalassemia intermedia from the Thalassemia Center in Erbil, Iraq. This study aimed to evaluate protein C and S levels in patients with β-thalassemia intermedia and correlate them to different clinical and laboratory parameters. This comprehensive descriptive case-control study was conducted in 2021. Twenty-three thalassemia intermedia patients were recruited. After the participants' demographic data were recorded, plasma levels of both proteins were measured. The acquired files were examined for the 23 patients studied, 48% of whom were female. The mean age of the patients was 16.32 years. The findings show that the proportion of protein C in males was greater than in females, while this percentage contrasts when compared with protein S (ranging between 89-99% and 85-96%, respectively). Concerning age, these two types of protein in children have more value compared to older ages. Only seven people had less than 1,000 ferritins, while the others had higher values. A decrease in proteins C and S was observed in the thalassemia intermediate compared to the control group. There was a significant relationship between the decreased protein C and S levels with splenectomy. Given the significant reduction in protein C and S levels among patients with thalassemia intermediate compared to the control group, there is an increased risk of thromboembolic events in patients with thalassemia intermediate., Competing Interests: The author declares no conflict of interest., (©2022 JOURNAL of MEDICINE and LIFE.)

Reduction or total lack of beta-globin chains caused by a congenital disease called ß-thalassemia major is one of the lives threatening diseases. Patients who suffer from ß-thalassemia need a repeated blood transfusion for survival. The repeated blood transfusion in ß-thalassemia patients may cause oxidative stress and tissue injury due to iron overload, altered antioxidant enzymes, and other essential trace element levels. The current study aimed to investigate the correlation of oxidative stress with serum trace element levels and antioxidant enzyme status in ß-thalassemia major patients. A total of 130 serum samples were obtained from ß-thalassemia major patients (n=100; 50 males and 50 females) and healthy individuals (n=30; 15 males and 15 females). Hematological parameters were measured on both groups by a comprehensive blood test that included the amount of hemoglobin Hb, packed cells volume, number of red blood cells, mean corpuscular volume ratio, mean corpuscular hemoglobin ratio, mean corpuscular hemoglobin concentration, red cell distribution width, white blood cells, and platelets counts. All of these blood parameters showed a clear decrease in thalassemia patients, except for red blood cells and platelets counts, which demonstrated a significant increase. The highest significant mean for iron in males and females were 233.768 and 219.150 µgm\dL in patients, respectively, while the mean level of iron significantly reduced in the control group (113.40 and 103.33 µgm\dL in males and females, respectively). The results indicated a significant decrease in uric acid in males and females in the patient group (41.042 and 40.582 mg\L in males and females, respectively), compared to the control group (53.866 and 43.60 mg\L in males and females, respectively). Allantoin concentration was detected by high-performance liquid chromatography technique, the results of which showed that the highest values in patients were 62.822 and 25.480 mg\L in males and females, respectively, compared to the control group 2.342 and 1.481 mg\L in males and females, respectively. Superoxide dismutase concentration decreased in patients (129.635 and 111.848 U\mL in males and females, respectively), compared to the control group (208.623 and 190.413 U\ml in males and females, respectively).

Hydroxyurea is an antimetabolite drug that induces fetal haemoglobin in sickle cell disease. However, its clinical usefulness in β-thalassaemia is unproven. We conducted a randomised, double-blind, placebo-controlled clinical trial to evaluate the efficacy and safety of hydroxyurea in transfusion-dependent β-thalassaemia. Sixty patients were assigned 1:1 to oral hydroxyurea 10-20 mg/kg/day or placebo for 6 months by stratified block randomisation. Hydroxyurea treatment did not alter the blood transfusion volume overall. However, a significantly higher proportion of patients on hydroxyurea showed increases in fetal haemoglobin percentage (89% vs. 59%; p < 0.05) and reductions in erythropoietic stress as measured by soluble transferrin receptor concentration (79% vs. 40%; p < 0.05). Based on fetal haemoglobin induction (> 1.5%), 44% of patients were identified as hydroxyurea-responders. Hydroxyurea-responders, required significantly lower blood volume (77 ± SD27ml/kg) compared to hydroxyurea-non-responders (108 ± SD24ml/kg; p < 0.01) and placebo-receivers (102 ± 28ml/kg; p < 0.05). Response to hydroxyurea was significantly higher in patients with HbE β-thalassaemia genotype (50% vs. 0%; p < 0.01) and Xmn1 polymorphism of the γ-globin gene (67% vs. 27%; p < 0.05). We conclude that oral hydroxyurea increased fetal haemoglobin percentage and reduced erythropoietic stress of ineffective erythropoiesis in patients with transfusion-dependent β-thalassaemia. Hydroxyurea reduced the transfusion burden in approximately 40% of patients. Response to hydroxyurea was higher in patients with HbE β-thalassaemia genotype and Xmn1 polymorphism of the γ-globin gene., (© 2022. The Author(s).)

Background: Betibeglogene autotemcel (beti-cel) gene therapy for transfusion-dependent β-thalassemia contains autologous CD34+ hematopoietic stem cells and progenitor cells transduced with the BB305 lentiviral vector encoding the β-globin (β A-T87Q ) gene., Methods: In this open-label, phase 3 study, we evaluated the efficacy and safety of beti-cel in adult and pediatric patients with transfusion-dependent β-thalassemia and a non-β 0 /β 0 genotype. Patients underwent myeloablation with busulfan (with doses adjusted on the basis of pharmacokinetic analysis) and received beti-cel intravenously. The primary end point was transfusion independence (i.e., a weighted average hemoglobin level of ≥9 g per deciliter without red-cell transfusions for ≥12 months)., Results: A total of 23 patients were enrolled and received treatment, with a median follow-up of 29.5 months (range, 13.0 to 48.2). Transfusion independence occurred in 20 of 22 patients who could be evaluated (91%), including 6 of 7 patients (86%) who were younger than 12 years of age. The average hemoglobin level during transfusion independence was 11.7 g per deciliter (range, 9.5 to 12.8). Twelve months after beti-cel infusion, the median level of gene therapy-derived adult hemoglobin (HbA) with a T87Q amino acid substitution (HbA T87Q ) was 8.7 g per deciliter (range, 5.2 to 10.6) in patients who had transfusion independence. The safety profile of beti-cel was consistent with that of busulfan-based myeloablation. Four patients had at least one adverse event that was considered by the investigators to be related or possibly related to beti-cel; all events were nonserious except for thrombocytopenia (in 1 patient). No cases of cancer were observed., Conclusions: Treatment with beti-cel resulted in a sustained HbA T87Q level and a total hemoglobin level that was high enough to enable transfusion independence in most patients with a non-β 0 /β 0 genotype, including those younger than 12 years of age. (Funded by Bluebird Bio; HGB-207 ClinicalTrials.gov number, NCT02906202.)., (Copyright © 2021 Massachusetts Medical Society.)

Two common hemoglobinopathies, sickle cell disease (SCD) and β-thalassemia, arise from genetic mutations within the β-globin gene. In this work, we identified a 500-bp motif (Fetal Chromatin Domain, FCD) upstream of human ϒ-globin locus and showed that the removal of this motif using CRISPR technology reactivates the expression of ϒ-globin. Next, we present two different cell morphology-based machine learning approaches that can be used identify human blood cells (KU-812) that harbor CRISPR-mediated FCD genetic modifications. Three candidate models from the first approach, which uses multilayer perceptron algorithm (MLP 20-26, MLP26-18, and MLP 30-26) and flow cytometry-derived cellular data, yielded 0.83 precision, 0.80 recall, 0.82 accuracy, and 0.90 area under the ROC (receiver operating characteristic) curve when predicting the edited cells. In comparison, the candidate model from the second approach, which uses deep learning (T2D5) and DIC microscopy-derived imaging data, performed with less accuracy (0.80) and ROC AUC (0.87). We envision that equivalent machine learning-based models can complement currently available genotyping protocols for specific genetic modifications which result in morphological changes in human cells., (© 2022. The Author(s).)

In patients with beta-thalassaemia intermedia or major, hepcidin induces iron overload by continuously promoting iron absorption. There have been no studies in pregnant women with beta-thalassaemia minor combined with iron deficiency anaemia (IDA), examining whether hepcidin is inhibited by GDF15, as may occur in patients with beta-thalassaemia intermedia or major, or whether the iron metabolism characteristics and the effect of iron supplementation are consistent with simple IDA in pregnancy. We compared and analysed routine blood parameters, iron metabolism parameters, the GDF15 levels, and the hepcidin levels among four groups, namely the beta-thalassaemia (β) + IDA, β, IDA, and normal groups. In addition, the β + IDA and IDA groups received iron supplementation for four weeks. We found no statistically significant correlation between hepcidin and GDF15 in any group, but a positive correlation was observed between hepcidin and ferritin. After iron supplementation, the routine blood parameters and iron metabolism parameters in the β + IDA group were improved, and the hepcidin content was significantly increased. These results suggest that in pregnant women with beta-thalassaemia minor, hepcidin functions normally to maintain iron homeostasis, and that iron supplementation is effective and safe., (© 2021 British Society for Haematology and John Wiley & Sons Ltd.)

In β-thalassaemia, the severity of inherited β-globin gene mutations determines the severity of the clinical phenotype at presentation and subsequent transfusion requirements. However, data on associated long-term outcomes remain limited. We analysed data from 2109 β-thalassaemia patients with available genotypes in a global database. Genotype severity was grouped as β 0 /β 0 , β 0 /β + , β + /β + , β 0 /β ++ , β + /β ++ , and β ++ /β ++ . Patients were followed from birth until death or loss to follow-up. The median follow-up time was 34·1 years. Mortality and multiple morbidity outcomes were analyzed through five different stratification models of genotype severity groups. Interestingly, β 0 and β + mutations showed similar risk profiles. Upon adjustment for demographics and receipt of conventional therapy, patients with β 0 /β 0 , β 0 /β + , or β + /β + had a 2·104-increased risk of death [95% confidence interval (CI): 1·176-3·763, P = 0·011] and 2·956-increased odds of multiple morbidity (95% CI: 2·310-3·784, P < 0·001) compared to patients in lower genotype severity groups. Cumulative survival estimates by age 65 years were 36·8% for this subgroup compared with 90·2% for patients in lower genotype severity groups (P < 0·001). Our study identified mortality and morbidity risk estimates across various genotype severity groups in patients with β-thalassaemia and suggests inclusion of both β + and β 0 mutations in strata of greatest severity., (© 2021 British Society for Haematology and John Wiley & Sons Ltd.)

Background: Patients with thalassemia major may suffer from complications due to iron overload. It has been suggested that several adipokines may play a potential role in the development of complications in thalassemia. Fatty acid-binding protein 4 (FABP4) is one of the adipokines, bridging several aspects of metabolic and inflammatory pathways. Little is known about the relationship between this adipokine and cardiac and liver function, especially in patients with thalassemia major., Aims: This study is aimed at determining serum FABP4 levels in patients with thalassemia major and whether its concentration correlated with serum ferritin levels, as well as cardiac and liver function., Methods: Thalassemia major outpatients ( n = 48) completed laboratory examination, echocardiography, and electrocardiography., Results: The mean age was 21.9 ± 8.0 years. A negative and weak correlation between serum ferritin and FABP4 was observed ( r = -0.291, p < 0.05). In addition, there was moderate and positive correlation between left atrial volume index (LAVI) and FABP4 ( r = 0.316, p < 0.05)., Conclusions: Serum FABP4 correlated with serum ferritin and cardiac function in patients with thalassemia major. FABP4 may be a potential clinical biomarker for cardiac dysfunction via metabolic and inflammatory pathways due to iron accumulation and toxicity in patients with thalassemia major., Competing Interests: The authors declare that there are no conflicts of interest., (Copyright © 2021 Pandji I. Fianza et al.)

Introduction: The objective of the study was to evaluate the performance of the Abbott Alinity hq advanced multi angle polarized scatter separation (MAPSS TM )-based optical RBC technology, for the differentiation between iron deficiency anemia (IDA) and β-thalassemia carrier status., Methods: Four hundred and sixty-four samples were analyzed. 228 were healthy controls, 30 were β-thalassemia carriers, and 40 were IDA. Receiver operating characteristics analysis evaluated the performance of red cell parameters and mathematical formulas., Results: RBC concentration was the most efficient discriminant (area under the curve; AUC of 0.963, Youden Index of 0.88) followed by red blood cell distribution width in size distribution (AUC of 0.960 and YI of 0.86), and red blood cell distribution width coefficient of variation (AUC of 0.924, and YI of 0.74). The absolute reticulocyte concentration showed good diagnostic efficiency, with AUC of 0.808. Hemoglobin distribution width, the %CV of directly measured cellular hemoglobin concentration, and CHCr, the average hemoglobin concentration of reticulocytes have emerged as novel discriminating parameters, with AUC of 0.749 and 0.785, respectively. The England and Fraser index was the best discriminating mathematical formula based on Youden Index of 0.91. The Ricerca, red blood cell distribution width index, Green and King, and Mentzner Index formulas also showed strong discriminative power. The Shine and Lal index, together with the recent mathematical formula M/H, (ratio of percent microcytic and hypochromic red blood cells) demonstrated moderate performance with AUC of 0.796 and 0.740, respectively., Conclusion: Extended red cell analysis delivered by the advanced optical technology on the Alinity hq hematology analyzer has efficient diagnostic utility in the initial discrimination of the two most common microcytic anemias: IDA and β-thalassemia trait., (© 2021 John Wiley & Sons Ltd.)

Introduction: β-thalassemia is a severe hereditary hemolytic anemia. Due to the diversity of mutations spectrum, β-thalassemia manifests a highly heterogeneous clinical severity. We noted that a previous report characterized HBB:c.313delA, at the end of exon 2, as a β-thalassemia trait rather than dominant β-thalassemia, the classification given to similar mutations. We further explored the impact of this functional variant on globin structure through larger pedigree analysis and in vitro studies., Methods: Hematological analysis and molecular genotyping were conducted on the proband and his family members. We evaluated functional effects of the variant on β-globin gene in the proband's nucleated erythrocytes and transfected HEK-293T cells. Three-dimensional construction of protein structure was carried out in silico to demonstrate amino acid changes., Results: The thalassemia major proband was identified as a compound heterozygote of HBB:c.313delA and HBB:c.126&#95;129delCTTT. Three family members with heterozygotes of HBB:c.313delA displayed microcytic hypochromic anemia. Molecular characterization demonstrated that the frameshift mutation could give rise to retro-positioning of the termination codon, resulting in an elongated β-globin chain with an extension of 10 amino acids. Clinical phenotype and functional experiments indicated that HBB:c.313delA led to β 0 -thalassemia phenotype., Conclusion: We concluded that the phenotype of HBB:c.313delA was mainly related to the stability of mutant mRNA, the degradation of mutant proteins, and production of inclusion bodies according to a systematic description of clinical phenotype and a series of molecular experiments., (© 2021 John Wiley & Sons Ltd.)

Background: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene., Methods: Next-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis., Results: NGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11&#95;95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed., Conclusion: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population., (© 2021 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.)