Search

Understanding the cellular and molecular mechanisms underlying the formation and maintenance of memories is a central goal of the neuroscience community. It is well regarded that an organism's ability to lastingly adapt its behavior in response to a transient environmental stimulus relies on the central nervous system's capability for structural and functional plasticity. This plasticity is dependent on a well-regulated program of neurotransmitter release, post-synaptic receptor activation, intracellular signaling cascades, gene transcription, and subsequent protein synthesis. In the last decade, epigenetic markers like DNA methylation and post-translational modifications of histone tails have emerged as important regulators of the memory process. Their ability to regulate gene transcription dynamically in response to neuronal activation supports the consolidation of long-term memory. Furthermore, the persistent and self-propagating nature of these mechanisms, particularly DNA methylation, suggests a molecular mechanism for memory maintenance. In this review, we will examine the evidence that supports a role of epigenetic mechanisms in learning and memory. In doing so, we hope to emphasize (1) the widespread involvement of these mechanisms across different behavioral paradigms and distinct brain regions, (2) the temporal and genetic specificity of these mechanisms in response to upstream signaling cascades, and (3) the functional outcome these mechanisms may have on structural and functional plasticity. Finally, we consider the future directions of neuroepigenetic research as it relates to neuronal storage of information.

Memory formation is a multi-stage process that initially requires cellular consolidation in the hippocampus, after which memories are downloaded to the cortex for maintenance, in a process termed systems consolidation (1). Epigenetic mechanisms regulate both types of consolidation (2-7), but histone variant exchange, in which canonical histones are replaced with their variant counterparts, is an entire branch of epigenetics that has received limited attention in the brain (8-12) and has never, to our knowledge, been studied in relation to cognitive function. Here we show that histone H2A.Z, a variant of histone H2A, is actively exchanged in response to fear conditioning in the hippocampus and the cortex, where it mediates gene expression and restrains the formation of recent and remote memory. Our data provide evidence for H2A.Z involvement in cognitive function and specifically implicate H2A.Z as a negative regulator of hippocampal consolidation and systems consolidation, probably through downstream effects on gene expression. Moreover, alterations in H2A.Z binding at later stages of systems consolidation suggest that this histone has the capacity to mediate stable molecular modifications required for memory retention. Overall, our data introduce histone variant exchange as a novel mechanism contributing to the molecular basis of cognitive function and implicate H2A.Z as a potential therapeutic target for memory disorders. AGCACCTGCGATCCTTTCC GCTTACCTTTCACCACCCTGT CGCGTGTGTGCTGGTTATTT, As a first step in exploring the role of H2A.Z in cognitive function, we used immunohistochemistry to confirm its expression throughout the hippocampus (Extended Data Fig. 1a-c). Next, we showed [...]

One of the most exciting discoveries in the learning and memory field in the past two decades is the observation that active regulation of gene expression is necessary for experience to trigger lasting functional and behavioral change, in a wide variety of species, including humans. Thus, as opposed to the traditional view of 'nature' (genes) being separate from 'nurture' (environment and experience), it is now clear that experience actively drives alterations in central nervous system (CNS) gene expression in an ongoing fashion, and that the resulting transcriptional changes are necessary for experience to trigger altered long-term behavior. In parallel over the past decade, epigenetic mechanisms, including regulation of chromatin structure and DNA methylation, have been shown to be potent regulators of gene transcription in the CNS. In this review, we describe data supporting the hypothesis that epigenetic molecular mechanisms, especially DNA methylation and demethylation, drive long-term behavioral change through active regulation of gene transcription in the CNS. Specifically, we propose that epigenetic molecular mechanisms underlie the formation and stabilization of context- and cue-triggered fear conditioning based in the hippocampus and amygdala, a conclusion reached in a wide variety of studies using laboratory animals. Given the relevance of cued and contextual fear conditioning to post-traumatic stress, by extension we propose that these mechanisms may contribute to post-traumatic stress disorder (PTSD) in humans. Moreover, we speculate that epigenetically based pharmacotherapy may provide a new avenue of drug treatment for PTSD-related cognitive and behavioral function. [ABSTRACT FROM AUTHOR]