Search

Abstract Background SARS-CoV-2, a highly contagious coronavirus, is responsible for the global pandemic of COVID-19 in 2019. Currently, it remains uncertain whether SARS-CoV-2 possesses oncogenic or oncolytic potential in influencing tumor progression. Therefore, it is important to evaluate the clinical and functional role of SARS-CoV-2 on tumor progression. Methods Here, we integrated bioinformatic analysis of COVID-19 RNA-seq data from the GEO database and performed functional studies to explore the regulatory role of SARS-CoV-2 in solid tumor progression, including lung, colon, kidney and liver cancer. Results Our results demonstrate that infection with SARS-CoV-2 is associated with a decreased expression of genes associated with cancer proliferation and metastasis in lung tissues from patients diagnosed with COVID-19. Several cancer proliferation or metastasis related genes were frequently downregulated in SARS-CoV-2 infected intestinal organoids and human colon carcinoma cells. In vivo and in vitro studies revealed that SARS-CoV-2 nucleocapsid (N) protein inhibits colon and kidney tumor growth and metastasis through the N-terminal (NTD) and the C-terminal domain (CTD). The molecular mechanism indicates that the N protein of SARS-CoV-2 interacts with YBX1, resulting in the recruitment of PKM mRNA into stress granules mediated by G3BP1. This process ultimately destabilizes PKM expression and suppresses glycolysis. Conclusion Our study reveals a new function of SARS-CoV-2 nucleocapsid protein on tumor progression.

Emerging ferroelectric and antiferroelectric HfO2-based thin films are attractive candidates for energy conversion and storage applications. In this work, the polar phase transformation between tetragonal and orthorhombic phases associated with ferroelectric or antiferroelectric behaviors is utilized to manipulate the electrocaloric cooling and energy storage performances in Zr-doped, woken up HfO2 ultrathin films. A giant electrocaloric temperature change of up to 11.85 K in Hf0.5Zr0.5O2 with the morphotropic phase boundary (MPB) state and a high energy storage density of 39.34 J/cm3 in the tetragonal phase-dominant Hf0.25Zr0.75O2 system are obtained. More interestingly, contrary to overdoping and excessive electric fields, an appropriate Zr concentration of 0.5 and an applicable driving field of 1.91 MV/cm are desired for the electrocaloric effect, resulting in an ultralow operating voltage as low as 1.3 V in this 6.8 nm thick Hf0.5Zr0.5O2 film. These findings illustrate that the structural design strategy is a visible method for achieving optimal energy-related behaviors and highlight the great possibilities for building future energy-related devices.

Abstract Background Weaning causes redox dyshomeostasis in piglets, which leads to hepatic oxidative damage. Microbe-derived antioxidants (MA) have great potential for anti-oxidation. This study aimed to investigate changes in hepatic redox system, mitochondrial function and apoptosis after weaning, and effects of MA on growth performance and liver health in weaning piglets. Methods This study consisted of 2 experiments. In the both experiments, piglets were weaned at 21 days of age. In Exp. 1, at 21 (W0), 22 (W1), 25 (W4), 28 (W7), and 35 (W14) days of age, 6 piglets were slaughtered at each timepoint. In Exp. 2, piglets were divided into 2 groups: one received MA gavage (MA) and the other received saline gavage (CON). At 25 days of age, 6 piglets from each group were sacrificed. Results In Exp. 1, weaning caused growth inhibition and liver developmental retardation from W0 to W4. The mRNA sequencing between W0 and W4 revealed that pathways related to “regulation of apoptotic process” and “reactive oxygen species metabolic process” were enriched. Further study showed that weaning led to higher hepatic content of reactive oxygen species (ROS), H2O2 and O2 −. Weaning enhanced mitochondrial fission and suppressed their fusion, activated mitophagy, thus triggering cell apoptosis. In Exp. 2, MA improved growth performance of piglets with higher average daily gain (ADG) and average daily feed intake (ADFI). The hepatic ROS, as well as products of oxidative damage malonaldehyde (MDA) and 8-hydroxy-2′-deoxyguanosine (8-OHdG) in the MA group decreased significantly than that of the CON group. The MA elevated mitochondrial membrane potential, increased activity of mitochondrial respiratory chain complexes (MRC) I and IV, enhanced mitochondrial fusion and reduced mitophagy, thus decreasing cell apoptosis. Conclusions The present study showed that MA improved the growth performance of weaning piglets and reversed weaning-induced oxidative damage, mitochondrial dysfunction, and apoptosis. Our results suggested that MA had promising prospects for maintaining liver health in weaning piglets and provided a reference for studies of liver diseases in humans. Graphical Abstract

Abstract Cyanobacteria are important primary producers, contributing to 25% of the global carbon fixation through photosynthesis. They serve as model organisms to study the photosynthesis, and are important cell factories for synthetic biology. To enable efficient genetic dissection and metabolic engineering in cyanobacteria, effective and accurate genetic manipulation tools are required. However, genetic manipulation in cyanobacteria by the conventional homologous recombination-based method and the recently developed CRISPR-Cas gene editing system require complicated cloning steps, especially during multi-site editing and single base mutation. This restricts the extensive research on cyanobacteria and reduces its application potential. In this study, a highly efficient and convenient cytosine base editing system was developed which allows rapid and precise C → T point mutation and gene inactivation in the genomes of Synechocystis and Anabaena. This base editing system also enables efficient multiplex editing and can be easily cured after editing by sucrose counter-selection. This work will expand the knowledge base regarding the engineering of cyanobacteria. The findings of this study will encourage the biotechnological applications of cyanobacteria.

Abstract With the growing interest in utilizing Mg and austenitic stainless steel (ASS) in the automotive sector, joining them together in three-sheet configuration is inevitable. However, achieving this task presents considerable challenges due to the large differences in their physical, metallurgical and mechanical properties. To overcome these challenges, the feasibility of using weld-bonding to join Mg alloy/ASS/ASS was investigated. The nugget formation, interface characteristics, microstructure and mechanical properties of the joints were investigated. The results show that the connection between the Mg alloy and upper ASS was achieved through the combined effect of the cured adhesive and weld-brazing in the weld zone. On the other hand, a metallurgical bond was formed at the ASS/ASS interface. The Mg nugget microstructure exhibited fine columar grains composed predominantly of primary α-Mg grains along with a eutectic mixture of α-Mg and β-Mg17Al12. The nugget formed at the ASS/ASS interface consisted largely of columnar grains of austenite, with some equiaxed dendritic grains formed at the centerline of the joint. The weld-bonded joints exhibited an average peak load and energy absorption of about 8.5 kN and 17 J, respectively (the conventional RSW joints failed with minimal or no load application). The failure mode of the joints changed with increasing welding current from interfacial failure via the Mg nugget/upper ASS interface to partial interfacial failure (part of the Mg nugget was pulled out of the Mg sheet). Both failure modes were accompanied by cohesive failure in the adhesive zone.

Exertional heatstroke (EHS) is a life-threatening condition with potential for tissues and organs injury, including heart. Effective drug strategies to treat patients with EHS are warranted to unlock the therapeutic potential. Considering the cardioprotective effects of L-carnitine (LC), this study aimed to investigate the effects of LC on EHS-induced myocardial injury in rats and to explore the underlying mechanisms. Here, we found that LC exerted a greater protective effect on EHS-induced cardiac dysfunction and mortality, which also significantly attenuated certain negative effects, including increased myocardial apoptosis, pathological changes, and ultrastructural impairment, enhanced activity levels of such serum enzymes as AST, LDH, CK, and CK-MB, reduced BCL-2 expression, increased the expression of cleaved caspase-3 and the critical endoplasmic reticulum stress (ERS) indices like CHOP and GRP78 in EHS rats. Besides, pretreatment of EHS rats with PBA (4-Phenyl butyric acid), a chemical chaperone that attenuates ERS, restored BCL-2 expression, reduced the protein levels of cleaved caspase-3, CHOP, and GRP78. Furthermore, thapsigargin (TG), which induces ERS, enhanced the expression of BAX, cleaved caspase-3, CHOP, and GRP78, attenuated BCL-2 expression, and enhanced mitochondrial impairment in EHS + LC rats. Mechanismly, the protective effects of LC were mediated, at least partly, by inhibiting the activation of PERK pathway against ERS-associated myocardial damage. These results indicate that supplementation of LC might be a potential strategy to reduce myocardial injury by affecting ERS via inhibiting the PERK pathway against EHS.

Heatstroke is a condition caused by overheating of the body that leads to severe central nervous system dysfunction. Although there have been numerous studies on the pathological process of heatstroke, effective treatment methods are lacking. Astragaloside IV can protect the brain from inflammation and brain damage in various inflammation-related diseases, but it has not yet been used clinically for the treatment of heatstroke. Therefore, the aim of this study was to explore the neuroprotective effect of Astragaloside IV on heatstroke-induced central nervous system damage and its mechanism. Brain injury model under heatstroke was established using artificial climate simulation cabin. By scoring neurological deficits, performing histological and immunofluorescence staining of microglia, and detecting cytokine levels, we determined that Astragaloside IV alleviated brain injury and neuroinflammation. To further explore the potential molecular mechanism, RNA sequencing was performed to investigate the differences in the brain. The results revealed that the PI3K/AKT pathway is involved. In vitro experiments further confirmed that Astragaloside IV can abrogate the phenotypic changes in microglia induced by heatstroke. Moreover, Astragaloside IV promotes the polarization of M2 microglia by activating the PI3K/AKT pathway. In summary, these results indicate that Astragaloside IV alleviates neuroinflammation and brain injury induced by heatstroke through the PI3K/AKT pathway. Astragaloside IV is a commonly used therapeutic agent in the clinic, but its use in the treatment of heatstroke-induced brain injury has not been explored. This study reveals that Astragaloside IV may be a new therapeutic agent for the treatment of heatstroke-induced brain injury.

Abstract Background Effective teaching methods are needed to improve students’ abilities in hand-eye coordination and understanding of cardiac anatomy in echocardiography education. Simulation devices have emerged as innovative teaching tools and exhibited distinctive advantages due to their ability to provide vivid and visual learning experiences. This study aimed to investigate the effect of simulation of sectional human anatomy using ultrasound on students’ learning outcomes and satisfaction in echocardiography education. Methods The study included 18 first-year clinical medical students with no prior echocardiography training. After randomization, they underwent a pre-test to assess basic knowledge. Following this, the students were divided into two groups: traditional teaching (traditional group) and simulation of sectional human anatomy using ultrasound (digital group). Each group received 60 min of instruction. Post-tests were assigned to students at two different time points: immediately after the lecture, and one week later (referred to as post-tests 1, and 2). In addition, anonymous questionnaires were distributed to students after class to investigate their satisfaction with teaching. Results Both groups showed significant improvement in their scores on post-test 1 compared to pre-test (traditional group: from 33.1 ± 8.8 to 48.1 ± 13.1, P = 0.034 vs. digital group: from 35.0 ± 6.7 to 58.0 ± 13.2, P = 0.008). However, there were no significant differences between the two groups in several post-test comparisons. Student satisfaction ratings revealed that the digital group experienced significantly greater satisfaction in areas such as subject interest, teaching style, course alignment, and interaction compared to the traditional group. Additionally, 80% of the digital group strongly endorsed the use of simulation of sectional human anatomy using ultrasound for echocardiography teaching, highlighting its effectiveness. Conclusions Simulation of sectional human anatomy using ultrasound may improve students’ understanding of echocardiography and satisfaction with the course. Our study provides evidence supporting the use of simulation teaching devices in medical education. Further research is needed to explore the long-term impact of this teaching method on students’ learning outcomes and its integration into the medical curriculum. Trial registration http://www.chictr.org.cn (registration number: ChiCTR2300074015, 27/07/2023).

Abstract CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P

A comparison was conducted on the microstructure, mechanical properties, and corrosion resistance of the fusion zone (FZ) in Zr R60702 laser lap joints prepared under air-cooled and water-cooled conditions. The results reveal that the upper and lower regions of the FZ in the welded joint consist of dendritic structure and α′ martensite, respectively. When water-cooled forced cooling is applied, α′ martensite emerges in the upper region of the FZ, with a few dendrites exhibiting an isoaxial distribution. Furthermore, the α′ martensite in the lower region becomes noticeably refined. The utilization of water-cooling triggers multiple strengthening mechanisms that, through synergistic interactions, enhance the microhardness, strength, and plasticity of the welded joints. The improved corrosion resistance within the FZ of the welded joint is attributed to the formation of a more stable passivation film.

Background: Preimplantation genetic testing (PGT) can reduce the risk of familial genetic diseases, chromosome abnormalities, and recurrent abortions. It is unclear whether genetic counselees with PGT indications understand and accept the implications of PGT. A well-developed and validated tool is needed to evaluate the knowledge, attitude, and practice (KAP) levels of genetic counselees with PGT indications. The purpose of this study was to develop and validate a PGT KAP questionnaire (PGT-KAP-Q) for genetic counselees with PGT indications. Methods: First, we established an item pool based on a literature review and qualitative interviews. Second, we developed the PGT-KAP-Q using the Delphi method. Third, we evaluated the quality of the questionnaire using item analysis and psychometric evaluation. The item analysis included extreme value comparison, application of the correlation and Cronbach's alpha (α) coefficient methods, and factor analysis. We also evaluated the content and structural validity of the questionnaire, as well as the internal consistency, test–retest reliability, and split-half reliability. Findings: After the literature review and interviews, and based on three rounds of expert consultations, we formed a 43-item questionnaire. In the validity analysis, the item's content validity index (I-CVI) and the average scale level CVI (S-CVI/Ave) values (>0.78 and >0.95, respectively) confirmed the questionnaire's content validity. Exploratory factor analysis showed that all 43 items had strong factor loadings (>0.4), and the three factors of the PGT-KAP-Q explained 51.97 % of the total variance. The Cronbach's α coefficient for the questionnaire was 0.95 (p

In oligotrophic oceans, primary productivity is widely limited by nitrogen bioavailability. The broadly distributed and abundant nitrogen-fixing cyanobacterium Trichodesmium plays an important role in the oceanic nitrogen and carbon cycles by providing a “new” source of nitrogen to many non-diazotrophic microbes, thereby driving new primary production in the ocean. However, the underlying process and mechanism of nitrogen supply from Trichodesmium to other phytoplankton remain unclear. Here, our results demonstrated that the fixed nitrogen released by Trichodesmium could sustain the growth of a non-nitrogen-fixing cyanobacterium Synechococcus sp. PCC 7002, including a mutant strain (Mut-ureA) that cannot use urea. However, the growth rate of Mut-ureA was approximately 20% lower than that of the wild strain when Trichodesmium filtrate was used for nitrogen supply. This result was consistent with the composition of the Trichodesmium exudate, in which urea comprised more than 20% of the total fixed nitrogen that was released. It is evident from the experiments that a fraction of the Trichodesmium-derived nitrogen was not available to Mut-ureA. Our results suggested that Trichodesmium produces dissolved organic nitrogen, especially a certain amount of urea as a “new” nitrogen source, benefiting in particular populations of surrounding phytoplankton species.

Recent studies have unveiled the presence of nano- and microplastics (NMPs) within both human and avian respiratory systems, prompting an exploration into the interactions between these particles and the human respiratory system. Experimental evidence has strongly suggested that these plastic particles amplify human susceptibility to a spectrum of lung disorders, including chronic obstructive pulmonary disease, fibrosis, dyspnea, asthma, and the formation of frosted glass nodules. To advance the understanding, this study employs computational fluid-particle dynamics (CFPD) to study the transfer and deposition of poly-dispersed 1-100 nm nanoplastics and 1-100 μm microplastics under three breathing conditions. Notably, this investigation utilized a computerized tomography-based full respiratory tract model, comprehensively spanning regions from the nasal cavity to the 13th generation of the bronchial tree, providing a highly detailed representation of the anatomical complexities of the human respiratory system. The outcomes reveal distinctive deposition patterns of spherical, cylindrical, and tetrahedral NMPs in the human respiratory tract, elucidating the significant impact of breathing rate, pinpointing specific deposition hotspots, and highlighting the critical role of particle size in governing transport and deposition behavior. This study establishes a link between the behavior of nanoplastics within the respiratory tract and its consequential impact, providing insights that extend across three critical domains. Firstly, in environmental health, the research contributes to understanding NMP-related air pollution. Secondly, within respiratory medicine, the findings shed light on NMPs' role in respiratory disorders. Finally, this study guides the formulation of regulations addressing permissible NMP levels and mitigating associated health and environmental risks.

In this paper, we propose a doping approach to lower the error floor of Low-Density Parity-Check (LDPC) codes. The doping component is a short block code in which the information bits are selected from the coded bits of the dominant trapping sets of the LDPC code. Accordingly, an algorithm for selecting the information bits of the short code is proposed, and a specific two-stage decoding algorithm is presented. Simulation results demonstrate that the proposed doped LDPC code achieves up to 2.0 ​dB gain compared with the original LDPC code at a frame error rate of 10−6. Furthermore, the proposed design can lower the error floor of original LDPC codes.

Abstract Lung cancer, a prevalent and aggressive disease, is characterized by recurrence and drug resistance. It is essential to comprehend the fundamental processes and discover novel therapeutic objectives for augmenting treatment results. Based on our research findings, we have identified a correlation between methylation of cg09897064 and decreased expression of ZBP1, indicating a link to unfavorable prognosis in patients with lung cancer. Furthermore, these factors play a role in macrophage polarization, with ZBP1 upregulated in M1 macrophages compared to both M0 and M2 polarized macrophages. We observed cg09897064 methylation in M2 polarization, but not in M0 and M1 polarized macrophages. ATACseq analysis revealed closed chromatin accessibility of ZBP1 in M0 polarized macrophages, while open accessibility was observed in both M1 and M2 polarized macrophages. Our findings suggest that ZBP1 is downregulated in M0 polarized macrophages due to closed chromatin accessibility and downregulated in M2 polarized macrophages due to cg09897064 methylation. Further investigations manipulating cg09897064 methylation and ZBP1 expression through overexpression plasmids and shRNAs provided evidence for their role in modulating macrophage polarization and tumor growth. ZBP1 inhibits M2 polarization and suppresses tumor growth, while cg09897064 methylation promotes M2 polarization and macrophage-induced tumor growth. In mechanism investigations, we found that cg09897064 methylation impairs CEBPA binding to the ZBP1 promoter, leading to decreased ZBP1 expression. Clinical experiments were conducted to validate the correlation between methylation at cg09897064, ZBP1 expression, and macrophage M2 polarization. Targeting these factors may hold promise as a strategy for developing innovative checkpoint inhibitors in lung cancer treatment.

Abstract Background In heart failure (HF), mitochondrial dysfunction and metabolic remodeling lead to a reduction in energy productivity and aggravate cardiomyocyte injury. Supplementation with α-ketoglutarate (AKG) alleviated myocardial hypertrophy and fibrosis in mice with HF and improved cardiac insufficiency. However, the myocardial protective mechanism of AKG remains unclear. We verified the hypothesis that AKG improves mitochondrial function by upregulating NAD+ levels and activating silent information regulator 2 homolog 1 (SIRT1) in cardiomyocytes. Methods In vivo, 2% AKG was added to the drinking water of mice undergoing transverse aortic constriction (TAC) surgery. Echocardiography and biopsy were performed to evaluate cardiac function and pathological changes. Myocardial metabolomics was analyzed by liquid chromatography‒mass spectrometry (LC‒MS/MS) at 8 weeks after surgery. In vitro, the expression of SIRT1 or PINK1 proteins was inhibited by selective inhibitors and siRNA in cardiomyocytes stimulated with angiotensin II (AngII) and AKG. NAD+ levels were detected using an NAD test kit. Mitophagy and ferroptosis levels were evaluated by Western blotting, qPCR, JC-1 staining and lipid peroxidation analysis. Results AKG supplementation after TAC surgery could alleviate myocardial hypertrophy and fibrosis and improve cardiac function in mice. Metabolites of the malate-aspartate shuttle (MAS) were increased, but the TCA cycle and fatty acid metabolism pathway could be inhibited in the myocardium of TAC mice after AKG supplementation. Decreased NAD+ levels and SIRT1 protein expression were observed in heart of mice and AngII-treated cardiomyocytes. After AKG treatment, these changes were reversed, and increased mitophagy, inhibited ferroptosis, and alleviated damage in cardiomyocytes were observed. When the expression of SIRT1 was inhibited by a selective inhibitor and siRNA, the protective effect of AKG was suppressed. Conclusion Supplementation with AKG can improve myocardial hypertrophy, fibrosis and chronic cardiac insufficiency caused by pressure overload. By increasing the level of NAD+, the SIRT-PINK1 and SIRT1-GPX4 signaling pathways are activated to promote mitophagy and inhibit ferroptosis in cardiomyocytes, which ultimately alleviates cardiomyocyte damage.

This paper studies a class of quasi-cyclic LDPC (QC-LDPC) codes, i.e., Tanner (3, 23)-regular QC-LDPC codes of code length $23p$ with $p$ being a prime and $p \equiv 1 (\mathrm {mod} 69)$ . We first analyze the cycle structure of Tanner (3, 23)-regular QC-LDPC codes, and divide their cycles of lengths 4, 6, 8, and 10 into five equivalent types. We propose the sufficient and necessary condition for the existence of these five types of cycles, i.e., the polynomial equations in a 69th unit root of the prime field $\mathbb {F}_{p}$ . We check the existence of solutions for such polynomial equations by using the Euclidean division algorithm and obtain the candidate girth values of Tanner (3, 23)-regular QC-LDPC codes. We summarize the results and determine the girth distribution of Tanner (3, 23)-regular QC-LDPC codes.

Flexible hafnia-based ferroelectric memories are arousing much interest with the ever-growing demands for nonvolatile data storage in wearable electronic devices. Here, high-quality flexible Hf0.5Zr0.5O2 membranes with robust ferroelectricity were fabricated on inorganic pliable mica substrates via an atomic layer deposition technique. The flexible Hf0.5Zr0.5O2 thin membranes with a thickness of ∼8 nm exhibit a high remanent polarization of ∼16 μC/cm2, which possess very robust polarization switching endurance (>1010 cycles, two orders of magnitude better than reported flexible HfO2-based films) and superior retention ability (expected >10 years). In particular, stable ferroelectric polarization as well as excellent endurance and retention performance show negligible degradations under 6 mm radius bending conditions or after 104 bending cycles with a 6 mm bending radius. These results mark a crucial step in the development of flexible hafnium oxide-based ferroelectric memories for wearable electronic devices.

Ultrasonic plastic welding (UPW) is a highly efficient and environmental friendly method that has gained gradually increased attention in joining carbon fiber reinforced thermoplastic (CFRTP). A crucial aspect in UPW of CFRTP is the design of the energy director (ED). This paper employs ultrasonic embossing, a cost-effective way to manufacture ED on the surface of CFRTP sheets. The effect of ultrasonic embossing time and welding time on the joint performance is investigated in terms of microstructure, tensile-shear property, and fracture surface morphology. The results show that the structured surface made by ultrasonic embossing can be used as ED to concentrate welding energy. This process reduces the randomness and dispersion of weld distribution, improves the failure load of welded joints by 30 % compared with the joints made without using ED. The ultrasonic embossing time has a limited influence on the joint failure load. Sound welded joints can be obtained when welding with one structured surface and welding time of 1.5 s.

Abstract. Background:. Red-cell transfusion is critical for surgery during the peri-operative period; however, the transfusion threshold remains controversial mainly owing to the diversity among patients. The patient's medical status should be evaluated before making a transfusion decision. Herein, we developed an individualized transfusion strategy using the West-China-Liu's Score based on the physiology of oxygen delivery/consumption balance and designed an open-label, multicenter, randomized clinical trial to verify whether it reduced red cell requirement as compared with that associated with restrictive and liberal strategies safely and effectively, providing valid evidence for peri-operative transfusion. Methods:. Patients aged >14 years undergoing elective non-cardiac surgery with estimated blood loss > 1000 mL or 20% blood volume and hemoglobin concentration

Background: Diarrheal disease remains a significant public health issue, particularly affecting young children and older adults. Despite efforts to control and prevent these diseases, their incidence continues to be a global concern. Understanding the trends in diarrhea incidence and the factors influencing these trends is crucial for developing effective public health strategies. Objective: This study aimed to explore the temporal trends in diarrhea incidence and associated factors from 1990 to 2019 and to project the incidence for the period 2020–2040 at global, regional, and national levels. We aimed to identify key factors influencing these trends to inform future prevention and control strategies. Methods: The eXtreme Gradient Boosting (XGBoost) model was used to predict the incidence from 2020 to 2040 based on demographic, meteorological, water sanitation, and sanitation and hygiene indicators. SHapley Additive exPlanations (SHAP) value was performed to explain the impact of variables in the model on the incidence. Estimated annual percentage change (EAPC) was calculated to assess the temporal trends of age-standardized incidence rates (ASIRs) from 1990 to 2019 and from 2020 to 2040. Results: Globally, both incident cases and ASIRs of diarrhea increased between 2010 and 2019. The incident cases are expected to rise from 2020 to 2040, while the ASIRs and incidence rates are predicted to slightly decrease. During the observed (1990–2019) and predicted (2020–2040) periods, adults aged 60 years and above exhibited an upward trend in incidence rate as age increased, while children aged < 5 years consistently had the highest incident cases. The SHAP framework was applied to explain the model predictions. We identified several risk factors associated with an increased incidence of diarrhea, including age over 60 years, yearly precipitation exceeding 3000 mm, temperature above 20 °C for both maximum and minimum values, and vapor pressure deficit over 1500 Pa. A decreased incidence rate was associated with relative humidity over 60%, wind speed over 4 m/s, and populations with above 80% using safely managed drinking water services and over 40% using safely managed sanitation services. Conclusions: Diarrheal diseases are still serious public health concerns, with predicted increases in the incident cases despite decreasing ASIRs globally. Children aged < 5 years remain highly susceptible to diarrheal diseases, yet the incidence rate in the older adults aged 60 plus years still warrants additional attention. Additionally, more targeted efforts to improve access to safe drinking water and sanitation services are crucial for reducing the incidence of diarrheal diseases globally.

IntroductionDrip irrigation under mulch film promotes a non-uniform salinity distribution in salt fields. The effect of different N application methods on the growth and yield of cotton under drip irrigation under mulch film conditions in eastern coastal saline-alkaline soils in China remain remained unclear.MethodsA randomized complete block design was used in the experiment. Three N application methods were assigned: N applied under mulch film (low-salinity area; UM), N applied between mulch films (high-salinity area; BM), and half N applied under mulch film and half between mulch films (HUHB).ResultsPlant height, photosynthesis, Chl content, boll load, biomass, boll weight and boll density under UM were all significantly higher than those under the other two treatments. The N absorption of UM was higher than in the other two treatments, which might be attributed to the expression of GHNRT1.5 and GHNRT2.1. The net NO3- influx in the roots in UM increased significantly compared with that in BM. The yield and FNRE of UM were 3.9% and 9.1%, respectively, and were 26.52% and 90.36% higher than under HUHB and BM treatments.DiscussionUM not only improved cotton yield but also alleviated the pollution of N residue on drip irrigation under mulch film conditions in salt areas.

Abstract Control of convection plays an important role in heat transfer regulation, bio/chemical sensing, phase separation, etc. Current convection controlling systems generally depend on engineered energy sources to drive and manipulate the convection, which brings additional energy consumption into the system. Here the use of human hand as a natural and sustainable infrared (IR) radiation source for the manipulation of liquid convection is demonstrated. The fluid can sense the change of the relative position or the shape of the hand with the formation of different convection patterns. Besides the generation of static complex patterns, dynamic manipulation of convections can also be realized via moving of hand or finger. The use of such sustainable convections to control the movement of a floating “boat” is further achieved. The use of human hands as the natural energy sources provides a promising approach for the manipulation of liquid convection without the need of extra external energy, which may be further utilized for low‐cost and intelligent bio/chemical sensing and separation.

Abstract The practical implementation of aqueous Zn‐ion batteries (ZIBs) for large‐scale energy storage is impeded by the challenges of water‐induced parasitic reactions and uncontrolled dendrite growth. Herein, we propose a strategy to regulate both anions and cations of electrolyte solvation structures to address above challenges, by introducing an electrolyte additive of 3‐hydroxy‐4‐(trimethylammonio)butyrate (HTMAB) into ZnSO4 electrolyte. Consequently, the deposition of Zn is significantly improved leading to a highly reversible Zn anode with paralleled texture. The Zn/Zn cells with ZnSO4/HTMAB exhibit outstanding cycling performance, showcasing a lifespan exceeding 7500 h and an exceptionally high accumulative capacity of 16.47 Ah cm−2. Zn/NaV3O8·1.5H2O full cell displays a specific capacity of ~130 mAh g−1 at 5 A g−1 maintaining a capacity retention of 93% after 2000 cycles. This work highlights the regulation on both cations and anions of electrolyte solvation structures in optimizing interfacial stability during Zn plating/stripping for high performance ZIBs.

Abstract Because of its potent antioxidant effects, lycopene has been used in various industries including, but not limited to, food, medical, and cosmetic industries. Yarrowia lipolytica, a non-conventional yeast species, is a promising chassis due to its natural mevalonate (MVA) pathway, abundant precursor acetyl coenzyme A content, and oleaginous properties. Several gene editing tools have been developed for Y. lipolytica along with engineering strategies for tetraterpenoid production. In this study, we engineered Y. lipolytica following multi-level strategies for efficient lycopene accumulation. We first evaluated the performance of the key lycopene biosynthetic genes crtE, crtB, and crtI, expressed via ribosomal DNA (rDNA) mediated multicopy random integration in the HMG1- and GGS1-overexpressing background strain. Further improvement in lycopene production was achieved by overexpressing the key genes for MVA synthesis via non-homologous end joining (NHEJ) mediated multi-round iterative transformation. Efficient strategies in the MVA and lipid synthesis pathways were combined to improve lycopene production with a yield of 430.5 mg/L. This strain produced 121 mg/g dry cell weight of lycopene in a 5-L fed-batch fermentation system. Our findings demonstrated iterative gene integration mediated by 26S rDNA and NHEJ for the efficient production of lycopene in Y. lipolytica. These strategies can be applied to induce Y. lipolytica to produce other tetraterpenoids. Graphical Abstract

Abstract Background Broussonetia papyrifera (L.) L’Hér. ex Vent. has the characteristics of strong stress resistance, high crude protein content, and pruning tolerance. It is an ecological, economic, and medicinal plant. Polyploid plants usually perform better than their corresponding diploid plants in terms of nutrients, active substances, and stress resistance. Results In this study, the leaves, calli, and seeds of diploid B. papyrifera were used for tetraploid induction by colchicine. The induction effect of colchicine on B. papyrifera was summarized through the early morphology, chromosome count and flow cytometry. It was concluded that the best induction effect (18.6%) was obtained when the leaves of B. papyrifera were treated in liquid MS (Murashige and Skoog) medium containing 450 mg·L-1 colchicine for 3 d. The comparative analysis of the growth characteristics of diploid and tetraploid B. papyrifera showed that tetraploid B. papyrifera has larger ground diameter, larger stomata, thicker palisade tissue and thicker sponge tissue than diploid B. papyrifera. In addition, the measurement of photosynthetic features also showed that tetraploids had higher chlorophyll content and higher photosynthetic rates. Conclusion This study showed that tetraploid B. papyrifera could be obtained by treating leaves, callus and seeds with liquid and solid colchicine, but the induction efficiency was different. Moreover, there were differences in stomata, leaf cell structure and photosynthetic features between tetraploid B. papyrifera and its corresponding diploid. The induced tetraploid B. papyrifera can provide a technical basis and breeding material for the creation of B. papyrifera germplasm resources in the future.

Abstract The severity of heat stroke (HS) is associated with intestinal injury, which is generally considered an essential issue for HS. Heat acclimation (HA) is considered the best strategy to protect against HS. In addition, HA has a protective effect on intestinal injuries caused by HS. Considering the essential role of gut microbes in intestinal structure and function, we decided to investigate the potential protective mechanism of HA in reducing intestinal injury caused by HS. HA model was established by male C57BL/6J mice (5–6 weeks old, 17–19 g) were exposed at (34 ± 0.7)°C for 4 weeks to establish an animal HA model. The protective effect of HA on intestinal barrier injury in HS was investigated by 16S rRNA gene sequencing and nontargeted liquid chromatography‐mass spectrometry (LC‐MS) metabolomics. According to the experimental results, HA can change the composition of the gut microbiota, which increases the proportion of lactobacilli, faecal bacteria, and urinobacteria but decreases the proportion of deoxycholic acid. Moreover, HA can reduce liver and kidney injury and systemic inflammation caused by HS and reduce intestinal injury by enhancing the integrity of the intestinal barrier. In addition, HA regulates inflammation by inhibiting NF‐κB signalling and increasing tight junction protein expression in HS mice. HA induces changes in the gut microbiota, which may enhance tight junction protein expression, thereby reducing intestinal inflammation, promoting bile acid metabolism, and ultimately maintaining the integrity of the intestinal barrier. In conclusion, HA induced changes in the gut microbiota. Among the gut microbiota, lactobacilli may play a key role in the potential protective mechanism of HA.

Zr–Sn and Zr–Sn–Nb alloys were joined using current-induced solid-state welding. This process led to significant plastic deformation in Zr alloy, resulting in a robust welded joint. The Cu particles, oxides, and other impurities were scattered at the interface. Two distinct microstructures, basketweave-parallel-plate and basketweave-plate, emerged in the weld's center, attributable to varying thermal cycles. The average grain size in Zr–Sn–Nb alloy was smaller than in Zr–Sn alloy side. During the welding of Zr–Sn–Nb alloy, the majority of β-Nb secondary phases particles (SPPs) dissolved. Conversely, in Zr–Sn alloy, elongated, irregular ZrFe2 SPPs were observed between the α plates. The joint formation was influenced significantly by initial slip, twin-induced plasticity (TWIP), and transformation-induced plasticity (TRIP) mechanisms. The joint's burst force was measured between 8790 and 8890 N, and the fractures occurred at a location distant from the weld.

In order to facilitate the application of underwater laser welding technology in in situ repairs of nuclear power plants, this study conducted comparative experiments between local dry underwater laser welding and laser welding in air on 304NG nitrogen-controlled stainless steel. The aim was to explore its microstructural evolution and mechanical properties in underwater environments. It was found that, near the fusion line of laser welding in air, columnar dendrites gradually evolved into cellular dendrites toward the weld center, eventually disappearing, resulting in a skeletal ferrite and serrated austenite structure. The underwater laser welding joints exhibited similar characteristics yet with more pronounced alternation between columnar and cellular dendrites. Additionally, the size of cellular dendrites decreased significantly, and needle-like ferrite was observed at the weld center. The hardness of underwater laser welded joints was slightly higher than that of in-air laser welded joints. Compared to laser welding in air, the strength of underwater laser welding joints increased from 443 MPa to 471 MPa, and the displacement increased from 2.95 mm to 3.45 mm, both types of welded joints exhibited a mixed mode fracture characterized by plasticity and brittleness.

Highlights The synergistic “anchor-capture” mechanism of polar groups on Zn stripping/plating process is firstly proposed. The amino group firmly anchors on Zn surface and the carboxyl group strongly captures Zn2+, constructing a robust anode–electrolyte interface and inducing uniform Zn deposition. The ultra-stable cycle lifespan of Zn–Zn symmetric cell (over 2800 h) and high utilization rate of Zn anode (the depth of discharge up to 68% for 200 h) are achieved under the proposal of synergistic “anchor-capture.”

In order to investigate the anti-photoaging effect and mechanism of tomato and aronia extracts, the effects of tomato extract and aronia extract on apoptosis, reactive oxygen species (ROS) and prostaglandin E2 (PGE2) were studied in UVB-irradiated HaCaT cells. Hematoxylin-eosin (HE) staining was used to evaluate the anti-photoaging effect of tomato and aronia complex (LA) on skin photoaging in UVB-irradiated ICR mice. The activity of superoxide dismutase (SOD), the level of malondialdehyde (MDA) and the expression of pro-inflammatory factors interleukin-1β (IL-1β), interleukin-6 (IL-6), cyclooxygenase-2 (COX-2) and tumor necrosis factor-α (TNF-α) were detected. The results showed that tomato extract and aronia extract were not cytotoxic to HaCaT cells. In the photoaging model of HaCaT cells, compared with the model group, the number of apoptotic cells in 100 μg/mL tomato extract group and 30μg/mL aronia extract group were significantly decreased (P

Abstract Endothelial cells (ECs) angiogenesis is the process of sprouting new vessels from the existing ones, playing critical roles in physiological and pathological processes such as wound healing, placentation, ischemia/reperfusion, cardiovascular diseases and cancer metastasis. Although mitochondria are not the major sites of energy source in ECs, they function as important biosynthetic and signaling hubs to regulate ECs metabolism and adaptations to local environment, thus affecting ECs migration, proliferation and angiogenic process. The understanding of the importance and potential mechanisms of mitochondria in regulating ECs metabolism, function and the process of angiogenesis has developed in the past decades. Thus, in this review, we discuss the current understanding of mitochondrial proteins and signaling molecules in ECs metabolism, function and angiogeneic signaling, to provide new and therapeutic targets for treatment of diverse cardiovascular and angiogenesis-dependent diseases.

Taxadiene is an important precursor for the biosynthesis of highly effective anticancer drug paclitaxel, but its microbial biosynthesis yield is very low. In this study, we employed Yarrowia lipolytica as a microbial host to produce taxadiene. First, a “push–pull” strategy was adopted to increase taxadiene production by 234%. Then taxadiene synthase was fused with five solubilizing tags respectively, leading a maximum increase of 62.3% in taxadiene production when fused with SUMO. Subsequently, a multi-copy iterative integration method was used to further increase taxadiene titer, achieving the maximum titer of 23.7 mg/L in shake flask culture after three rounds of integration. Finally, the taxadiene titer was increased to 101.4 mg/L by optimization of the fed-batch fermentation conditions. This is the first report of taxadiene biosynthesis accomplished in Y. lipolytica, serving as a good example for the sustainable production of taxadiene and other terpenoids in this oleaginous yeast.

In this paper, we introduce Dirac equation, the hole theory of positive and negative matter, and Anderson localization theory briefly. We analyze physical conditions of localization: [Formula: see text] inequality relation. On this basis, we try to put forward the physical mode of production of free positron and electron. In this model, when [Formula: see text] rays travel through a vacuum, due to the action in which quantum superfluid rushes to the heat source ([Formula: see text] ray), the quantum superfluid polymerization, local disorder, two-model quantum superfluid shunt, quantum superfluid in a vacuum is localized by the electro-vector and magnetic-vector in the electromagnetic field of the [Formula: see text] ray to form electrons and positrons; in essence, the electro-vector and magnetic-vector are components of [Formula: see text] quantum in the electromagnetic field ([Formula: see text] ray); and the spin of the [Formula: see text] ray is composed of two components. After localization, positive and negative polarities whose phases are opposite are formed. The positron and electron charges produced in this model have the same quantum numbers such as the mass, spin and average lifetime, and the additive quantum numbers such as charge, baryon number, lepton number, and singularity number should be equal but opposite, the magnetic moment direction of the positive and negative particles are opposite when their spin directions are the same. We can take experimental verification of this model. Once verified, the localization theory also seems to open a door for us to study the structure of sub-quarks and lepton, and also provides a theoretical basis for harnessing the enormous energy generated by the annihilation of positive and negative matter.

Key Clinical Message Intra‐abdominal hypertension and abdominal compartment syndrome (ACS) are distinct clinical stages of pathology caused by increased intra‐abdominal pressure, which may lead to respiratory and circulatory dysfunction in children and is associated with high pediatric mortality. An emergency exploratory laparotomy was planned for an infant with ACS. After induction of anesthesia and endotracheal intubation, the patient developed ventilation failure and any management was ineffective. Ventilation was resumed after a race against time abdominal decompression by the surgical team. Abdominal decompression is the primary treatment to relieve respiratory and circulatory failure in children with ACS.

IntroductionTo investigate the therapeutic effect of clitoris exposure + episioplasty + dermabrasion + platelet-rich plasma (PRP) injection + chemexfoliation on vulvar lichen sclerosus (VLS).MethodsTwenty children with VLS (under 14 years old) at our hospital from July 2020 to November 2022 were enrolled and treated with clitoris exposure + episioplasty + dermabrasion + PRP injection + chemexfoliation. Additionally, symptomatic changes and improvements in signs were recorded.ResultsSignificant therapeutic effects were achieved in all children enrolled in this study. The Cattanco score was 8.02 ± 1.22 points before surgery, 2.21 ± 0.70 points 3 months after surgery, and 2.61 ± 0.59 points 6 months after surgery, demonstrating that the score after surgery was significantly lower than that before surgery (p < 0.05). Mild complications (one case of mild vulvar swelling, one case of minor bleeding, and one case of superficial ulcer) were observed in three children after surgery, with an overall complication incidence of 15%; all complications were improved after the intervention, and no severe adverse reactions were observed. Recurrence was observed in one child (5%) 6 months after surgery.ConclusionClitoris exposure + episioplasty + dermabrasion + PRP injection + chemexfoliation is an effective approach for the treatment of VLS.Systematic Review Registrationhttps://www.chictr.org.cn/searchproj.html, identifier: ChiCTR2100054787.

CD36 is a multifunctional receptor expressed on the surface of many cell types. Among healthy individuals, CD36 may be absent on platelets and monocytes (type I deficiency) or platelets alone (type II deficiency). However, the exact molecular mechanisms underlying CD36 deficiency remain unclear. In this study, we aimed to identify individuals with CD36 deficiency and investigate the molecular basis underlying it. Blood samples were collected from platelet donors at Kunming Blood Center. Platelets and monocytes were isolated and CD36-expression levels were analyzed using flow cytometry. DNA from whole blood and mRNA isolated from monocytes and platelets of individuals with CD36 deficiency were analyzed using polymerase chain reaction (PCR) testing. The PCR products were cloned and sequenced. Among the 418 blood donors,7 (1.68%) were CD36 deficient: 1 (0.24%) with type I deficiency and 6(1.44%) with type II deficiency. Six heterozygous mutations occurred, including c.268C>T (in type I individuals), c.120 + 1 G>T, c.268C>T, c.329_330del/AC, c.1156 C>T, c.1163A>C, and c.1228_1239del/ATTGTGCCTATT (in type II individuals). Mutations were not detected in one type II individual . At the cDNA level, only mutant, but not wild-type, transcripts were detected in the platelets and monocytes of type I individual. In type II individuals, only mutant transcripts were found in platelets, whereas monocytes possessed wild-type and mutant transcripts. Interestingly, only alternative splicing transcripts were observed in the individual without mutation. We report the incidence rates of type I and II CD36 deficiencies among platelet donors in Kunming. Molecular genetic analyses of DNA and cDNA demonstrated that homozygous mutations on the cDNA level in platelets and monocytes or platelets alone identified type I and II deficiencies, respectively. Furthermore, alternatively spliced products also potentially contribute to the mechanism of CD36 deficiency.

Abstract Viral infection in respiratory tract usually leads to cell death, impairing respiratory function to cause severe disease. However, the diversity of clinical manifestations of SARS-CoV-2 infection increases the complexity and difficulty of viral infection prevention, and especially the high-frequency asymptomatic infection increases the risk of virus transmission. Studying how SARS-CoV-2 affects apoptotic pathway may help to understand the pathological process of its infection. Here, we uncovered SARS-CoV-2 imployed a distinct anti-apoptotic mechanism via its N protein. We found SARS-CoV-2 virus-like particles (trVLP) suppressed cell apoptosis, but the trVLP lacking N protein didn’t. Further study verified that N protein repressed cell apoptosis in cultured cells, human lung organoids and mice. Mechanistically, N protein specifically interacted with anti-apoptotic protein MCL-1, and recruited a deubiquitinating enzyme USP15 to remove the K63-linked ubiquitination of MCL-1, which stabilized this protein and promoted it to hijack Bak in mitochondria. Importantly, N protein promoted the replications of IAV, DENV and ZIKV, and exacerbated death of IAV-infected mice, all of which could be blocked by a MCL-1 specific inhibitor, S63845. Altogether, we identifed a distinct anti-apoptotic function of the N protein, through which it promoted viral replication. These may explain how SARS-CoV-2 effectively replicates in asymptomatic individuals without cuasing respiratory dysfunction, and indicate a risk of enhanced coinfection with other viruses. We anticipate that abrogating the N/MCL-1-dominated apoptosis repression is conducive to the treatments of SARS-CoV-2 infection as well as coinfections with other viruses.

The strata with large impedance differences are presented as strong amplitude seismic events on the seismic profile, which obscure useful information of nearby reservoirs and need interpretive target processing to remove the strong shielding. Therefore, this study proposes a multi-channel matching pursuit algorithm based on adaptive weight to remove strong shielding. Moreover, to address the problem of poor matching accuracy and spatial continuity of normal multi-channel matching pursuit at area where strong tectonic changes occur, a multi-channel matching pursuit de-strong shielding method based on adaptive weights is proposed. First, we used the layer structure information to flatten the strong reflection layer locally to weaken the influence of stratigraphic structure changes on the extraction of the strong reflection layer. Subsequently, we introduced a correlation coefficient between adjacent seismic traces and the central trace as the weight of multi trace averaging, which improved the stability and lateral continuity of the matching results. The result analysis of model processing tests and practical seismic data application shows that the proposed method can effectively strip the strong reflections and highlight the effective reservoir information; the well seismic match degree is significantly improved with higher matching accuracy, better spatial continuity, and better striping effect than those of the conventional matching pursuit algorithm.

Oxidative stress can induce inflammation and tight junction disruption in enterocytes. The initiation of inflammation is thought to commence with the activation of the ROS/NLRP3/IL-1β signaling pathway, marking a crucial starting point in the process. In our previous studies, we found that microbe-derived antioxidants (MAs) showed significant potential in enhancing both antioxidant capabilities and anti-inflammatory effects. The main aim of this research was to investigate the ability of MAs to protect cells from oxidative stress caused by H2O2, to reduce inflammatory responses, and to maintain the integrity of tight junction proteins by modulating the ROS/NLRP3/IL-1β signaling pathway. IPEC-1 cells (1 × 104 cells/well) were initially exposed to 100 mg/L of MAs for 12 h, after which they were subjected to 1 mM H2O2 treatment for 1 h. We utilized small interfering RNA (siRNA) to inhibit the expression of NLRP3 and Nrf2. Inflammatory factors such as IL-1β and antioxidant enzyme activity levels were detected by ELISA. Oxidative stress marker ROS was examined by fluorescence analysis. The NLRP3/IL-1β signaling pathway, Nrf2/HO-1 signaling pathway and tight junction proteins (ZO-1 and Occludin) were detected by RT-qPCR or Western blotting. In our research, it was observed that MA treatment effectively suppressed the notable increase in H2O2-induced inflammatory markers (TNF-α, IL-1β, and IL-18), decreased ROS accumulation, mitigated the expression of NLRP3, ASC, and caspase-1, and promoted the expression of ZO-1 and Occludin. After silencing the NLRP3 gene with siRNA, the protective influence of MAs was observed to be linked with the NLRP3 inflammasome. Additional investigations demonstrated that the treatment with MAs triggered the activation of Nrf2, facilitating its translocation into the nucleus. This process resulted in a notable upregulation of Nrf2, NQO1, and HO-1 expression, along with the initiation of the Nrf2-HO-1 signaling pathway. Consequently, there was an enhancement in the activities of antioxidant enzymes like SOD, GSH-Px, and CAT, which effectively mitigated the accumulation of ROS, thereby ameliorating the oxidative stress state. The antioxidant effectiveness of MAs was additionally heightened in the presence of SFN, an activator of Nrf2. The antioxidant and anti-inflammatory functions of MAs and their role in regulating intestinal epithelial tight junction protein disruption were significantly affected after siRNA knockdown of the Nrf2 gene. These findings suggest that MAs have the potential to reduce H2O2-triggered oxidative stress, inflammation, and disruption of intestinal epithelial tight junction proteins in IPEC-1 cells. This reduction is achieved by blocking the ROS/NLRP3/IL-1β signaling pathway through the activation of the Nrf2 pathway.

The treatment of tritiated nuclear wastewater is facing greater challenges with the continuous expansion of the nuclear industry. The key to solving the issue of detritium in low-abundance tritium water lies in developing highly efficient and cost-effective hydrogen isotope separation technology. Graphene oxide (GO) membrane separation method exhibits greater potential compared to other existing energy-intensive technologies for the challenging task of hydrogen isotope separation in nuclear wastewater. In recent years, researchers have explored few strategies to enhance the performance of graphene oxide (GO) membranes in hydrogen isotope water treatment, recognizing the current limitations in separation efficiency. In this study, the GO/g-C3N4 composite membrane has been successfully employed for the first time in the separation of hydrogen isotopes in water. A series of GO membranes were prepared and their performances were tested by a self-made experimental device. As a result, the separation performance of the GO membrane was enhanced by the modification with graphitic carbon nitride (g-C3N4). The permeation rate of the GO/g-C3N4 membrane was higher than that of the GO membrane, while maintaining a high separation factor. Our study also demonstrated that this phenomenon can be attributed to the changes in membrane structure at the microscopic scale. The H/D separation factor and the permeate flux of the composite membrane containing g-C3N4 of 6.7% by mass were 1.10 and 7.2 × 10−5 g·min−1·cm−2 are both higher than that of the GO membrane under the same experimental conditions, which is promising for the isotope treatment.

Objective: Heatstroke (HS) is a severe acute disease related to gastrointestinal barrier dysfunction, systemic inflammation and multiple organ injury. Many of the functions of Intestinal alkaline phosphatase (IAP) have been linked to gut homeostasis, gut barrier function and inflammation. However, the protective effect of IAP on heatstroke is not fully elucidated. This study aims to explore the protective effect of IAP on heatstroke by maintaining intestinal barrier and improving permeability. Methods: Male C57BL/6 mice were placed in a controlled climate chamber (ambient temperature: 40.0 ± 0.5 °C; humidity: 60 ± 5 %) until the maximum core temperature (Tc, max) reached 42.7 °C (the received criterion of HS). Then heat exposed mice (n = 195) were divided into three groups: 0.2 mL of 0.9 % physiological saline (HS) or vehicle (HS + Vehicle) or 300 IU IAP (HS + IAP) by gavage at 0, 24, and 48 h after onset. Control group mice (Con) (n = 65) were not exposed to heat and were gavaged with 0.9 % physiological saline of the same volume at the same time. Results: IAP treatment significantly reduced the levels of endotoxin, FD4, and D-lactate in the blood of heatstroke mice, reduced intestinal permeability and maintained the integrity of the intestinal barrier by increasing the expression of tight junction proteins. Meanwhile, IAP treatment alleviated liver and kidney damage caused by heatstroke, reduced serum levels of inflammatory cytokines, and thus improved survival rate of mice after heatstroke. Conclusion: This study indicates that IAP can improve the intestinal barrier function and intestinal permeability by increasing intestinal tight junctions, reduce systemic inflammation and multiple organ injury and improving the survival rate of heatstroke. Therefore, we consider IAP may be added to enteral nutrition formulas as a potential means for diseases characterized by intestinal permeability disorders, including heatstroke.

Brain organoids have been widely used to study diseases and the development of the nervous system. Many reports have investigated the application of brain organoids, but most of these models lack vascular structures, which play essential roles in brain development and neurological diseases. The brain and blood vessels originate from two different germ layers, making it difficult to induce vascularized brain organoids in vitro. We developed this protocol to generate brain-specific blood vessel and cerebral organoids and then fused them at a specific developmental time point. The fused cerebral organoids exhibited robust vascular network-like structures, which allows simulating the in vivo developmental processes of the brain for further applications in various neurological diseases.Key Features• Culturing vascularized brain organoids using human embryonic stem cells (hESCs).• The new approach generates not only neural cells and vessel-like networks but also brain-resident microglia immune cells in a single organoid.Graphical overviewWorkflow and timeline for vessel organoid and vascularized brain organoid generation. (By Figdraw, ID: RTIURffccf)

Given the increasing incidence of pancreatic cancer and the low survival rate, the exploration of the complex tumor microenvironment and the development of novel treatment options is urgent. NK cells, known for their cytotoxic abilities and modulation of other immune cells, are vital in recognizing and killing cancer cells. However, hypoxic conditions in the tumor microenvironment have been found to impair NK cell functionality and contribute to tumor immune escape. Therefore, we aimed to uncover the mechanism through which hypoxia mediates the immune escape of pancreatic cancer cells, focusing on the influence of miR-1275/AXIN2 on NK cells. Using a combination of GEO dataset screening, Tumor Immune Estimation Resource 2.0 immunoscore screening, and the Cancer Genome Atlas data, we identified a correlation between miR-1275 and NK cells. The down-regulation of miR-1275 was associated with decreased NK cell activity and survival in patients with pancreatic cancer. Pathway analysis further linked miR-1275 expression with the hypoxic HIF1A pathway. In vitro experiments were conducted using the NK-92 cell, revealing that hypoxia significantly reduced miR-1275 expression and correspondingly decreased the cell-killing ability of NK cells. Upregulation of miR-1275 increased perforin, IFN-γ and TNF-α expression levels and enhanced NK cell cytotoxicity. Additionally, miR-1275 was found to bind to and inhibit AXIN2 expression, which when overexpressed, partially alleviated the promotive effect of upregulated miR-1275 on NK-92 cell killing ability. In conclusion, this research underscores the critical role of the miR-1275/AXIN2 axis in hypoxia-mediated immune escape in pancreatic cancer, thus opening new potential avenues for treatment strategies.

Fatigued driving is one of the main causes of road traffic accidents. In the process of fatigued driving detection, the evaluation based on a single sign is biased. To improve the adaptability and accuracy of fatigued driving detection, this paper proposes an improved D-S evidence theory-based algorithm for detecting facial fatigue signs. This algorithm uses the multi-thread-optimized Dlib to track and locate the image of the face, captures the 68 key points of the driver’s face with reference to the Dlib open-source library, and narrows the target areas to the eyes and mouth regions. Based on the video stream, it calculates the horizontal and vertical ratios of the eyes and mouth to determine the fatigue sign subsets based on the EAR and MAR within a unit cycle, and calculates the Pitch angle after converting the head pose from 2D images to 3D models, which is used for determining the status of the head pose. The algorithm then fuses multiple feature subsets and uses the improved D-S evidence theory to optimize the weights of the three subsets to mitigate the influence of the “general conflict” and “one veto” problems, and to increase the temporal correlation coefficient of a single fatigue sign. Experimental results show that the improved D-S face detection algorithm can effectively solve the problems of lighting and partial occlusion in complex environments, with an accuracy rate of 93.8% for detecting facial fatigue signs.

Homocysteine-inducible endoplasmic reticulum protein (HERP) is an endoplasmic reticulum (ER)-resident protein and important for the adaptation of cellular protein homeostasis by ER-associated degradation (ERAD) system. HERP interactors are critical for cellular viability and the reaction to ER stress. To explore the exact mechanisms by which HERP performed the biological functions, we conducted an interaction analysis of HERP protein in HeLa cells by co-immunoprecipitation (Co-IP) and liquid chromatography-mass spectrometer (LC-MS)/MS coupled with label-free quantification (LFQ). Among the interactome results, 123 proteins significantly interacted with HERP, which leads to numerous biological processes including protein import into nucleus, ubiquitin-dependent ERAD pathway, negative regulation of apoptotic process, and protein transport from ER, along with multiple pathways including several diseases, protein processing in ER, fatty acid metabolism, and steroid biosynthesis. Furthermore, we selected several prey proteins from the interactome data and confirmed that HERP interacted with ancient ubiquitous protein 1 (AUP1), Fas-associated factor family member 2 (FAF2), tripartite motif containing 47 (TRIM47), acyl-CoA synthetase long-chain family member 3 (ACSL3), sequestosome 1 (SQSTM1), and poly(rC) binding protein 2 (PCBP2) by Co-IP and confocal microscopy experiments, respectively. Moreover, the expression and location of several interacted proteins were obviously altered in response to ER stress induced by Thapsigargin stimulation and Enterovirus 71 infection. In conclusion, our findings revealed that the vital proteins interacted with HERP to mediate signaling transduction, thus providing novel clues for the mechanisms of HERP associated with ERAD and metabolism in response to ER stress under physiological and pathological conditions.

Highlights A strategy that combines multi-mode scanning probe microscopy-based electrical characterization and nano-infrared spectroscopy is developed. A series of samples with different coupling agents and nanoparticles are characterized to unveil the local structure-property correlation of the interface in ferroelectric polymer nanocomposites. The formation of hydrogen bond between the surface modifiers and the ferroelectric polymer enhances the β-phase content and reduces the domain size of the interface, and hence promotes the local piezoelectric effect and breakdown strength.

NLRP3 inflammasome mainly controls interleukin-1β (IL-1β) secretion, leading to cell death called pyroptosis constituting a major antiviral host defense and inflammatory diseases upon viral infection. The RAF-MEK1/2-ERK1/2 cascade and downstream c-Jun/Fos and Activator protein-1 (AP1) signaling pathway control the degree of inflammatory response. Influenza A virus (IAV) infection is known to stimulate NLRP3 inflammasome activation and inflammatory responses. Nevertheless, the detailed mechanism by which IAV induces NLRP3 inflammasome activation involved in transcription of pro-IL-1β mRNA remains elusive. In our study, we found that IAV infection promotes pro-IL-1β mRNA transcription and activates NLRP3 inflammasome. Detailed studies reveal that type I interferon (IFN-α/IFN-β) as well as U0126 (a selective inhibitor of MEK-1 and MEK-2) typically inhibit IAV-mediated NLRP3 inflammasome activation via downregulating pro-IL-1β mRNA. Moreover, knock-down of c-Jun decreases pro-IL-1β mRNA and inhibits NLRP3 inflammasome activation upon IAV infection. Overall, the findings uncover that AP-1 signaling pathway promotes NLRP3 inflammasome activation upon IAV infection, which provides a new idea for the therapy of NLRP3 inflammasome-associated inflammatory diseases.

This research was focused on innovative design of lattice metamaterials that can exhibit tunable double-negative mechanical properties and elastic isotropy simultaneously. A discrete topology optimization method using a multi-material ground structure was developed to create microlattices exhibiting both negative thermal expansion coefficient and negative Poisson’s ratio in a single integrated design, while maintaining elastic isotropy. First, the numerical homogenization method with beam elements was used to estimate the effective thermal and elastic properties of a microlattice. Second, the topological design, subject to required geometric constraints, was formulated as a mixed integer programming problem to discover a series of multi-material microlattices that present customized isotropic values of negative thermal expansion coefficient and negative Poisson’s ratio. Finally, several three-dimensional multi-material microstructures were produced by altering either the cross-sections or constituent materials of struts to demonstrate their tunable mechanical properties.