Search

ABSTRACT In recent years, with increasing global demand for oil and gas resources and continuous decline in conventional oil and gas production, the global development focus has shifted from conventional medium to high permeability reservoirs to low permeability and tight oil reservoirs. As a result, nanoparticles (NPs) have found a promising role in enhanced oil recovery as potential improved oil recovery agents in low permeability. Despite many experiments that have proved that nanoparticles can be adsorbed on the rock surface in a macroscopic perspective, the adsorption mechanism and the effects of molecular structure on the adsorption behavior of nanoparticles on rock surfaces remain scarce. Here, the fundamental phenomena involved in hydrophobic nanoparticles adsorption on rock surface and the effect of mineral composition on adsorption mechanism were elucidated by the analysis of molecular dynamics simulation. The simulation results show that water molecules could form two adsorption layers on both quartz and kaolinite surfaces. Hydration layer thickness of kaolinite is greater than that of the quartz surface. The solid/liquid interface hydration layer thickness of quartz–water system is approximately 0.71 nm, while the thickness of kaolinite–water system is approximately 0.75 nm. Furthermore, coulombic interactions are the main influencing factor for the stable adsorption of nanoparticles on the wall. Nanoparticles can only break through the first adsorption layer to absorb on the layer. Finally, wetting angle tests were conducted which indicated that SiO2 nanoparticles can be adsorbed on the surface and have a good wetting reversal effect. Our study highlights the adsorption mechanism of nanoparticles on a molecular level, which may help to promote the development of low permeability and tight oil reservoirs. [ABSTRACT FROM AUTHOR]

ABSTRACT Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP‐type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid‐maturity stage. Co‐analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL‐like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular‐assisted breeding efforts aimed at establishing high‐protein soybean varieties. [ABSTRACT FROM AUTHOR]

It was previously reported that the TAG derived from PC-based DAG is laden with PUFAs, and the TAG derived from I de novo i DAG using glycerol-3-phosphate (G3P) acylation (Kennedy pathway) is rich in MUFAs (Eskandari I et al i ., [1]). (2015) Heterologous expression of flax phosphatidylcholine:diacylglycerol cholinephosphotransferase (PDCT) increases polyunsaturated fatty acid content in yeast and Arabidopsis seeds. Phosphatidylcholine:diacylglycerol cholinephosphotransferase (PDCT) serves as a catalyst for the interconversion of phosphatidylcholine (PC) and diacylglycerol (DAG). Design of high-monounsaturated fatty acid soybean seed oil using GmPDCTs knockout via a CRISPR-Cas9 system. [Extracted from the article]

ABSTRACT With the continuous exploitation of global oil and gas resources, the focus of oilfield development has gradually shifted to low‐permeability and tight reservoirs. Nowadays the nanofluid has become one of the most important methods to enhance oil recovery in low‐permeability reservoir since the wettability and fluid flow characteristics can be changed as hydrophobic nanoparticles are adsorbed on the surface. In this study, we focus on the fluid slip characteristics feature of nanoparticles adsorbed with different adsorption degrees through molecular dynamics methods. Our results show that the adsorption of hydrophobic nanoparticles on the wall induces a velocity slip effect. The fluid flows in a Cassie state in the micro‐channel, with a significant increase in density, velocity, and slip length. In addition, the velocity in the mainstream area is significantly greater than that near the wall. The fluid flow rate within the pore channel is maximized and the most optimal adsorption degree is around 65.08%. Meanwhile, this study provides not only of great significance for the microscopic mechanism of pressure reduction and injection enhancement technology by nanoparticles adsorbed, but also an efficient method in enhance oil recovery in low‐permeability oil reservoirs. [ABSTRACT FROM AUTHOR]

There is growing interest in expanding the production of soybean oils (mainly triacylglycerol, or TAG) to meet rising feed demand and address global energy concerns. We report that a plastid‐localized glycerol‐3‐phosphate dehydrogenase (GPDH), encoded by GmGPDHp1 gene, catalyzes the formation of glycerol‐3‐phosphate (G3P), an obligate substrate required for TAG biosynthesis. Overexpression of GmGPDHp1 increases soybean seed oil content with high levels of unsaturated fatty acids (FAs), especially oleic acid (C18:1), without detectably affecting growth or seed protein content or seed weight. Based on the lipidomic analyses, we found that the increase in G3P content led to an elevated diacylglycerol (DAG) pool, in which the Kennedy pathway‐derived DAG was mostly increased, followed by PC‐derived DAG, thereby promoting the synthesis of TAG containing relatively high proportion of C18:1. The increased G3P levels induced several transcriptional alterations of genes involved in the glycerolipid pathways. In particular, genes encoding the enzymes responsible for de novo glycerolipid synthesis were largely upregulated in the transgenic lines, in‐line with the identified biochemical phenotype. These results reveal a key role for GmGPDHp1‐mediated G3P metabolism in enhancing TAG synthesis and demonstrate a strategy to modify the FA compositions of soybean oils for improved nutrition and biofuel. [ABSTRACT FROM AUTHOR]

Injecting CO 2 and foaming agents can effectively improve the recovery rate of high cycle steam huff and puff. In this paper, firstly, the influence of oil saturation and injection plug on recovery rate is analyzed using a sand filled pipe physical simulation device. Then, combined with reservoir parameters, the influence of reservoir thickness, interlayer thickness, and oil saturation on the economic limits of development is elucidated. Thirdly, reservoir engineering methods are used to analyze the appropriate timing for injecting foaming agents into the study area. Results show that (a) CO 2 dissolves in crude oil, increasing its internal elastic energy and forming a solution gas drive. (b) When the oil saturation is 40 %, the cyclic oil increase is 109 tons, and the oil to gas ratio is 1.09; when the oil saturation is 35 %, the cyclic oil increase rapidly decreases to 38 tons. (c) For the research area, foaming agents should be intervened as early as possible. Foaming agent concentration is 0.4%. • The influence of oil saturation and injection plug on recovery rate is analyzed. • The influence of reservoir parameters on development economic limits is elucidated. • eservoir engineering methods are used to analyze appropriate timing for injecting foaming agents. [ABSTRACT FROM AUTHOR]

With the global assistance of oil fields entering the stage of improving oil recovery, diversified composite flooding technology has become one of the key research targets. This article takes composite flooding to improve oil recovery as the research object, explores the differential mechanism of crude oil displacement efficiency under water flooding and composite flooding conditions, and elucidates the dynamic evolution characteristics of pore structure before and after composite flooding. Results show that: (a) The permeability and porosity of Daqing oilfield cores have a good correlation. The porosity of cores after water driving and ternary composite driving mainly ranged from 23.6 % to 27.4 % and 22.8 %–26.8 %. The water-driving permeability mainly ranged from 168 × 10−3 μm2 to 2162 × 10−3 μm2. Ternary composite driving permeability mainly ranges from 302 × 10−3 μm2 to 2307 × 10−3 μm2. (b) Compared with water driving, quartz and clay minerals are corroded by alkali during ternary composite driving. (c) Under the condition of similar permeability, the average pore size of the core after ternary composite driving is smaller than the average pore size after water driving. • The differential mechanism of oil displacement efficiency under water flooding and ASC flooding conditions is explored. • The dynamic evolution characteristics of pore structure before and after composite flooding is elucidated. • The increase of permeability after water injection leads to a slight increase of water distribution in pore space. [ABSTRACT FROM AUTHOR]

The distribution pattern of oil and water in different stages of low permeability reservoirs is one of the main research topics in oilfield development. This paper takes low-permeability and tight oil reservoirs as the research object, systematically carries out experimental research on water flooding efficiency, and carries out theoretical comparative analysis. The innovations of this paper mainly include three aspect: (a) the experimental study of water drive efficiency under the conditions of different water drive stages is carried out, and the dynamic evolution characteristics of remaining oil distribution is analyzed. (b) The comparative analysis of water drive efficiency under different combination conditions of "permeability and crude oil physical properties" is studied. (c) The dynamic evolution mechanism of the coupling of "bound water - semi-bound water - free water" is explored by using the frozen core method. Results show that: (a) At the original oil bearing stage of the core in F Oilfield, the free microscale residual oil is the majority, followed by the bound and semi-bound residual oil. (b) Water flooding mainly develops the free residual oil. The remaining oil in clusters decreased from 22.35% to 2.21%. The residual oil in the form of inter-particle adsorption decreased from 28.56% to 2.53%. (c) It is difficult to develop bound and semi-bound residual oil in water drive. As the cluster like remaining oil is developed, the facial mask like remaining oil on the pore surface increases from 1.13% to 4.04%. • The dynamic evolution characteristics of remaining oil distribution is analyzed. • The comparative analysis of water drive efficiency under different "permeability - oil properties" combination is studied. • The dynamic evolution mechanism of "bound water - semi-bound water - free water" is explored. [ABSTRACT FROM AUTHOR]