Search

BACKGROUND Type 1 diabetes (T1D) is a severe and prevalent metabolic disease. Due to its high heredity, an increasing number of genome-wide association studies have been performed, most of which were from hospital-based case-control studies with a relatively small sample size. The association of single nucleotide polymorphisms (SNPs) and T1D has been less studied and is less understood in natural cohorts. AIM To investigate the significant variants of T1D, which could be potential biomarkers for T1D prediction or even therapy. METHODS A genome-wide association study (GWAS) of adult T1D was performed in a nested case-control study (785 cases vs 804 controls) from a larger 5-year cohort study in Suzhou, China. Potential harmful or protective SNPs were evaluated for T1D. Subsequent expression and splicing quantitative trait loci (eQTL and sQTL) analyses were carried out to identify target genes modulated by these SNPs. RESULTS A harmful SNP for T1D, rs3117017 [odds ratio (OR) = 3.202, 95% confidence interval (CI): 2.296-4.466, P = 9.33 × 10-4] and three protective SNPs rs55846421 (0.113, 0.081-0.156, 1.76 × 10-9), rs75836320 (0.283, 0.205-0.392, 1.07 × 10-4), rs362071 (0.568, 0.495-0.651, 1.66 × 10-4) were identified. Twenty-two genes were further identified as potential candidates for T1D onset. CONCLUSION We identified a potential genetic basis of T1D, both protective and harmful, using a GWAS in a larger nested case-control study of a Chinese population.

PARK2, which encodes Parkin, is a disease-causing gene for both neurodegenerative disorders and cancer. Parkin can function as a neuroprotector that plays a crucial role in the regulation of mitophagy, and germline mutations in PARK2 are associated with Parkinson's disease (PD). Intriguingly, recent studies suggest that Parkin can also function as a tumor suppressor and that somatic and germline mutations in PARK2 are associated with various human cancers, including lung cancer. However, it is presently unknown how the tumor suppressor activity of Parkin is affected by these mutations and whether it is associated with mitophagy. Herein, we show that wild-type (WT) Parkin can rapidly translocate onto mitochondria following mitochondrial damage and that Parkin promotes mitophagic clearance of mitochondria in lung cancer cells. However, lung cancer-linked mutations inhibit the mitochondrial translocation and ubiquitin-associated activity of Parkin. Among all lung cancer-linked mutants that we tested, A46T Parkin failed to translocate onto mitochondria and could not recruit downstream mitophagic regulators, including optineurin (OPTN) and TFEB, whereas N254S and R275W Parkin displayed slower mitochondrial translocation than WT Parkin. Moreover, we found that deferiprone (DFP), an iron chelator that can induce mitophagy, greatly increased the death of A46T Parkin-expressing lung cancer cells. Taken together, our results reveal a novel mitophagic mechanism in lung cancer, suggesting that lung cancer-linked mutations in PARK2 are associated with impaired mitophagy and identifying DFP as a novel therapeutic agent for PARK2-linked lung cancer and possibly other types of cancers driven by mitophagic dysregulation.

The cellular protein degradation system, such as proteasomal or autophagy-lysosomal system plays an important role in the pathogenesis of a variety of human diseases including cancer. Transcription factor EB (TFEB) is a master transcriptional factor in the regulation of autophagy-lysosome pathway (ALP), and it has multiple biological functions including protein degradation, cell homeostasis and cell survival. In the present study we show that the tumor suppressor p53 can regulate TFEB nuclear translocation and activity in lung cancer cells. We found p53 deletion or chemical inhibition of p53 using pifithrin-α could promote the translocation of TFEB from cytoplasm to the nucleus, thus increased the TFEB-mediated lysosomal and autophagosomal biogenesis in lung cancer cells. Moreover, re-expression of p53 could decrease the expression levels of TFEB-targeting genes involved in ALP, and knockdown of TFEB could abolish the effect of p53 on the regulation of ALP gene expression. Taken together, our data indicate that p53 affects ALP through regulating TFEB nuclear translocation in lung cancer cells. Importantly, our study reveals a critical link between two keys factors in tumourigenesis and autophagy, and suggests a potential important role of p53-TFEB signaling axis in lung cancer.

The neuroprotective effects of estrogen against cerebral ischaemia have been confirmed by multiple basic and clinical studies. However, most of these studies used exogenous estrogen administered via different injection methods, and the neuroprotective effects of endogenous estrogen produced by ovaries during different phases of estrous cycle and the underlying mechanisms involved have rarely been explored. In this study, we first identified the stage of estrous cycle via vaginal smears and then measured serum estradiol levels at each phase via radioimmunoassay. We found that the estradiol level was highest in the proestrous and lowest in the diestrous. However, ovariectomy or treatment with the aromatase inhibitor letrozole significantly decreased estradiol levels compared to that of rats in diestrous. Western blotting showed that ovariectomy or letrozole treatment significantly decreased ERα and Bcl-2 protein expression and dramatically increased Bax protein expression compared with the rats in diestrous or proestrous. Rats also underwent 2h of ischaemia via middle cerebral artery occlusion followed by a 24-h reperfusion. Ovariectomy or letrozole treatment significantly decreased the neurological scores and the number of intact neurons detected via Nissl staining and dramatically increased the infarct volume detected via TTC staining and the extent of apoptosis detected via TUNEL staining and Western blotting for cleaved-caspase 3 protein expression. These results demonstrate that endogenous estrogen alleviates ischaemia-reperfusion injury by maintaining Bcl-2 expression via ERα signalling pathway and highlight the neuroprotective effects of endogenous estrogen during different stages of the estrous cycle, providing preliminary information on the underlying mechanism of this process.

Several previous meta-analyses show a consistent inverse association between nut consumption and all-cause mortality, but the associations with cause-specific mortality remain uncertain. A recent meta-analysis on nut consumption and multiple health outcomes combined incidence and mortality outcomes across most of the analyses, which may have introduced heterogeneity across studies. We conducted an updated meta-analysis to evaluate the nut-mortality association. We searched PubMed and EMBASE and we contacted authors for additional data. The final analyses included 18 prospective studies. The random-effects summary RRs for high compared with low nut consumption were 0.81 (95% CI: 0.78–0.84) for all-cause mortality (18 studies with 81 034 deaths), 0.75 (95% CI: 0.71–0.79) for CVD mortality (17 studies with 20 381 deaths), 0.73 (95% CI: 0.67–0.80) for CHD mortality (14 studies with 10 438 deaths), 0.82 (95% CI: 0.73–0.91) for stroke mortality (13 studies with 4850 deaths) and 0.87 (95% CI: 0.80–0.93) for cancer mortality (11 studies 21 353 deaths). These results were broadly consistent within subgroups according to various study and population characteristics and within sensitivity analyses that took into account potential confounders. Peanut (5 studies) and tree nut (3 studies) consumption were similarly associated with mortality risks. Dose–response analyses suggested evidence for nonlinear associations between nut consumption and mortality (P-nonlinearity

Background: Diabetic retinopathy (DR) is one of the most prominent pathological microvascular complications in diabetes. A series of studies reported that vitamin D deficiency was associated with increased prevalence of retinopathy in diabetic patients but the results were inconsistent. In this study we focused on evaluating the relationship between vitamin D deficiency and DR by conducting a meta-analysis of observational studies. Methods: Systematic computerized searches were performed in PubMed, MEDLINE, and the Cochrane Library for relevant original articles till November 20, 2016. The pooled odds ratios (ORs) with corresponding confidence intervals (CIs) were calculated to assess the associated value of vitamin D deficiency to the risk of DR. 9 studies including 6332 participants were subjected to final analysis. Results: The results indicated that vitamin D deficiency increases the risk of DR (OR = 1.57, 95% CI 1.32-1.87) with a little heterogeneity (I2 = 23%). In addition, the subgroup analysis demonstrated that there were obvious heterogeneities in T2DM (I2 = 47.8%). Sensitivity analysis showed that the results were relatively stable and reliable. Conclusion: our meta-analysis demonstrated that vitamin D deficiency could increase the risk of DR.

Iron overload is widely regarded as a risk factor for osteoporosis. It has been demonstrated that iron can inhibit osteoblast differentiation. However, the effects of iron on osteoclast differentiation and bone resorption remain controversial. In this study, we found that ferric ion promoted Receptor Activator of Nuclear Factor κ B Ligand (RANKL)-induced osteoclast (OC) formation in both RAW264.7 cells and bone marrow-derived macrophages (BMMs), and this effect was accompanied by elevated levels of reactive oxygen species (ROS) and oxidative stress. Moreover, this effect was attenuated by the administration of antioxidant N-acetyl-L-cysteine (NAC). Therefore, we conclude that ferric ion can promote osteoclast differentiation and bone resorption through the production of ROS.

The neuroprotective effects of estrogen in neurodegenerative diseases, such as Alzheimer’s disease, cerebral ischemia and Parkinson’s disease, are well documented and involve stimulating neurogenesis. However, the dosage and timing of estrogen treatment is controversial, and the underlying mechanism remains unclear. In this study, we tested the effects of various estrogen doses on the proliferation and differentiation of NSCs. First, we identified estrogen receptor α, β and GPR30 were highly expressed in NSCs. The results from a cell cycle analysis detected by flow cytometry revealed that 10 nM 17β-estradiol (E2) treatments for 3 days significantly increased the proliferation of neural stem cells (NSCs) and the expression level of p-ERK1/2, whereas 50 nM E2 exposures markedly decreased the proliferation of NSCs and the expression level of p-ERK1/2. According to immunofluorescence staining and Western blot analyses, 10 nM E2 treatment for 7 days stimulated NSCs to differentiate into neurons and inhibited their differentiation into astrocytes. These results demonstrate NSCs is definitely the target of estrogen and that an appropriate dose of E2 (10 nM) can significantly increase the proliferation of NSCs and significantly stimulate NSCs to differentiate into neurons, which supports the neuroprotective role of estrogen in neurodegenerative diseases.

Genetic factors contribute to the variation of bone mineral density (BMD), which is a major risk factor of osteoporosis. The aim of this study was to identify more "novel" genes for BMD. Based on the publicly available SNP-based P values, we performed an initial gene-based analysis in a total of 32,961 individuals. Furthermore, we performed differential expression, pathway and protein-protein interaction analyses to find supplementary evidence to support the significance of the identified genes. About 21,695 genes for femoral neck (FN)-BMD and 21,683 genes for lumbar spine (LS)-BMD were analyzed using gene-based association analysis. A total of 35 FN-BMD associated genes and 53 LS-BMD associated genes were identified (P < 2.3×10(-6)) after Bonferroni correction. Among them, 64 genes have not been reported in previous SNP-based genome-wide association studies. Differential expression analysis further supported the significant associations of 14 genes with FN-BMD and 19 genes with LS-BMD. Especially, WNT3 and WNT9B in the Wnt signaling pathway for FN-BMD were further supported by pathway analysis and protein-protein interaction analysis. The present study took the advantage of gene-based association method to perform a supplementary analysis of the GWAS dataset and found some BMD-associated genes. The evidence taken together supported the importance of Wnt signaling pathway genes in determining osteoporosis. Our findings provided more insights into the genetic basis of osteoporosis.

To explore the expression of soluble programmed death ligand-1 on lung cancer cells and to clarify its biological function through PD-1/PD-L1 pathway in regulating the function of T lymphocytes.Labeled monoclonal antibody and flow cytometry were used to analyze the expression of PD-L1 and its receptor PD-l on lung cancer cells and human T lymphocytes, respectively. The level of sPD-L1 in the supernatant of lung cancer cells was determined with an ELISA kit. The inhibition of proliferation of T lymphocytes by mPD-L1 and sPD-L1 was studied using CCK-8 incorporation.Low or no expression [(16.08 ± 2.28)%] of PD-1 was found on resting T lymphocytes from human peripheral blood with flow cytometry, but up-regulated expression of PD-1 [(78.06 ± 7.21)%] was found on the surface of activated T lymphocytes. Soluble PD-L1 was found in supernatant of some lung cancer cell lines, such as H1299, HO8910, SPCA-1, H460, H446 cells, with PD-L1 expressing on their cell surface [(78.34 ± 10.25)%, (68.17 ± 11.56)%, (45.32 ± 7.98)%, (47.52 ± 9.62)% and (40.95 ± 8.56)%, respectively], but very low expression on A549 cells [(16.02 ± 6.28)%]. The level of mPD-L1 on H1299 cells was highest [(78.34 ± 10.25)%], compared with HO8910 cells (68.17 ± 11.56)%, SPCA-1 cells (45.32 ± 7.98)%, H446 cells (40.95 ± 8.56)%, and H460 cells (47.52 ± 9.62)%. At the same time, the sPD-L1 level on H1299 cells was low [(0.17 ± 0.01) ng/ml], compared with HO8910 cells (0.30 ± 0.03) ng/ml, SPCA-1cells (0.59 ± 0.03) ng/ml, H446 cells (0.34 ± 0.02) ng/ml, and H460 cells (0.57 ± 0.03) ng/ml, but not expressed on A549 cells. PD-L1 expressing H1299 cells inhibited the proliferation of T lymphocytes in the co-culture system. Supernatant of the cultured PD-L1(+) lung cancer cells also inhibited T cell proliferation. Anti-human PD-L1 blocking antibody could partly restore the proliferation capacity of T lymphocytes.Membrane-bound PD-L1 and soluble PD-L1 released from lung cancer cells can effectively inhibit the proliferation of T lymphocytes in mixed culture system and down-regulate cell-mediated immunity in vitro. This may lead to inactivation of tumor antigen-specific T cells and immune escape of lung cancer cells.

Objective.Extensive association analyses including genome-wide association studies (GWAS) and powerful metaanalysis studies have identified a long list of loci associated with rheumatoid arthritis (RA) in very large populations, but most of them established statistical associations of genetic markers and RA only at the DNA level, without supporting evidence of functional relevance. Our study serves as a trial to detect the functional mechanisms underlying associations for RA by searching publicly available datasets and results.Methods.Based on publicly available datasets and results, we performed integrative analyses (gene relationships across implicated loci analysis, differential gene expression analysis, and functional annotation clustering analysis) and combined them with the expression quantitative trait locus (eQTL) results to dissect functional mechanisms underlying the associations for RA.Results.By searching 2 GWAS, Integrator and PheGenI, we selected 98 RA association results (p < 10−5). Among these associations, we found that 8 single-nucleotide polymorphisms (SNP; rs1600249, rs2736340, rs3093023, rs3093024, rs4810485, rs615672, rs660895, and rs9272219) serve as cis-effect regulators of the corresponding eQTL genes (BLK and CD4 in non-HLA region; CCR6, HLA-DQA1, and HLA-DQB1 in HLA region) that also were differentially expressed in RA-related cell groups. These 5 genes are closely related with immune response in function.Conclusion.Our results showed the functional mechanisms underlying the associations of 8 SNP and the corresponding genes. This study is an example of mining publicly available datasets and results in validation of significant disease-association results. Using public data resources for integrative analyses may provide insights into the molecular genetic mechanisms underlying human diseases.

To explore the effects of ferric ion on the differentiation from both RAW264.7 and bone marrow macrophages to osteoclast in vitro and bone resorption in vivo.In the presence of 50 ng/ml receptor activator of nuclear factor kappa-B ligand (RANKL), RAW264.7 was treated with ferric ammonium citrate (FAC). The formation of osteoclast was observed by staining of tartrate-resistant acid phosphatase (TRAP) and the TRAP positive cell counted. The expression levels of TRAP, cathepsin-K, nuclear factor of activated T cells c1 (NFATc1) and (receptor activator of NF-κB) RANK were measured by reverse transcription-polymerase chain reaction (RT-PCR).The control and iron overload groups were established by the intraperitoneal injection of normal saline and FAC. In vivo imaging system was employed to determine the bone density of femoral midportion and the fourth lumbar vertebra. After that, the bone marrow cells of femurs were used for osteoclast culture. The serum levels of ferritin, TRAP-5b, RANKL, osteoprotegerin (OPG) and C-terminal cross-linking telopeptide (CTX) were measured by enzyme-linked immunosorbent assay (ELISA).Ferric ion could stimulate the formation of TRAP positive cells in a dose-dependent manner. The expression levels of TRAP, cathepsin-K and NFATc1 in the FAC treated group were significantly higher those of the control group (P0.05) while the expression of RANK showed no statistical difference among these groups (P = 0.967). The bone marrow density of femoral midportion and the fourth lumbar vertebra of the iron-overload group decreased significantly versus the control group. The concentrations of ferritin, TRAP-5b, RANKL and CTX of the iron overload group were markedly higher than those of the control group (P0.05). Moreover, the concentration of ferritin showed a positive correlation with TRAP-5b and CTX respectively in the iron-overload group (r = 0.65, r = 0.76, P0.05). But no significant differences existed in the concentration of OPG for two groups (P0.05).Ferric ion may enhance the differentiation of osteoclast in vitro as well as bone resorption in vivo.

Carvacrol (CAR), a naturally occurring monoterpenic phenol and food additive, has been shown to have antimicrobials, antitumor, and antidepressant-like activities. A previous study demonstrated that CAR has the ability to protect liver against ischemia/reperfusion injury in rats. In this study, we investigated the protective effects of CAR on cerebral ischemia/reperfusion injury in a middle cerebral artery occlusion mouse model. We found that CAR (50 mg/kg) significantly reduced infarct volume and improved neurological deficits after 75 min of ischemia and 24 h of reperfusion. This neuroprotection was in a dose-dependent manner. Post-treatment with CAR still provided protection on infarct volume when it was administered intraperitoneally at 2 h after reperfusion; however, intracerebroventricular post-treatment reduced infarct volume even when the mice were treated with CAR at 6 h after reperfusion. These findings indicated that CAR has an extended therapeutic window, but delivery strategies may affect the protective effects of CAR. Further, we found that CAR significantly decreased the level of cleaved caspase-3, a marker of apoptosis, suggesting the anti-apoptotic activity of CAR. Finally, our data indicated that CAR treatment increased the level of phosphorylated Akt and the neuroprotection of CAR was reversed by a PI3K inhibitor LY-294002, demonstrating the involvement of the PI3K/Akt pathway in the anti-apoptotic mechanisms of CAR. Due to its safety and wide use in the food industry, CAR is a promising agent to be translated into clinical trials.

Iron overload is widely regarded as a risk factor for osteoporosis. It has been demonstrated that iron can inhibit osteoblast differentiation. However, the effects of iron on osteoclast differentiation and bone resorption remain controversial. In this study, we found that ferric ion promoted Receptor Activator of Nuclear Factor κ B Ligand (RANKL)-induced osteoclast (OC) formation in both RAW264.7 cells and bone marrow-derived macrophages (BMMs), and this effect was accompanied by elevated levels of reactive oxygen species (ROS) and oxidative stress. Moreover, this effect was attenuated by the administration of antioxidant N-acetyl-L-cysteine (NAC). Therefore, we conclude that ferric ion can promote osteoclast differentiation and bone resorption through the production of ROS.

To investigate the effects of 1 alpha hydroxylase and serum calcium on the expression of 24-hydroxylase gene in mice kidney.Mice with targeted deletion of the 25-hydroxyvitamin D 1 alpha hydroxylase gene(1alpha (OH)ase-/-), and the vitamin D receptor gene (VDR-/-) were used. The study of each mutant had two groups which were (1) mutant with high calcium diet, which maintained fertility but left mice hypocalcaemia; (2) mutant with high lactose diet, which normalized calcium in two mutant. Mice in same litter were as control. There were six groups in total and each group had five mice. All mice were killed at 10-week-old. Serum calcium was determined by an autoanalyzer. RNA was isolated from mouse kidney and the express of 1 alpha hydroxylase gene and 24-Hydroxylase gene were studied by RT-PCR.On the high calcium intake, all mutant animals were hypocalcaemia (1alpha (OH)ase-/- (78 +/- 10.4) mg/L, P0.05; VDR-/- (68 +/- 9.8) mg/L, P0.05. WT (111 +/- 16.5 mg/L), but when the high lactose diet was administered, serum calcium levels in two mutant mice rose to wild-type levels. The 1 alpha hydroxylase gene was expressed at very higher levels in the vitamin D receptor mutant mice than in wild-type mice when animals received a high calcium intake; This was reduced by eliminating hypocalcaemia with the high lactose diet. Expression of the 24(OH)ase gene was extremely down-regulated in two mutant mice on the high calcium diet but was restored to wild-type levels on the high lactose diet.The express of 24-hydroxylase gene was directly regulated by serum calcium rather than 1 alpha-hydroxylase. These studies indicate that both the serum calcium and 1 alpha-hydroxylase exert effects on the expression of 24-hydroxylase gene, but 1 alpha-hydroxylase take the effects by elevated the concentration of serum calcium. There are no direct interaction between 1 alpha-hydroxylase gene and 24-hydroxylase gene.

To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells.PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy.The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference.Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

To study the polymorphisms of DNA repair gene XRCC3 and the relationship between genetic variations and susceptibility to lung cancer.A case-control study of 291 patients with lung cancer and 273 cancer-free subjects as a control group was conducted from September 2006 to January 2007 to detect XRCC3 polymorphisms at loci. Genotypes of XRCC3 were analyzed by real time PCR using Taqman probes.Compared with never smoking subjects with wild homozygous genotype (Thr/Thr), smokers with the same genotytpe (Thr/Thr) had increased risk of lung cancer, adjusted odds ratio (OR) was 2.467 (95% CI: 1.49 - 4.08, P0.001). Smokers with the heterozygous genotype (Thr/Met) also had increased risk of lung cancer, adjusted OR was 2.283 (95% CI: 1.21 - 6.60, P0.05). XRCC3 codon 241 homozygous genotype (Thr/Thr) and pack-years of smoking less than 30 had a weak protective effect on adenocarcinoma (OR = 0.49, 95% CI: 0.26 - 0.93, P0.05). Allel Met of XRCC3 codon 241 and smoking conferred an increased risk of squamous cell carcinoma (OR = 9.69, 95% CI: 3.27 - 28.72, P0.01). Those with allel Met of XRCC3 codon 241 and pack-years of smoking less than 30 or more than 30 had different risk of squamous cell carcinoma, the OR was 8.00 (95% CI: 1.97 - 32.52, P0.01), and 11.67 (95% CI: 2.98 - 45.73, P0.01) respectively.The results demonstrated that genetic polymorphism of XRCC3 DNA repair gene may contribute to the susceptibility to lung cancer and have synergistic effect with smoking.

It is well known that estrogen can inhibit bone absorption, decrease bone turnover and preserve bone mass. Some studies indicated that the effect of estrogen on calcium and bone is relative to vitamin D system, while others also reported that this effect of estrogen is independent of vitamin D. The genomic effect of 1alpha, 25(OH)(2)D(3)is mediated by the nuclear vitamin D receptor (VDR) in a ligand-dependent manner. Hypocalcemia, hyperparathyroidism and osteomalacia are developed in VDR gene knockout mice. To determine whether the effect of estrogen on calcium and bone is dependent on VDR, this study examined the effect of exogenous estrogen on calcium and bone homeostasis in VDR gene knockout mice. Male and female wild type (WT) and VDR gene knockout heterozygous mice were mated each other and the genotyping of their offsprings were determined by PCR. At age of 21-day, WT and knockout mice were weaned and treated by one of three different regimens: (1) WT-vehicle group: the WT mice were injected with normal saline; (2) VDR KO-vehicle group: the VDR gene knockout mice were injected with normal saline; (3) VDR KO-E group: the VDR gene knockout mice were subcutaneously injected with estradiol, 0.2 mug per mouse, once daily for 1 month. The bone mineral density (BMD) of mice was measured using dual-energy X-ray absorptiometry. All mice were sacrificed at age of 50-day. Blood was taken by heart puncture under anesthesia and serum calcium was measured by autoanalyser.Tibiae were removed, fixed and embedded with the methylmethacrylate (MMA), and undecalcified sections were cut. These sections were stained for mineral with the von Kossa staining procedure and counterstained with toluidine blue. Static histomorphometric analyses were performed on those stained sections. The results showed that the serum calcium level was (2.10+/-0.37) mmol/L in the VDR KO-vehicle mice and rose to (2.80+/-0.41) mmol/L in the VDR KO-E mice although it was still lower than WT-vehicle mice [(3.10+/-0.48) mmol/L]. BMD and mineralized trabeculer volume were increased significantly in VDR KO-E group compared with that in VDR KO-vehicle group. These results suggest that exogenous estrogen can improve calcium absorption and skeletal mineralization in a VDR-independent manner.

The polymorphism of mtDNA D-loop of 83 individuals from 9 Chinese indigenous sheep breeds and 2 imported sheep breeds were studied with 5 endonucleases, Hinf I, Msp I, Sau3A I, Xsp I and Taq I, using PCR-RFLP. The results indicated that there existed two basic haplotypes in the region of mtDNA D-loop. It could be inferred that Chinese indigenous sheep breeds originated from two maternal ancestors. The averaged polymorphic degree (Pi value=0.0421%) of mtDNA D-loop showed that the genetic diversity of mtDNA of Chinese indigenous sheep breeds was very poor.

The gentic structure and relationship of Boer goat and its upgrading offspring to Tangshan Dairy goat were studied using the RAPD maker and some statistical program, such as POPGENE, PHYLIP and SPSS. The results indicated that there were the similar percentage of polymorphic loci, observed and effective number of alleles, gene diversity between Boer goat and its upgrading offspring, especially higher upgrading offspring. With the increasing of upgrading, the difference of population structure decreased as well as the genetic distance and differentiation among higher upgrading offspring and their improving parental, but gene flow and genetic identity increased. There was a close genetic relationship between higher upgrading offspring and Boer goat.