Search

Background: Hemoglobin (Hb) Hekinan II (A27; Glu-Asp) is an α-chain variant, and its interaction with the common Southeast Asian (--SEA/) α-thalassemia (α-thal) deletion is rarely reported. This study provides a clinical update of Hb Hekinan II associated with (--SEA/) α-thal., Methods: A total of 11 simple heterozygotes and 20 composite heterozygotes for Hb Hekinan II and (--SEA/) α-thal were included based on molecular diagnosis., Results: Hb Hekinan II exhibited a significant increase in hemoglobin, mean corpuscular volume, and mean corpuscular hemoglobin content, but a decrease in red blood cell level compared with α+ thalassemia deletion. Compared with (--SEA/) α-thal, composite heterozygotes for Hb Hekinan II and (--SEA/) α-thal showed similar erythrocyte parameters. Both heterozygotes with and without (--SEA/) α-thal showed low Hb A2 level. Hb Hekinan II showed abnormal performance in high-performance liquid chromatography but not in capillary electrophoresis., Conclusion: Hb Hekinan II is a benign Hb variant. The heterozygotes exhibit clinically asymptomatic coinheritance with (--SEA/) α-thal having comparable hematological phenotype to simple (--SEA/) α-thal. The combination of hematological and molecular analysis helped to improve the detection rate of this rare variant., (© The Author(s) 2024. Published by Oxford University Press on behalf of American Society for Clinical Pathology. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.)

To determine the molecular basis, genotype - phenotype relationship, and genetic origin of Hemoglobin (Hb) Hekinan associated with several forms of α-thalassemia and other hemoglobinopathies for a better understanding of its diverse clinical phenotypes. Seventeen participants with suspected abnormal Hb were studied. Hb analysis was performed using high-performance liquid chromatography (HPLC) and capillary electrophoresis (CE). Mutational and α-haplotypic and structural analyses were conducted, and the effects of mutations on globin-chain stability were determined. All participants harbored Hb Hekinan II (HBA1:c.84 G>T) co-inherited with another α-globin gene anomaly. Three novel genotypes, (αα Hekinan /α CS α), (αα Hekinan /α CS α,β A /β E ), and (αα Hekinan /α CS α,β E /β E ), were characterized. Despite being co-inherited with both α- and β-Hb variants Hb Hekinan II led to minimal changes in erythrocyte parameters, suggesting a non-pathological nature. HPLC but not CE revealed a distinct small shoulder-like Hb pattern. Thai Hb Hekinan II was strongly associated with haplotype [+ - S + - - -] and the possibility of four different haplotypes, while two Burmese Hb Hekinan II were associated with haplotypes [± - S + - + -] and [± - S + - - -]. The novel genotypes identified provide a fresh perspective on Hb Hekinan II diversity. HPLC has superior identification capabilities for samples of Hb Hekinan II co-inherited with α-thalassemia. Thai and Burmese Hb Hekinan II have diverse origins.

Background: The global prevalence of α-thalassemia necessitates effective newborn screening strategies due to its severe clinical consequences. Traditional methods such as liquid chromatography (LC), capillary electrophoresis (CE), and isoelectric focusing (IEF) face limitations, including low separation efficiency, poor sensitivity for detecting Hb Bart's, and time-intensive operations, particularly with dried blood spots (DBS). These limitations hinder timely and accurate screening. This study addresses the need for a more efficient, sensitive, and rapid method for detecting Hb Bart's in newborns., Results: We enhanced IEF separation and sensitivity by designing a microfluidic IEF (mIEF) system with shortened columns and employing a coelution sample loading technique using oil-sealed blood spots for rapid sample pretreatment. Our experiments demonstrated significant improvements: the total analysis time was reduced from 1110 min (IPG IEF) and 46 min (LC) per batch to 36 min per batch. For individual samples, the focusing time decreased from 6 min (previous mIEF) to 3 min, with the microcolumn length shortened by 50 %, from 30 mm to 15 mm. The developed method showed excellent consistency with clinical Bart's detection and PCR diagnosis, achieving 100 % sensitivity and 98 % specificity for α-thalassemia screening., Significance and Novelty: Our novel mIEF method provides an efficient, sensitive, and rapid tool for screening newborns for α-thalassemia. This advancement addresses the limitations of traditional techniques, improving early diagnosis and intervention strategies and ultimately enhancing health outcomes for at-risk newborns., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Objective: To analyze the hematological phenotype and genotype of HbA2 : c.96-2A > G carriers., Methods: The blood routine parameters and hemoglobin electrophoresis of rare cases were analyzed and identified by PCR combined with reverse dot blot (RBD-PCR), GAP-PCR and DNA sequencing., Results: Among the 7 patients, one adult patient had normal hemoglobin levels, with slightly decreased mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH). Hb Bart's band was found in 6 neonates by hemoglobin electrophoresis, of which the content of Hb Bart's band in 1 neonate was 15.80%, and the content of Hb Bart's band in the other 5 neonates was 0.30%-0.90%. The results of genetic analysis showed that all the 7 patients had HbA2 : c.96-2A > G (IVS-I-116A > G) mutation, in which 1 case was compounded with - SEA deletion., Conclusion: HbA2 : c.96-2A > G mutation carriers exhibit the phenotype of α-thalassemia, and when the HbA2 :c.96-2A > G mutation is combined with - SEA deletion, an intermediate phenotype of anemia is produced.

Objectives: This study aimed to establish a droplet digital polymerase chain reaction (ddPCR) assay for South-East Asian (SEA) deletion based on a fully integrated digital PCR system DropXpert S6., Methods: A total of 151 whole blood samples, 10 chorionic villus samples, and 17 amniotic fluid samples were collected, including 106 SEA heterozygotes, 43 normal individuals, 10 Hb Bart's hydrops details, and 19 SEA deletions combined with other genotypes.Genotypes of these samples were determined by the Gap-PCR method. We perform a series of optimizations of the ddPCR system to ensure the performance of the entire ddPCR reaction, such as droplet stability, fluorescence clustering, sensitivity, and accuracy., Results: Our assay exhibited 99.4% (177/178) accuracy compared with the Gap-PCR method, and the minimum detection limit of DNA was 0.1 ng/μL.Both targets have reliable linearity, R 2  = 0.9999 for the α-thalassemia SEA deletion allele and R 2  = 1 for the wild-type allele. The coefficient of variation for α-thalassemia SEA deletion allele detection at 2 and 10 ng/μL concentrations was 5.42% and 1.91%, respectively. In contrast, the coefficient of variation for wild-type allele detection was 4.06% and 1.83%, demonstrating its high quantitative accuracy. In addition, the DropXpert S6 PCR system showed some advantages over other ddPCR instruments, such as reducing testing costs, simplifying and automating the workflow., Conclusions: The DropXpert S6 PCR system provided a highly accurate diagnosis for α-thalassemia SEA deletion and can be used to detect α-thalassemia as an alternative method.

The isoelectric focusing has realized various improvements, including the protocols and creation of mIEF (microcolumn isoelectric focusing) instruments with excellent sensitivity for screening of diabetes and beta thalassemia. However, the problem of manual sample loading and hydration for the mIEF limits the operational capacity for stably detecting and quantitating most abnormal hemoglobin (Hb). Herein, we provided a high stable sample loading protocol for analysis of alpha thalassemia and Hb variants. In contrast to the previous volume of 20 μl, a 100 µl blood sample solution in this protocol was optimized with mixture of 6.4-7.5 and 3-10 pH carrier ampholytes, pI markers and loaded for 30 mins IPG microcolumn hydration. The hydrated microcolumn was then automatically loaded onto the mIEF chip array to which CH 3 COOH and NH 4 OH act as anodic and cathodic solutions. Lastly, the IEF was run for 9 mins. Hb H, Barts, A 1c , F, A 2 and CS were simultaneously separated and focused with higher resolution and sensitivity in quantifying H and Barts as low as 0.6 and 0.5 % respectively. Accordingly, there was an enhanced stability and linearity with a rapid assay time of 45 secs per sample. Moreover, analysis showed a fitting linear relationship with conventional technology at R 2  = 0.9803 for H and R 2  = 0.9728 for Barts thereby indicating greater accuracy confirmed by the AUC. Hence, the developed protocol could simply be employed for high stable and throughput batch sample loading of hydration, and accurate separation and quantitation of Hb variants for alpha and beta thalassemia., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

The blood counts of α thalassemia carriers (α-thal) are similar to those of β thalassemia carriers, except for Hemoglobin A 2 (Hb A 2 ), which is not elevated. The objective of this study was to determine whether mathematical formulas are effective for detecting suspected α-thal. The data were obtained from the database of the prevention program for detecting couples at risk for having a child with hemoglobinopathy. Red Blood Cells (RBC) indices were analyzed using mathematical formulas, and the sensitivity and negative predictive value (NPV) were calculated. Among 1334 blood counts suspected of α-thal analyzed, only the Shine and Lal and the Support Vector Machine formulas revealed high sensitivity and NPV. Sensitivity was 85.54 and 99.33%, and NPV was 98.93 and 99.93%, respectively. Molecular defects were found in 291, and 81 had normal α genes. Molecular analysis was not performed in 962 of the samples. Based on these results, mathematical formulas incorporating one of these reliable formulas for detecting suspected α or β thalassemia carriers in the program of the automatic analyzers can flag these results, increase the awareness of the primary physicians about the carrier risk, and send an alert with a recommendation for further testing.

Background: Post-transfusion survival of donor red blood cells (RBCs) is important for effective chronic transfusion therapy in conditions including sickle cell disease (SCD). Biotin labeling RBCs allows direct in vivo measurement of multiple donor RBC units simultaneously post-transfusion., Study Design and Methods: In an observational trial of patients with SCD receiving monthly chronic transfusion therapy, aliquots of RBCs from one transfusion episode were biotin-labeled and infused along with the unlabeled RBC units. Serial blood samples were obtained to measure RBC survival. Donor units were tested for RBC indices, hemoglobin fractionation, and glucose-6-phosphate dehydrogenase (G6PD) enzyme activity. For microcytic donor RBCs (MCV < 70 fL), HBA1 and HBA2 genetic testing was performed on whole blood., Results: We present one recipient, a pediatric patient with SCD and splenectomy who received two RBC units with aliquots from each unit labeled at distinct biotin densities (2 and 18 μg/mL biotin). One donor unit was identified to have microcytosis (MCV 68.5 fL after biotinylation); whole blood sample obtained at a subsequent donation showed 2-gene deletion alpha-thalassemia trait (ɑ- 3.7kb /ɑ- 3.7kb ) and normal serum ferritin. G6PD activity was >60% of normal mean for both. The RBCs with alpha-thalassemia RBC had accelerated clearance and increased surface phosphatidylserine post-transfusion, as compared with the normocytic RBC (half life 65 vs. 86 days, respectively)., Discussion: Post-transfusion RBC survival may be lower for units from donors with alpha-thalassemia trait, although the impact of thalassemia trait donors on transfusion efficacy requires further study., (© 2024 AABB.)

Thalassaemia is a typically monogenic disease caused by mutations or deletions in the globin gene and has a high prevalence in southern China. Prenatal screening for thalassaemia can be effective in reducing the incidence of thalassaemia. Haematologic parameters of pregnant thalassaemia carriers are diverse and potentially valuable for identifying different types of genotypes. By comparing and evaluating haematological parameters, formulas in the literature, we tried to reveal differences between pregnant women carrying different types of thalassaemia genes. The Mentzer formula (MCV/RBC) showed a strong ability to differentiate thalassaemia genotypes in pregnant women. In addition, combined with haemoglobin electrophoresis HbA2 can further distinguish the -α/αα, α T α/αα, -/αα, β + /N and β 0 /N groups. HbA2 divides them into two groups. Based on the Mentzer formula, we can further decide which type of thalassaemia to screen (α/β and the subgroups) for genotyping. Therefore, this simpler and more cost-effective workflow has great potential for application in screening pregnant women for thalassaemia carriers.Impact Statement What is already known on this subject? Currently, it is known that thalassaemia gene carriers have abnormal blood indicators. Many findings describe their important values in distinguishing thalassaemia and other blood diseases. They combined different metrics as an algorithm to distinguish thalassaemia and iron deficiency anaemia. Prenatal screening is an effective method to reduce the incidence of thalassaemia. The current main method is PCR. Due to technical and financial constraints, many backward places cannot use this technology. The necessity for prenatal screening for thalassaemia has been overlooked. What the results of this study add? Among these algorithms, Mentzer formula revealed differences in haematological parameters during pregnancy between normal individuals and thalassaemia carriers. Combining the HbA2, thalassaemia carriers can be distinguished from normal individuals, including -α/αα, α T α/αα, -/αα, β 0 /N and β + /N. What are the implications of these findings for clinical practice and/or further research? We provide another tool for these hospitals that donot have Hb electrophoresis test and PCR. Then the clinical doctor can get some evidence and suggest women go to another big hospital for essential tests. It is an excellent suggestion. In the future, we will collect more specific gene types and further investigate their potential relationship using these formulas.

Introduction: Liver iron overload is common in patients with thalassemia. In patients with beta-thalassemia, the correlation between serum ferritin and liver iron concentration is well established. The correlation between serum ferritin levels and liver iron concentrations in patients with alpha-thalassemia remains limited., Methods: This is a cross-sectional study in patients with alpha-thalassemia aged ≥ 18 years old at Srinagarind Hospital, Khon Kaen University, Thailand. Liver iron concentration (LIC) was evaluated by the MRI-T2* technique. Linear logistic regression analysis was used to determine the correlation between serum ferritin levels and liver iron concentrations., Results: One hundred and thirty-one of the MRI-T2* measurements from 65 patients with alpha-thalassemia were evaluated. Patients with non-deletional alpha-thalassemia had higher LIC compared to patients with deletional alpha-thalassemia. The serum ferritin levels were relatively low at the same levels of LIC in patients with non-deletional alpha-thalassemia compared to deletional alpha-thalassemia ., Conclusions: The correlation of serum ferritin levels and LIC was modest and different among alpha-thalassemia genotypes. A different serum ferritin threshold is needed to guide iron chelation therapy in patients with alpha-thalassemia. Evaluation of liver iron concentration is necessary for patients with alpha-thalassemia, especially in patients with non-deletional alpha-thalassemia.

Introduction: The high-sequence homology of the α-globin-gene cluster is responsible for microhomology-mediated recombination events during meiosis, resulting in a high density of deletion breakpoints within a 10 kb region. Commonly used deletion detection methods, such as multiplex ligation-dependent probe amplification (MLPA) and Southern blot, cannot exactly define the breakpoints. This typically requires long-range PCR, which is not always successful. Targeted locus amplification (TLA) is a targeted enrichment method that can be used to sequence up to 70 kb of neighboring DNA sequences without prior knowledge about the target site., Methods: Genomic DNA (gDNA) TLA is a technique that folds isolated DNA, ensuring that adjacent loci are in a close spatial proximity. Subsequent digestion and religation form DNA circles that are amplified using fragment-specific inverse primers, creating a library that is suitable for Illumina sequencing., Results: Here, we describe the characterization of a rare 16 771 bp deletion, utilizing gDNA TLA with a single inverse PCR primer set on one end of the breakpoint. Primers for breakpoint PCR were designed to confirm the deletion breakpoints and were consequently used to characterize the same deletion in 10 additional carriers sharing comparable hematologic data and similar MLPA results., Conclusions: The gDNA TLA technology was successfully used to identify deletion breakpoints within the alpha-globin cluster. The deletion was described only once in an earlier study as the -- gb , but as it was not registered correctly in the available databases, it was not initially recognized as such., (© 2021 The Authors. International Journal of Laboratory Hematology published by John Wiley & Sons Ltd.)

Background: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene., Methods: Next-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis., Results: NGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11&#95;95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed., Conclusion: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population., (© 2021 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.)

The present study tested the impact of α-thalassaemia on oxygen gradient ektacytometry in sickle cell anaemia (SCA). Three SCA groups were compared: (i) no α-thalassaemia (four α-genes, n = 62), (ii) silent α-thalassaemia (three α-genes, n = 35) and (iii) homozygous α-thalassaemia (two α-genes, n = 12). Red blood cell (RBC) deformability measured in normoxia was not different between the three groups. The lowest RBC deformability reached at low oxygen partial pressure (pO 2 ) was greater and the pO 2 at which RBC started to sickle was lower in the two α-genes group compared to the other groups. Our present study showed an effect of α-thalassaemia on oxygen gradient ektacytometry in SCA., (© 2021 British Society for Haematology and John Wiley & Sons Ltd.)

The aim of the study was to assess the clinical utility of a third-generation sequencing (TGS) approach termed comprehensive analysis of thalassemia alleles (CATSA) for identifying both α and β thalassemia genetic carrier status. Prospective blood samples (n = 1759) with abnormal hemoglobin parameters were screened for pathogenic thalassemia variants by CATSA on the PacBio TGS platform. In 1159 individuals, a total of 1317 pathogenic thalassemia variants were identified and confirmed by independent PCR-based tests. Of the total thalassemia variants detected, the α-variant -- SEA (35.4%) and β-variant c.126&#95;129delCTTT (15%) were the most common. CATSA was also able to detect three types of rare HBA structural variants as well as five rare HBA2, three HBA1, and 10 HBB single-nucleotide variations/insertions and deletions. Compared with standard thalassemia variant PCR panel testing, CATSA identified all panel variants present, with no false-negative results. Carrier assignment was improved through identification of rare variants missed by the panel test. On the basis of allelic coverage, reliability, and accuracy, TGS with long-range PCR presents a comprehensive approach with the potential to provide a universal solution for thalassemia genetic carrier screening. It is proposed that CATSA has immediate clinical utility as an effective carrier screening approach for at-risk couples., (Copyright © 2021 Association for Molecular Pathology and American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.)

Hemoglobin H (Hb H) disease is the most significant health problem of the α-thalassemia syndromes. The Hb disease patients are categorized based on their genotype to deletional and nondeletional, with the latter genotype presents the more severe clinical symptoms. Since telomere length is an indicator of biological aging and health, we hypothesized that telomere length could reflect Hb H disease's severity. In this study, we recruited 48 deletional and 47 nondeletional Hb H disease patients, along with 109 normal controls, for telomere length assessment. The leukocyte telomere length was assessed by monochromatic multiplex real-time PCR and reported as the telomere to single-copy gene (T/S) ratio. When telomere length was adjusted for age, the analysis of covariance between the control and the two Hb H disease groups revealed no significant difference. However, the telomere shortening rate was more rapid in the nondeletional Hb H disease group than those of the control and deletional Hb H disease groups. Gender analysis found that male patients have a significantly lower T/S ratio than females in the nondeletional group but not in the control and deletional groups. In the two disease groups, the T/S ratio was not influenced by ferritin level or transfusion burden but was positively correlated with the absolute reticulocyte count., (Copyright © 2021 Elsevier Inc. All rights reserved.)

Fetal anemia is common in malaria-endemic areas and a risk factor for anemia as well as mortality during infancy. Placental malaria (PM) and red cell abnormalities have been proposed as possible etiologies, but the relationship between PM and fetal anemia has varied in earlier studies, and the role of red cell abnormalities has not been studied in malaria-endemic areas. In a Tanzanian birth cohort study designed to elucidate the pathogenesis of severe malaria in young infants, we performed a cross-sectional analysis of risk factors for fetal anemia. We determined PM status, newborn red cell abnormalities, and maternal and cord blood levels of iron regulatory proteins, erythropoietin (EPO), cytokines and cytokine receptors. We examined the relationship between these factors and fetal anemia. Fetal anemia was present in 46.2% of the neonates but was not related to PM. Maternal iron deficiency was common (81.6%), most frequent in multigravidae, and interacted with parity to modify risk of fetal anemia, but it was not directly related to risk. Among offspring of iron-deficient women, the odds of fetal anemia increased with fetal α + -thalassemia, as well as these patterns of cord blood cytokines: increased cord IL-6, decreased TNF-RI, and decreased sTfR. The EPO response to fetal anemia was low or absent and EPO levels were significantly decreased in newborns with the most severe anemia. This study from an area of high malaria transmission provides evidence that 1) fetal α + -thalassemia and cytokine balance, but not PM at delivery, are related to fetal anemia; 2) maternal iron deficiency increases the risk that other factors may cause fetal anemia; and 3) fetal anemia has a multifactorial etiology that may require a variety of interventions, although measures that reduce maternal iron deficiency may be generally beneficial., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Kabyemela, Fried, Kurtis, Moses, Gorres, Muehlenbachs and Duffy.)

Alpha thalassemia and beta-globin haplotype are considered classical genetic disease modifiers in sickle cell anemia (SCA) causing clinical heterogeneity. Nevertheless, their functional impact on SCA disease emergence and progression remains elusive. To better understand the role of alpha thalassemia and beta-globin haplotype in SCA, we performed a retrospective study evaluating the clinical manifestations of 614 patients. The univariate analysis showed that the presence of alpha-thalassemia -3.7-kb mutation (αα/-α and -α/-α) decreased the risk of stroke development (p = 0.046), priapism (p = 0.033), and cholelithiasis (p = 0.021). Furthermore, the cumulative incidence of stroke (p = 0.023) and cholelithiasis (p = 0.006) was also significantly lower for patients carrying the alpha thalassemia -3.7-kb mutation. No clinical effects were associated with the beta-globin haplotype analysis, which could be explained by the relatively homogeneous haplotype composition in our cohort. Our results reinforce that alpha thalassemia can provide protective functions against hemolysis-related symptoms in SCA. Although, several genetic modifiers can impact the inflammatory state of SCA patients, the alpha thalassemia mutation remains one of the most recurrent genetic aberration and should therefore always be considered first.

Hyperbilirubinemia in patients with sickle cell anemia (SCA) as a result of enhanced erythrocyte destruction, lead to cholelithiasis development in a subset of patients. Evidence suggests that hyperbilirubinemia may be related to genetic variations, such as the UGT1A1 gene promoter polymorphism, which causes Gilbert syndrome (GS). Here, we aimed to determine the frequencies of UGT1A1 promoter alleles, alpha thalassemia, and β S haplotypes and analyze their association with cholelithiasis and bilirubin levels. The UGT1A1 alleles, -3.7 kb alpha thalassemia deletion and β S haplotypes were determined using DNA sequencing and PCR-based assays in 913 patients with SCA. The mean of total and unconjugated bilirubin and the frequency of cholelithiasis in GS patients were higher when compared to those without this condition, regardless of age (P < 0.05). Cumulative analysis demonstrated an early age-at-onset for cholelithiasis in GS genotypes (P < 0.05). Low fetal hemoglobin (HbF) levels and normal alpha thalassemia genotype were related to cholelithiasis development (P > 0.05). However, not cholelithiasis but total and unconjugated bilirubin levels were associated with β S haplotype. These findings confirm in a large cohort that the UGT1A1 polymorphism influences cholelithiasis and hyperbilirubinemia in SCA. HbF and alpha thalassemia also appear as modulators for cholelithiasis risk.

The aim of this study was to retrospectively compare hematological parameters among normal, α-, and β-thalassemia fetuses between 17 and 38 weeks of gestation. Pregnant women at risk of having fetuses with thalassemia major and underwent cordocentesis for prenatal diagnosis were recruited. Fetal cord blood samples were collected from 249 fetuses for hematological and DNA analysis. Fetuses were divided into subgroups according to thalassemia DNA genotypes. The average and gestational age of subjects were 27.95 ± 5.78 years and 27.78 ± 3.57 weeks, respectively. The distribution of α-thalassemia, β-thalassemia, and normal cases was 67.87%, 19.68%, and 12.45%, respectively. Significant differences in almost all the hematological parameters (HbF, HbA, Hb, HCT, MCV, MCH, MCHC, RDW, and NBRCs) were observed in three groups (P < 0.001, except for RBC, P = 0.446). These differences were also observed in four α-thalassemia subgroups (P < 0.001) and were associated with the number of defected genes. Similarly, in five β-thalassemia genotypes, HbF, HbA, RBC, MCV, MCH and NBRCs were presented differently (P < 0.05). Additionally, the trends in RBC, Hb, and HCT changes in three α-thalassemia subgroups (silent carrier, trait, and major) and β + /β + fetuses' MCV, MCH, and RDW levels with gestation age were opposite to those of normal fetuses. We compared the distribution of hematological parameters in fetuses affected by most genotypes of thalassemia, as well as their trends in relation to gestational age for the first time, which is a good reference for future studies and prenatal diagnostic practices. The investigated hematological parameters are also valuable in diagnosing and differentiating thalassemia.

Background: Thalassemia is a common inherited hematological disease in tropical and subtropical regions. This study aimed to investigate the mutation spectrum of thalassemia in the Dongguan region of southern China and comprehensively analyze hematologic features of thalassemia carriers with various types of globin mutations., Methods: A hematological screening including hematological indices such as mean corpuscular volume (MCV), mean corpuscular hemoglobin content (MCH), and mean corpuscular hemoglobin concentration (MCHC) was conducted in 19 442 people from Dongguan region, Guangdong province of China. Then, 4891 suspected thalassemia carriers were further investigated by genetic analysis of combined NGS and gap-PCR., Results: Totally, 2319 (11.9%) cases were diagnosed as carriers of thalassemia, of which 1483 cases (7.6%) were α-thalassemia, 741 cases (3.8%) were β-thalassemia, and 95 cases (0.5%) were co-inheritance of α- and β-thalassemia. In α-thalassemia carriers, the phenotypic severity increases with the number of nonfunctional α-globin genes. The patients with - SEA /α WS α genotype have less severe clinical phenotypes than those with other Hb H diseases. As for β-thalassemia, the MCV and MCH in both β 0 and β + carriers are markedly reduced., Conclusions: This is the first comprehensive molecular epidemiological survey and hematological profiling of thalassemia in Dongguan area. This study will be benefit for genetic counseling in the clinic and may help pediatricians to make a correct diagnosis of different types of thalassemia., (© 2020 The Authors. Journal of Clinical Laboratory Analysis Published by Wiley Periodicals LLC.)

Objective: To determine the prevalence of low mean corpuscular volume (MCV) in newborn infants admitted to the neonatal intensive care unit and to assess low MCV as a diagnostic test for alpha thalassemia., Study Design: Retrospective analysis of all infants admitted to the neonatal intensive care unit between January 2010 and October 2018 for which a complete blood count was performed during the first 3 postnatal days. Infants with a low MCV were compared with those with a normal MCV. Infants with positive hemoglobin Bart (Hb Bart) were compared with those withnegative Hb Bart. Low MCV was also evaluated as a diagnostic test for alpha thalassemia., Results: A total of 3851 infants (1386 preterm, 2465 term) met the inclusion criteria and 853 (22.2%) had a low MCV. A low MCV was more common in term (25%) compared with preterm infants (17.1%, P < .001). Hb Bart positive newborn screening was identified in 133 infants (3.5%). Hb Bart was positive in 11.1% of infants with low MCV compared with 1.3% with normal MCV (P < .001). The sensitivity, specificity, positive predictive value, and negative predictive value of low MCV for the diagnosis of alpha thalassemia were 71.4%, 79.6%, 11.3%, and 98.7%, respectively., Conclusions: As Hb Bart positive newborn screens were seen in only 11.1% of infants with microcytosis, further diagnostic investigation may be warranted in individual infants. Further research to correlate microcytosis with iron status in infants and mothers is needed as well as studies using DNA analysis for the evaluation of alpha thalassemia variants., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Objectives: A sensitive screening for the coexistence of α 0 -thalassemia and the hemoglobin E (Hb E) trait is important to identify at-risk couples for hydrops fetalis. However, previous cutoff values have shown a positive predictive value (PPV) of only 50% or less. This study aimed to define more specific indicators to reduce the need for DNA tests. Methods: Patients with Hb E trait, as diagnosed by high performance liquid chromatography (HPLC) and/or isoelectric focusing (IEF) techniques, were tested for α 0 -thalassemia and α + -thalassemia deletions using multiplex gap polymerase chain reaction. Iron deficiency anemia (IDA) were excluded using a red cell distribution width (RDW) of more than 14.5%. Results: From 390 specimens, suitable cutoff values showing a 100% sensitivity for detection of heterozygous α 0 -thalassemia were an Hb E level of less than 22% by HPLC, a mean corpuscular volume (MCV) of less than 72 fL, and a mean corpuscular hemoglobin (MCH) level of less than 22.5 pg. Comparable results were obtained in the validation cohort ( N  = 179). Using a combination of Hb E with either MCV or MCH cutoff points gave a PPV of 76.2% and 77.4%, respectively. Discussion: IDA was reported to interfere with Hb E level. In this study, we excluded IDA using RDW of more than 14.5% to enhance the test specificity. Conclusion: Lower cutoff screening values can be used to exclude α 0 -thalassemia in the Hb E trait yielding a higher specificity in a normal RDW condition. This can save the cost and labor of DNA testing.

Hb Manitoba [α102(G9)Ser→Arg] is a rare α chain variant with diverse ethnic origins. It is mildly unstable with an expression of around 10.0-14.2% in the heterozygous state in most literature. In this study, 12 cases of Hb Manitoba [11 cases carried Hb Manitoba II ( HBA1 : c.309C>A) and one case carried Hb Manitoba IV ( HBA1 : c.307A>C)] were detected during a wide-spectrum study of α chain variants in the UK. Fluctuation in variant expression from 6.9 to 15.2% of total Hb on high performance liquid chromatography (HPLC) would pose a diagnostic dilemma in routine laboratories. Focusing on the variant expression, the median of Hb Manitoba was around 11.5% of total Hb in three cases, apparently with normal hemoglobin (Hb), and normal red blood cell (RBC) indices. Two cases showed a higher expression (13.9 and 15.2%) and five cases showed a lower expression (6.9-9.9%). The common α-thalassemia (α-thal) -α 3.7 (rightward) deletion coexisted with one case of increased Hb Manitoba expression. Iron (or other nutrient) deficiency was likely the cause of decreased Hb Manitoba percentage in this study. The α73(EF2)Val→Val (α2) ( HBA2 : c.222G>T) polymorphism is published for the first time and coexisted with two cases. The Cap +14 (C>G) ( HBA2 : c.-24C>G) polymorphism coexisted with another case in a heterozygous state. In conclusion, the fluctuation in variant expression can cause a diagnostic dilemma, especially in routine laboratories. Screening for the common -α 3.7 deletion and iron deficiency is recommended when an α chain variant is suspected.

Objectives: We analyzed hemoglobin (Hb) levels and degree of anemia in relation to genotype in patients with hemoglobin H (Hb H) disease, thereby providing a scientific basis for the prevention and treatment of Hb H disease in the Guangxi region of China., Methods: Hb analysis was conducted in 615 patients using high performance liquid chromatography. Seven α-thalassemia and 17 β-thalassemia genotypes commonly found in the Chinese population were detected by Gap-polymerase chain reaction and reverse dot hybridization. Multiple ligation-dependent probe amplification and sequencing were used to detect α-globin gene., Results: On analyzing the degree of anemia, we found that the proportion of severe and moderate anemia was the highest among cases with - SEA /α CS α genotype, followed by - SEA /α QS α. When Hb H disease was present in combination with β-thalassemia, the clinical symptoms of most patients were milder than those with simple Hb H disease., Conclusion: The clinical manifestations of various types of Hb H disease are heterogeneous; the Hb levels of patients with deletional Hb H are generally higher than those with non-deletional Hb H ( P < 0.05). In-depth knowledge of the gene mutation spectrum of thalassemia in Guangxi can provide a basis for genetic counseling of couples and enable prenatal diagnosis.

The aim of this study was to investigate a family with nonhomologous sequence recombination of HBA1 and HBA2 genes and provide a favorable basis for genetic counseling and eugenics. Peripheral blood of family members was collected. Hematological parameters were determined by an automated cell counter and hemoglobin (Hb) analysis was performed using high performance liquid chromatography (HPLC). Villus samples were taken for prenatal diagnosis (PND). Gap-polymerase chain reaction (gap-PCR) and reverse dot-blot were used for thalassemia genotyping. DNA sequencing was used to analyze the gene sequence of HBA1 (α1-globin) and HBA2 (α2-globin). The nonhomologous sequence recombination allelic variant of HBA1 and HBA2 genes were identified, namely, a gene conversion on the HBA2 gene called α12 ( HBA12 ). The α12 allele consists primarily of the HBA2 gene sequence except for a segment of the IVS-II in which HBA2 -specific sequences have been replaced by HBA1 -specific sequences. The following genotypes were observed: - - SEA /αα12 (Southeast Asian deletion), αα/αα12 and α QS α/αα12 (Hb Quong Sze or Hb QS; HBA2 : c.377T>C), and all manifested as small cell hypochromic anemia. To find the α12 allele in the Chinese population and clarify the influence of the α12 allele and its common inheritance with abnormal Hb and α-thalassemia (α-thal) on α-globin gene expression can help guide clinical diagnosis and genetic counseling.

Background: Cardiorenal syndrome (CRS), a serious condition with high morbidity and mortality, is characterized by the coexistence of cardiac abnormality and renal dysfunction. There is limited information about CRS in association thalassemia. This study aimed to investigate the prevalence of CRS in thalassemia patients and also associated risk factors., Methods: Thalassemia patients who attended the out-patient clinic of a tertiary care university hospital from October 2016 to September 2017 were enrolled onto this cross-sectional study. Clinical and laboratory findings from 2 consecutive visits, 3 months apart, were assessed. The criteria for diagnosis of CRS was based on a system proposed by Ronco and McCullough. Cardiac abnormalities are assessed by clinical presentation, establishment of acute or chronic heart failure using definitions from 2016 ESC guidelines or from structural abnormalities shown in an echocardiogram. Renal dysfunction was defined as chronic kidney disease according to the 2012 KDIGO guidelines., Results: Out of 90 thalassemia patients, 25 (27.8%) had CRS. The multivariable analysis showed a significant association between CRS and extramedullary hematopoiesis (EMH) (odds ratio (OR) 20.55, p = 0.016); thalassemia type [β 0 /β E vs β 0 /β 0 thalassemia (OR 0.005, p = 0.002)]; pulmonary hypertension (OR 178.1, p = 0.001); elevated serum NT-proBNP (OR 1.028, p = 0.022), and elevated 24-h urine magnesium (OR 1.913, p = 0.016). There was no association found between CRS and frequency of blood transfusion, serum ferritin, liver iron concentration, cardiac T2*, type of iron chelating agents, or urine neutrophil gelatinase-associated lipocalin level., Conclusions: CRS is relatively common in thalassemia patients. Its occurrence is associated with laboratory parameters which are easily measured in clinical practice.

Multiple molecular tests are currently needed for accurate carrier testing for thalassemia. Therefore, long-molecule sequencing (LMS) was evaluated as an alternate on the PacBio Sequel platform for genotyping carriers of α-thalassemia or β-thalassemia. Multiplex long PCR was used to generate representative amplicons for the α (HBA1/2) and β (HBB) gene loci. Following LMS, circular consensus sequencing reads were aligned to the hg19 reference genome and variants called using FreeBayes software version 1.2.0. In a blinded study of 64 known carrier samples, all HBA1/2 and HBB variants detected by LMS were concordant with those independently assigned by targeted PCR assays. For HBA1/2 carrier samples, LMS accurately detected the common South East Asian, -α3.7, and -α4.2 deletions and four different rare single-nucleotide variants (SNVs). For HBB carrier samples, LMS accurately detected the most common Chinese insertion and deletion variant c.126&#95;129delCTTT and 14 different SNVs/insertions and deletions and could discriminate compound heterozygous SNVs (trans configuration) and identify variants linked to benign SNPs (cis configuration). Overall, LMS displayed the hallmarks of a scalable, accurate, and cost-effective genotyping method. With further test coverage to additionally include detection of other clinically significant HBA1/2 copy number variations, such as the Thai, Mediterranean, and Filipino deletions, LMS may eventually serve as a comprehensive method for large-scale thalassemia carrier screening., (Copyright © 2020 Association for Molecular Pathology and American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.)

α-Thalassemia is a globally prevalent genetic disorder of hemoglobin (Hb) structure where the rate of α-globin chain synthesis is reduced or absent based on the underlying α-globin mutation(s). This study aimed to define the spectrum of α-globin gene mutations and assess their relative frequency within a group of α-thalassemia carriers. A total of 96 young subjects with unexplained hypochromia and microcytosis were recruited. They were referred from the premarital hemoglobinopathy screening and genetic counseling center in Erbil. All subjects were genetically tested for 21 common α-globin gene mutations using multiplex PCR and reverse hybridization. Six different α-globin gene mutations and nine different genotypes were detected in 84 carrier subjects. Their mean Hb was 12.9 (± 1.29) g/dL, of whom 49 subjects (58.3%) had a normal Hb level. The two most frequently encountered mutations were -α 3.7 deletion (62.86%) and α2 -5nt mutation (20%). Deletions were encountered in 71.43% of the mutated alleles. The most commonly observed genotype was -α 3.7 /αα (46.43%), followed by -α 3.7 /-α 3.7 and α -5nt α/αα genotypes (10.72% each). Carriers of α poly-A1 α/αα and -α 3.7 /-α -5nt α genotypes showed significantly lower Hb, mean cell volume, and mean cell Hb values comparing to carriers of most other genotypes. In our population, the spectrum of α-globin mutations was confined to a limited number of mutations with deletions being mostly observed.

We report the identification of a large deletion of the α-globin gene cluster, which removed both HBA2 and HBA1 and included the region from HBZ to HBQ1 on chromosome 16 (16p13.3). The α 0 -thalassemia (α 0 -thal) deletion was discovered in an Indian family residing in New Zealand. The proband was a 3-month-old female, who presented with a Hb H disease of unknown molecular origin. Routine hematology showed marked hypochromic microcytic anemia, with numerous Hb H inclusion bodies. In the absence of iron deficiency, there was a strong clinical suspicion of α-thal. On initial screening using a multiplex gap polymerase chain reaction (gap-PCR), only the common rightward deletion (-α 3.7 ) was detected. Investigation of the proband's mother and father revealed the mother was heterozygous for the -α 3.7 deletion, while none of the seven most common pathogenic α-thal deletions were detected in the father. Multiplex ligation-dependent probe amplification (MLPA) was employed to detect the presence of a novel α 0 -thal deletion in both the proband and her father. For the proband, the α 0 -thal deletion in combination with the -α 3.7 deletion, eliminated three copies of HBA consistent with a clinical diagnosis of Hb H disease.

Thalassemia is the most common monogenic disorder around the world. Based on the principle of genotype-phenotype correlation, identification of thalassemia mutations is the essential prerequisite for clinical diagnosis and management. Because only common mutations are routinely detected, the identification of rare or undetermined mutations is a challenge for clinical laboratories. Herein, a proband presenting with inconsistent phenotype-genotype correlation after routine molecular screening was investigated by multiplex ligation-dependent probe amplification (MLPA), targeted-next generation sequencing (targeted-NGS), gap-polymerase chain reaction (gap-PCR) and Sanger sequencing. Eventually, a novel 71.8 kb deletion (- - 71.8 ) was identified and characterized, which included HBZ (ζ), HBA2 (α2), and HBA1 (α1) genes and was causing α 0 -thalassemia (α 0 -thal). Furthermore, we summarized a practical procedure based on accumulated experience in studies and clinical practice, which can be a guide for molecular screening and clinical diagnosis of thalassemia, especially for identification of undetermined or novel mutations.

Hb Manitoba [α102(G9)Ser→Arg] results from an A GC> C GC or AG C >AG A substitution at codon 102 of the HBA1 or HBA2 genes. The variant is mildly unstable but carriers typically have normal clinical presentation and hematological profile. Hb Manitoba has not been reported in Pasifika of Tongan, Samoan or New Zealand (NZ) Māori descent before. The cases presented here support the findings from existing literature but include results from alternative methodology including capillary zone electrophoresis (CZE), which may slightly underestimate the true variant percentage. The subject of our case report, a Tongan male with microcytic indices, was shown to be heterozygous for Hb Manitoba III ( HBA2 : c.309C>A) coinherited with the -α 3.7 (rightward) deletion.

A rapid DNA-based assay is essential for clinical diagnosis and mass screening in thalassemia-prevention programs. Because of high homology and guanine-cytosine-rich and complex second structure of α-globin genes, it is rather difficult to develop a feasible and simple method for α-thalassemia genotyping. In this study, a strategy of nested asymmetric PCR melting curve analysis was designed to tackle these factors and ensure sensitivity and accuracy. Herein, a novel one-step assay for genotyping of nondeletional α-thalassemia mutations, including hemoglobin (Hb) Westmead (HBA2: c.369C>G), Hb Quong Sze (HBA2: c.377T>C), Hb Constant Spring (HBA2: c.427T>C), CD30 (HBA2: c.91-93delGAG), and CD31 (HBA2: c.95G>A) in a single closed tube, was established and evaluated. All five mutations were accurately determined with the concordance rate of 100% in a blind analysis of 255 genotype-known samples and 1250 clinical samples. In conclusion, this assay is useful for rapid and reliable genotyping of nondeletional α-thalassemia mutations in clinical practice. Especially, the strategy may have the potential to be a versatile scheme for rapid genotyping of other gene mutations because of its high throughput, sufficient stability, low cost, and simple operation., (Copyright © 2020 Association for Molecular Pathology and American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.)

Introduction: Determination of hemoglobins (Hbs) F, A 2, and E is crucial for diagnosis of thalassemia. This study determined the levels of Hbs F, A 2, and E in children aged 6-23 months and investigated the effect of age, sex, and types of thalassemia on the expression of these Hbs., Methods: A total of 698 blood samples of Laotian children including 272 non-Hb E, 271 Hb E heterozygotes, and 155 Hb E homozygotes were collected. Hb profiles were determined using the capillary zone electrophoresis. Coinheritance of α-thalassemia and the homozygosity for Hb E mutation were checked by PCR-based assay., Results: Children heterozygous and homozygous for Hb E had significantly higher Hb F and A 2 levels than non-Hb E children (median Hb F = 1.1% for non-Hb E group, 2.7% for Hb E heterozygotes, and 9.4% for Hb E homozygotes; median Hb A 2  = 2.6% for non-Hb E group, 3.8% for Hb E heterozygotes, and 5.2% for Hb E homozygotes). The median Hb E levels were 21.9% for Hb E heterozygotes and 85.3% for Hb E homozygotes. Comparing within group, there was a statistically significant difference between children with and without an α-gene defect for Hb A 2 and E, but not Hb F. Based on a multiple regression analysis, age and sex were significantly associated with the expression of Hb F and A 2 but not Hb E., Conclusions: Our findings can guide the development of a diagnostic approach to thalassemia in children aged 6-23 months., (© 2020 The Authors. International Journal of Laboratory Hematology published by John Wiley & Sons Ltd.)

Aim: To identify the optimal cutoff of mean corpuscular volume (MCV) for screening of alpha-thalassemia 1 trait., Methods: The database of pregnant women who attended antenatal care clinic at Department of Obstetrics and Gynecology, Chiang Mai University during January 1st, 2015 to December 31st, 2017 was accessed and reviewed. A total of 1264 cases who had MCV ≤80 fL and met the inclusion criteria were enrolled to the study. Cases with hemoglobin level ≤10.0 gm/dL, iron deficiency anemia, chronic medical diseases and other types of thalassemia trait except alpha-thalassemia 1 trait were excluded., Results: After exclusion, 438 cases were available for analysis. Of them, 139 were alpha-thalassemia 1 trait. Based on the receiver operating characteristic curves, the best cutoff value of MCV for screening of alpha-thalassemia 1 trait was ≤76.15 fL, giving 100% sensitivity, and 60.9% specificity with the area under curve of 0.925. Compared to the conventional cutoff (≤80 fL), the new cutoff gave much less false positive tests (117 vs 299 cases), whereas capability to detect alpha-thalassemia 1 trait was the same., Conclusion: With the new MCV cutoff (≤76.15 fL) as a secondary cutoff for screening alpha-thalassemia 1 carrier, a substantial number of positive cases requiring DNA analysis could be avoided without compromising the detection efficacy., (© 2020 Japan Society of Obstetrics and Gynecology.)

α-Thalassemia (α-thal) is assumed to be very prevalent in Bangladesh. We aimed to assess the prevalence of the disease in the country and provide a model for α-thal newborn screening in Bangladesh. We collected umbilical cord blood (UCB) samples from 413 unrelated newborns in Bangladesh. Demographic information, blood indices, osmotic fragility, serum iron (Fe), and zinc (Zn) levels were evaluated for all the subjects. All subjects underwent a polymerase chain reaction (PCR)-based diagnosis for α-thal status, followed by a multiplex gap-PCR-based identification of the deletion type present. Sixty-seven subjects had at least one α-thal deletion (16.22%). We observed that -α 3.7 (rightward), - - SEA (Southeast Asian), -α 4.2 (leftward), - - MED (Mediterranean) and - - THAI (Thailand) deletions were the most common α-globin deletions present in the country, with the -α 3.7 ( n  = 37) and - - SEA ( n  = 18) being most prevalent. The osmotic fragility test (OFT) could predict the presence of α-thal deletions with over 98.0% sensitivity. Complete UCB count analysis revealed significant differences between healthy subjects and subjects with α-thal deletions. Although the iron level was almost the same (108.0 vs. 105.7 µg/dL), a reduced level of Zn (98.6 vs. 71.8 µg/dL, p  < 0.01) was observed in the cord blood-derived serum of the subjects with α-thal deletions. Moreover, parental age at the time of delivery, gestational period, and birth weight was lower in the subjects with α-thal deletions. This study provides partial information on the epidemiology of α-thal in Bangladesh and describes a model for α-thal newborn screening in the country.

Microcytic anemia in children is commonly attributed to iron deficiency without attempting to find the cause. Inadequate investigations to exclude hemoglobinopathies lead to missed opportunities for identification of thalassemia carriers. Here we aim to describe the relative contribution of iron deficiency and thalassemia to microcytic anemia in children. This hospital-based prospective study was conducted at the Colombo North Teaching Hospital, Ragama, Sri Lanka. All newly diagnosed patients with microcytic anemia were recruited and data were collected using an interviewer-administered questionnaire. Full blood count, blood film, serum ferritin, c-reactive protein, quantification of hemoglobin sub-types and α-globin genotype were performed using 4 ml of venous blood. A total of 104 children (Male- 60.5%) were recruited. Iron deficiency was the cause for anemia in 49% whilst 16% and 10% had α- and β-thalassemia trait respectively. Seven (6.7%) children had co-existing iron deficiency and thalassemia trait while two coinherited α- and β-thalassemia trait. Children with β-thalassemia trait had significantly higher red cell count and lower mean corpuscular volume compared to children with iron deficiency. However, none of the red cell parameters were significantly different between children with α-thalassemia trait and iron deficiency. Iron deficiency contributes only to half of children with microcytic anemia; one-fourth had thalassemia trait. Co-existence of iron deficiency and thalassemia trait or co-inheritance of α- and β-thalassemia trait were found in 9%. Parallel investigation of children with microcytic anemia to diagnose iron deficiency and thalassemia provides an opportunity to identify thalassemia carriers which is beneficial for thalassemia prevention.

Hb Westmead (α122(H5)His>Gln) ( HBA2 : c.369C>G) is a common α-globin variant causing α-thalassemia (α-thal) in Mainland China. In this study, we report the hematological characteristics in Hb Westmead carriers in a Chinese population. There were 546 individuals carrying Hb Westmead based on their molecular diagnosis: 514 Hb Westmead heterozygotes and 32 compound heterozygotes for Hb Westmead and α 0 -thal. Compared to common deletional α + -thal, Hb Westmead was associated with higher mean corpuscular hemoglobin (Hb) (MCH) values. Compound heterozygotes for Hb Westmead and α 0 -thal showed significantly higher Hb, mean corpuscular volume (MCV) and MCH values than subjects with deletional Hb H disease. When compared to α 0 -thal carriers, compound heterozygotes for Hb Westmead and α 0 -thal showed similar Hb values, but significantly lower MCV and MCH values. Our results indicate that Hb Westmead is a silent nondeletional α + -thal, with a deficiency of α-globin chain milder than deletional α + -thal, and compound heterozygotes for Hb Westmead/α 0 -thal have a phenotype similar to simple α 0 -thal.

In order to identify the α-thalassemia (α-thal) mutation spectrum in Kurdistan Province, West Iran, a total of 217 individuals, including 154 α-thal carriers and 63 normal subjects were investigated in this study. Molecular analysis of α1- and α2-globin genes using multiplex gap-polymerase chain reaction (gap-PCR), amplification refractory mutation system (ARMS)-PCR or direct DNA sequencing, showed 11 different α-globin variants. The -α 3.7 (rightward) deletion (NG&#95;000006.1: g.34164&#95;37967del3804) (70.32%), polyadenylation signal (polyA2) site (AAT A AA>AAT G AA) (α polyA2 α) ( HBA2 : c.*92A>G) (7.74%), -α 4.2 (leftward) deletion (6.45%) and codon 59 (or Hb Adana) (G>A) (αα codon 59 ) ( HBA1 : c.179G>A) (4.52%) were the most frequent mutations in the present study. In conclusion, the spectrum of α-thal mutations in Kurdistan Province is closest to that in western provinces of Iran (Kurdish and Laki populations). In addition, it was revealed that the codon 59 mutation is common in the Kurdish population. On the other hand, despite the same ethnic background of Kurds in Iran and Iraq, the - - MED I double gene deletion and polyA2 point mutation have different distributions in these two populations. Therefore, further studies are needed to identify the cause of these differences.

In this study, Hb A 2 variants and their association with α- and β-thalassemia (α- and β-thal) were analyzed. We performed molecular analyses to identify α-thal [- - SEA (Southeast Asian), - - THAI (Thai), -α 3.7 (rightward) and -α 4.2 (leftward)] deletions, and Hb Constant Spring (Hb CS; HBA2 : c.427T>C), Hb A 2 -Melbourne ( HBD : c.130G>A), Hb A 2 ' ( HBD : c.49G>C), Hb A 2 -Lampang ( HBD : c.142G>A). β 0 -Thalassemia mutations included codon 17 (A>T) ( HBB : c.52A>T), codons 41/42 (-TCTT) ( HBB : c.126&#95;129delCTTT), codons 71/72 (+A) ( HBB : c.216&#95;217insA) and IVS-I-1 (G>T) ( HBB : c.92+1G>T) in 23 samples which had a Hb A 2 variant peak in zone 1 of the capillary electrophoresis (CE) electropherogram. Results showed that 20 patients (87.0%) carried Hb A 2 -Melbourne with seven different genotypes for α- and β-thal, two (8.7%) carried Hb A 2 ' and one (4.3%) carried Hb A 2 -Lampang. All three samples doubly heterozygous for Hb A 2 -Melbourne/β 0 -thal had Hb A 2 levels lower than 4.0%, while summation of Hb A 2 and Hb A 2 -Melbourne ranged from 4.9-5.3%, reaching the accepted range (4.0-10.0%) for β-thal trait. Hb A 2 -Melbourne is the most common δ-globin variant in the Thai population. Hb A 2 variant and Hb A 2 levels must be combined in order to diagnose carriers of β-thal. β-Globin haplotype analysis showed an association with a single β-globin haplotype [+ - - - - + +] of Hb A 2 -Melbourne, Hb A 2 ' and Hb A 2 -Lampang, indicating that they were of the same origin. We developed a multiplex allele-specific polymerase chain reaction (ASPCR) for simultaneous detection of these three Hb A 2 variants.

Over many years, cases of suspected α-globin chain variants were collected from different parts of the UK. The suspicion was based on the clinical picture, high performance liquid chromatography (HPLC) variant percentage, retention time (RT) and isoelectric focusing (IEF). DNA sequencing and the restriction enzyme E ae I were used for definitive diagnosis. One hundred and forty-eight variants were confirmed on one or both of the two α-globin genes ( HBA2 , HBA1 ). These cases were identified as 46 different α-globin chain variants. The most common variants were Hb J-Meerut [ HBA2 : c.362C>A (or HBA1 )] (10.1%) and Hb Q-India ( HBA1 : c.193G>C) (8.1%), followed by Hb J-Paris-I [ HBA2 : c.38C>A (or HBA1 )] and Hb Manitoba II ( HBA1 : c.309C>A) (7.4% for each). Other α variants were detected at lower frequencies. Two novel alleles were also detected: Hb Walsgrave [α116(GH4)Glu→Val ( HBA2 : c.350A>T)] and Hb Coombe Park [α127(H10)Lys→Glu ( HBA2 : c.382A>G)]. The majority of the ethnic origin was Indian. The positive predictive value for α variant identification by HPLC-RT analysis was 65.9%, 41.9% by IEF, and using both RT and IEF, the value was 72.1%. The number of variants was higher in HBA1 than in HBA2 genes and in exons 1 and 2 than in exon 3. There was no clustering of mutations in consecutive codons. This study, the characterization of a wide spectrum of α-globin chain variants, can facilitate the presumptive diagnosis of these variants prior to screening by a panel of amplification refractory mutation system-polymerase chain reaction (ARMS-PCR), and a definitive diagnosis by DNA sequencing.

Hb Constant Spring (Hb CS) ( HBA2 : c.427T>C) is a common α-globin variant causing α-thalassemia (α-thal) phenotypes in mainland China. In this study, we evaluated the efficiency of erythrocyte parameters and capillary electrophoresis (CE) in the determination of Hb CS in blood samples from Hb CS carriers. Based on molecular diagnosis, there were 462 patients carrying Hb CS: 411 Hb CS heterozygotes, seven carried Hb H-Hb CS disease, 18 compound heterozygotes for Hb CS/α + -thal, and 26 double heterozygotes for Hb CS and β-thalassemia (β-thal). Forty-three cases had no Hb CS peak visible on CE, including all 26 cases of double heterozygotes for Hb CS and β-thal, and 17 cases of heterozygotes carrying only Hb CS. Hb CS heterozygotes, those without a Hb CS peak, presented with lower hemoglobin (Hb), mean corpuscular volume (MCV) and mean corpuscular Hb (MCH) values than those with a Hb CS peak. The MCV <80.0 fL yielded a detection rate of 87.8% for screening individuals carrying Hb CS. Therefore, we emphasize that if one partner of a couple has tested positive for α 0 -thal, the other should be subjected to detailed screening for this nondeletional allele using molecular analysis, regardless of his/her red cell indices and electrophoretic chromatogram.

α-thalassemia is an inherited blood disorder commonly caused by deletions or point mutations involving one or both α-globin genes. Recent studies shed new light on the critical role of upstream enhancers multi-species conserved sequences (MCSs) in the ordered regulation of α-globin gene expression. Herein, we reported two unrelated probands with deletions in α-globin genes and MCSs, respectively. The proband from Family A is a compound heterozygote carrying a known α + mutation (-α 3.7 ) and a novel 60.2 kb deletion causing the absence of both α-globin genes. The proband from Family B, on the other hand, is a compound heterozygote with a known α 0 mutation (-- SEA ) and a novel deletion involving only upstream regulatory elements MCS-R1, R2 and R3, while the α-globin genes remain intact. Notably, both these two patients suffered varied extent of anemia, indicating that the loss of enhancer elements could equally lead to reduced synthesis of α-globin. Upon these observations, we then confirmed the exact breakpoints of these two novel deletions using a targeted next-generation sequencing (NGS) previously established by our group, which may enable further elucidation of the rearrangement mechanisms on these deletions and functional dissection of MCSs. Taken together, our study reports a reliable NGS-based molecular screening approach for accurate identification of copy number variations (CNVs) in the α-globin cluster and the genetic diagnosis of these two probands may help to extend the spectrum of α-thalassemia mutations in Chinese population.

Hb H disease is a moderate to severe form of α-thalassemia (α-thal). Patients with Hb H disease may become symptomatic, especially during infections and pregnancy, and may require transfusions. Herein, we present a 16-year-old female with Hb H disease who was initially diagnosed during adolescent pregnancy and was found to carry the -α 3.7 /-(α) 20.5 deletions. The relatively mild presentation of this case highlights the milder phenotypic consequences of deletional α mutations. The case describes the screening and management of pregnancy with Hb H disease. Additionally, this case demonstrates that screening of some undiagnosed inherited blood disorders is important during pregnancy.