Search

Reza Zamiri1, B Z Azmi1,2, Amir Reza Sadrolhosseini1, Hossein Abbastabar Ahangar3, A W Zaidan1, M A Mahdi41Department of Physics, 2Advanced Materials and Nanotechnology Laboratory, 3Department of Chemistry, 4Wireless and Photonics Networks Research Center, Universiti Putra Malaysia, Serdang, Selangor, MalaysiaAbstract: Laser ablation of a silver plate immersed in virgin coconut oil was carried out for fabrication of silver nanoparticles. A Nd:YAG laser at wavelengths of 1064 nm was used for ablation of the plate at different times. The virgin coconut oil allowed formation of nanoparticles with well-dispersed, uniform particle diameters that were stable for a reasonable length of time. The particle sizes and volume fraction of nanoparticles inside the solutions obtained at 15, 30, 45 min ablation times were 4.84, 5.18, 6.33 nm and 1.0 × 10-8, 1.6 × 10-8, 2.4 × 10-8, respectively. The presented method for preparation of silver nanoparticles in virgin coconut oil is environmentally friendly and may be considered a green method.Keywords: silver nanoparticles, laser ablation, virgin coconut oil

The article discusses a study evaluating the efficacy of clonazepam which helped in reducing anxiety prior to oral surgery and a survey revealed that patients were given 2mg dose of clonazepam or a placebo one hour prior to surgery which helped them reduced the anxiety of the participants. Therefore the results proved that clonazepam was an effective anxiolytic drug which reduced anxiety in dental patients.

The article presents a study which examines the potential risk factors correlated with increasing length of hospital stay among patients with deep head and neck spaces infections of odontogenic origin. The study investigates 297 patients with head and neck spaces infection who were admitted to Shiraz Khalili hospital through a medical chart review. The study concludes that the odontogenic infections were a common risk of deep head and neck spaces infection resulting to longer hospital stay.

The article presents a case study of a 19-year-old male who suffered rapid onset gingival swelling of the right side of both jaws and looseness of the right upper molar teeth for 20 days. The patients' clinical examinations which include a panoramic radiograph, biopsies of the affected bone and soft tissue lesion, and axial computed tomography (CT) scan led to the diagnosis of chronic inflammation of the alveolar bone.

The article presents a study which investigates the changes in the overall soft palate dimensions after treating the patients with class III skeletal deformity using various surgical procedures such mandibular setback, maxillary advancement, and bimaxillary surgery. The study uses analysis of variance (ANOVA) test to evaluate the mean differences of the dependent variables among patients. Results show that the morphology of the soft palate and its position changed after the class III surgeries.

Objectives: The technique of MRI, using powerful magnets, plays an important role in the diagnosis of diseases of the head and neck without any ionizing radiation. Because of the potential hazard imposed by the presence of ferromagnetic metals, patients with implanted metallic objects are excluded from MRI. However, amalgam restorations seem to be safe. The purpose of this study was to evaluate microleakage of amalgam restorations following MRI. Methods: 63 human freshly extracted premolars were divided into 3 groups based on 3 high-copper amalgams used to restore standard class V preparations on both buccal and lingual surfaces. Three different amalgam materials were used: Cinalux, GS-80 and Vivacap. The teeth were transferred into saline solution for 2 months at room temperature and then sectioned mesiodistally. MRI was randomly applied to one half of each section, and the other half was kept as a control. Following MRI, all specimens were immersed in a dye solution, sectioned and scored for any microleakage using a stereomicroscope. Results: Differences in microleakage within each group following MRI were significant in the GS-80 and Vivacap groups but not in the Cinalux group. However, there was no significant difference between the three groups regarding the microleakage score. Conclusions: The results of this study suggest that MRI is not a completely safe technique in patients with amalgam restorations. It was shown that the main effect of fields led to the appearance of thermoelectromagnetic convection, which is responsible for the enhancement of the diffusion process, grain boundary migration and vacancy formation resulting in microleakage. [ABSTRACT FROM AUTHOR]

Objectives: Dental pulp stem cells (DPSCs) were shown to play an important role in regenerative medicine including reconstruction of various bone lesions. This study determined the impact of acemannan, an extracted product from Aloe vera , on in vitro proliferation of DPSCs and in vivo healing of mandibular defects in rabbits., Methods: DPSCs were isolated and characterized. The growth kinetics of cells exposed to acemannan (8 mg/mL) and Hank's balanced salt solution (HBSS) were compared in vitro . Fifteen male rabbits were divided into 3 groups. Five animals were left as control group without any therapeutic intervention. Five rabbits were considered as experimental group 1 and received 20 µL of a cell suspension containing 10 6 DPSCs in the bone defect. Another 5 rabbits were regarded as experimental group 2 and were injected in the bone defect with 20 µL of a cell suspension containing 10 6 DPSCs treated with acemannan for 24 h. After 60 days, the animals were assessed by radiography and histologically., Results: The mesenchymal properties of DPSCs were confirmed. Population doubling time (PDT) of DPSCs treated with acemannan (29.8 h) was significantly shorter than cells were just exposed to HBSS (45.9 h). DPSCs together with acemannan could significantly accelerate the healing process and osteogenesis in mandibular defects., Conclusions: As DPSCS showed an increased proliferation when treated with acemannan and accelerated the healing process in mandibular defects, these findings can open a new avenue in dentistry regenerative medicine when remedies of bone defects are targeted., Competing Interests: None., (AJSC Copyright © 2024.)

Biallelic expansions of various tandem repeat sequence motifs are possible in RFC1 (replication factor C subunit 1), encoding the DNA replication/repair protein RFC1, yet only certain repeat motifs cause cerebellar ataxia, neuropathy, and vestibular areflexia syndrome (CANVAS). CANVAS presents enigmatic puzzles: The pathogenic path for CANVAS neither is known nor is it understood why some, but not all expanded, motifs are pathogenic. The most common pathogenic repeat is (AAGGG)n•(CCCTT)n, whereas (AAAAG)n•(CTTTT)n is the most common nonpathogenic motif. While both intronic motifs can be expanded and transcribed, only r(AAGGG)n is retained in the mutant RFC1 transcript. We show that only the pathogenic forms unusual nucleic acid structures. Specifically, DNA and RNA of the pathogenic d(AAGGG)4 and r(AAGGG)4 form G-quadruplexes in potassium solution. Nonpathogenic repeats did not form G-quadruplexes. Triple-stranded structures are formed by the pathogenic motifs but not by the nonpathogenic motifs. G- and C-richness of the pathogenic strands favor formation of G•G•G•G-tetrads and protonated C+-G Hoogsteen base pairings, involved in quadruplex and triplex structures, respectively, stabilized by increased hydrogen bonds and pi-stacking interactions relative to A-T Hoogsteen pairs that could form by the nonpathogenic motif. The ligand, TMPyP4, binds the pathogenic quadruplexes. Formation of quadruplexes and triplexes by pathogenic repeats supports toxic-DNA and toxic-RNA modes of pathogenesis at the RFC1 gene and the RFC1 transcript. Our findings with short repeats provide insights into the disease specificity of pathogenic repeat motif sequences and reveal nucleic acid structural features that may be pathogenically involved and targeted therapeutically., Competing Interests: Conflict of interest The authors declare that they have no conflicts of interest with the contents of this article., (Crown Copyright © 2023. Published by Elsevier Inc. All rights reserved.)

Background: Besides the lungs, coronavirus disease 2019 (COVID-19) can affect the cardiovascular, digestive, urinary, hepatic, and central nervous systems. Other than its short-term effects, COVID-19 may also cause long-term complications. In this study, we assessed long-term COVID-19 cardiovascular symptoms among patients in a cardiovascular clinic., Method: A retrospective cohort was conducted between October 2020 to May 2021 on patients at an outpatient cardiovascular clinic in Shiraz, Iran. Patients with a history of COVID-19 at least one year before their referral were included. Baseline information was extracted from the clinic's database. Data were collected regarding symptoms like dyspnea, chest pain, fatigue, and palpitations after a year of COVID-19. We also noted any major adverse cardiac events (MACE)., Results: Most common symptoms after a year of COVID-19 were exertional dyspnea (51.2%), dyspnea at rest (41.6%), fatigue (39%), and chest pain (27.1%). The symptoms were more prevalent in hospitalized patients than in non-hospitalized patients. The prevalence of MACE was about 6.1% during the 12-month follow-up, with this rate being higher in those with a history of hospitalization or comorbid diseases., Conclusion: The prevalence of cardiovascular symptoms was fairly high in patients at our clinic a year after COVID-19, and the most common symptom was dyspnea. Hospitalized patients had more MACE. (Clinicaltrial.gov number: NCT05715879)(04/02/2023)., (© 2023. The Author(s).)

Objective: We searched for, from the FDA (Food and Drug Administration-USA)-approved drugs, inhibitors of FKBP5 with tolerable adverse effect profiles (eg, mild headache, sedation, etc.) and with the ability to cross the blood brain barrier (BBB), using bio-informatics tools (in-silico). This may pave the road for designing clinical trials of such drugs in patients with functional seizures (FS) and other stress-associated disorders., Methods: Several databases were used to find all the approved drugs that potentially have interactions with FKBP51 protein [ie, CTD gene-chemical interaction section of FKBP51 protein of Harmonizome of Mayaanlab, DrugCenteral database, PDID (Protein Drug Interaction Database), DGIdb (the Drug Gene Interaction database)]. Other databases were also searched [eg, clinicaltrials.gov; DRUGBANK (the FASTA format of the FKBP51 protein was imported to the target sequencing section of the database to find the associated drugs), and the STITCH database (to find the related chemical interaction molecules)]., Results: After a comprehensive search of the designated databases, 28 unique and approved drugs were identified. Fluticasone propionate and Mifepristone and Ponatinib, Mirtazapine, Clozapine, Enzalutamide, Sertraline, Prednisolone, Fluoxetine, Dexamethasone, Clomipramine, Duloxetine, Citalopram, Chlorpromazine, Nefazodone, and Escitalopram are inhibitors of FKBP5 and have BBB permeability., Significance: While the current in-silico repurposing study could identify potential drugs (that are already approved and are widely available) for designing clinical trials in patients with stress-associated disorders (eg, FS), any future clinical trial should consider the pharmacological profile of the desired drug and also the characteristics and comorbidities of the patients in order to foster a success., (© 2023 The Authors. Epilepsia Open published by Wiley Periodicals LLC on behalf of International League Against Epilepsy.)

Introduction: Nowadays, the catalysts' usage in chemical reactions is unavoidable, and this has led scientists to look for producing and using catalysts which not only cause pollution and toxicity in the reactions and products, but also generate economical benefits., Aims: Our goal in this paper is to produce a fully biocompatible, non-toxic and inexpensive carbocatalyst with a graphene oxide structure for use in multi-component reactions as a heterogeneous catalyst., Methods: The research has been carried out to simplify the method of preparing carbocatalysts. In this article, we heated citric acid and thiourea in the simple bottom-up method in which nitrogen and sulfur were atomically inserted into a carbon-carbon bond of graphene oxide., Results: The results have been obtained by comparing graphene oxide quantum dots (GOQDs) and functional graphene oxide quantum dots (GOQDs) and functional nitrogen and sulfur-doped graphene oxide quantum dots (NS-doped-GOQDS) using the produced carbocatalyst in the synthesis of spiro indoline pyrano pyrazoles and highly substituted pyridine derivatives with chemical and pharmacological properties., Conclusion: A simple and affordable bottom-up method has been developed to synthesize fluorescent NS-doped-GOQDS by the condensation of CA in the presence of thiourea with water elimination at 185 ℃. After the production of NS-doped-GOQDS, the carbocatalyst is used in the synthesis of spiro[indoline-3,4'-pyrano [2, 3-c]pyrazole] derivatives in four-component reactions and pyridine derivatives in five-component reactions., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.net.)

Background: Although statins decrease mortality in coronary artery disease, the effect of high-dose statins and duration of therapy post-percutaneous coronary intervention (PCI) is not well addressed. Aim: To determine the effective dose of statin to prevent major adverse cardiovascular events (MACEs), such as acute coronary syndrome, stroke, myocardial infarction, revascularisation and cardiac death, after PCI in patients with chronic coronary syndrome. Methods: In this randomised, double-blind clinical trial, all chronic coronary syndrome patients with a recent history of PCI were randomly divided into two groups after 1 month of high-dose rosuvastatin therapy. Over the next year, the first group received rosuvastatin 5 mg daily (moderate intensity), while the second received rosuvastatin 40 mg daily (high intensity). Participants were evaluated in terms of high-sensitivity C-reactive protein and MACEs. Results: The 582 eligible patients were divided into group 1 (n=295) and group 2 (n=287). There was no significant difference between the two groups in terms of sex, age, hypertension, diabetes, smoking, previous history of PCI or history of coronary artery bypass grafting (p>0.05). There were no statistically significant differences in MACE and high-sensitivity C-reactive protein after 1 year between the two groups (p=0.66). Conclusion: The high-dose group had lower LDL levels. However, given the lack of association between high-intensity statins and MACEs in the first year after PCI among chronic coronary syndrome patients, the use of moderate-intensity statins may be as effective as high-intensity statins, and treatment based on LDL targets may suffice., Competing Interests: Disclosure: The authors have no conflicts of interest to declare. Informed Consent to Participate and Publish: All participants have given written informed consent. Data availability: The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethics: This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Shiraz University of Medical Sciences (IR.SUMS.MED.REC.1398.620) Clinical trial registration: https://trials.gov registration: NCT04923152 Funding: This study was funded by the Faculty of Research of Shiraz University of Medical Sciences. Authors’ contributions: Conceptualisation: JK; data Curation: MC, RGV, MHR, MMP, AA, BZ, RH, MM; formal analysis: MC, JK; funding acquisition: JK, MC; investigation: JK, MC, RGV, MMP, AA, BZ, RH, MM; methodology: RH, JK; project administration: JK, MHR; resources: JK, MC; software: MHR, RGV; supervision: MHR, JK, RGV, MC; validation: JK, RGV, SAH; visualisation: JK, SAH; writing – organisation draft preparation: MC, SAH, JK; writing – review and editing: MC, SAH, JK., (Copyright © 2022, Radcliffe Cardiology.)

Background: Dyslipidemia is a prominent cause of cardiovascular disease as it leads to inflammation and plaque deposition within arteries. Treatment includes lifestyle modifications and lipid-lowering medications. We aimed to assess the therapeutic effects of red yeast rice (RYR) alongside statin therapy., Methods: This triple-blind randomized clinical trial involved 92 dyslipidemia patients and was performed in 2019. Standard laboratory tests were used to assess the serum LDL cholesterol (LDL-C), HDL cholesterol (HDL-C), total cholesterol, triglyceride (TG), and high sensitivity C-reactive protein (hs-CRP) levels. Subsequently, patients randomly received one daily RYR or placebo tablet for 1 month beside routine single statin therapy. Subsequently, blood tests were repeated and compared against the baseline. Liver function tests were also requested., Results: Total cholesterol significantly (P = 0.019) decreased in the treatment group (- 10.2 mg/dL) compared with the placebo group (- 1.3 mg/dL). HDL cholesterol decreased by 2.19 mg/dL in the treatment group but increased by 0.53 mg/dL in the treatment group (P = 0.083). LDL cholesterol declined in both placebo (- 5.09) and treatment (- 0.73) groups (P = 0.187). TG increased by about 7 mg/dL in the treatment group but fell by roughly 1 mg/dL in the placebo group (P = 0.386). Hs-CRP increased by 0.28 mg/dL in the treatment group but decreased by 0.09 mg/dL in the placebo group (P = 0.336)., Conclusions: We found that adding RYR (Lesstat®) to statin medications significantly decreases total cholesterol. However, no significant effect was seen on other lipid profile components or Hs-CRP. Finally, we showed that RYR is safe to add to statins considering liver function (clinicaltrials.gov: NCT05095480)., (© 2022. The Author(s).)

Hypertension is a highly prevalent disease with serious cardiovascular and renal complications. Many studies have demonstrated a weak correlation between the consumption of calcium (or calcium plus vitamin D) and blood pressure, suggesting that calcium supplements might reduce blood pressure. However, the results to date remain controversial. In this study, we assessed the effect of calcium and vitamin D supplementation on the blood pressure of postmenopausal women with hypertension as a population group in which the use of calcium supplements is prevalent. This triple-blind randomized clinical trial enrolled 98 women of postmenopausal age with hypertension in 2019. The study period was 8 weeks with close follow-up. We used 24-h ambulatory blood pressure monitoring to record the initial and final blood pressure in all participants. The changes in both the mean systolic (p = 0.047) and diastolic blood pressure (p = 0.015) were suggestive of an increase in blood pressure after consuming calcium and vitamin D supplements. Among patients who had been using calcium channel blockers, calcium and vitamin D supplementation caused a notable increase compared to baseline systolic (p = 0.019) and diastolic blood pressures (p = 0.001). The present results differ from those of previous studies. This suggests that calcium supplementation for postmenopausal women with hypertension requires the close observation of blood pressure to prevent any further increase, especially in women who are being treated with calcium channel blockers (clinicaltrial.gov registration: NCT04618952)., (© 2022. The Author(s), under exclusive licence to The Japanese Society of Hypertension.)

Objectives: The current study aimed to evaluate the effects of Ficus carica latex on the treatment of cutaneous leishmaniasis (CL), induced by Leishmania major. A 5% topical gel with F. carica latex was prepared. BALB/c mice were infected by inoculation of amastigotes form of L. major. Thirty BALB/c mice were divided into five groups, where the first group was treated daily, the second group twice per day, and the third group every other day with the 5% topical gel, for 3 weeks. The sizes of the lesions were measured before and during the course of treatment., Results: Although the mean size of lesions in the mice group treated with the 5% F. carica gel, especially in the group receiving daily treatment, was less than the mean size of the lesions in the control group, yet, the differences was not statistically significant (p > 0.05). The findings of the current study demonstrated that the 5% F. carica latex with a 3-week course of treatment had no considerable effect in recovery or control of CL induced by L. major in the murine model. Using higher concentration of F. carica latex and with longer treatment lengths may increase its efficacy in the treatment of CL.

An efficient and simple method for the application of PEGylated affinity ligands in precipitative isolation of protein target molecules (TMs) from a biological fluid such as blood serum or small target molecules from an aqueous medium is presented for the first time. This approach is based on the high binding specificity of PEGylated recognition molecules (PEG-RMs) to their TMs and the unique physicochemical properties of PEG that result in their salt-assisted phase transformation. Addition of PEG-RM to blood serum results in the formation of an RM-specific macromolecular complex (PEG-RM + TM → PEG-RM.TM) that undergoes facile salt-assisted phase transformation to a separable semisolid with ammonium sulfate. PEG-RM.TM is then dissociated into its components by pH reduction or an increase of ionic strength (PEG-RM.TM → PEG-RM + TM). PEG-RM is salted out to afford pure TM in solution. The same phenomenon is observed when RM or TM are small molecules. The general applicability of the method was validated by PEGylation of two proteins (protein A, sheep antihuman IgG) and a small molecule (salicylic acid) used as model RMs for the isolation of Igs, IgG, and serum albumin from blood serum. The isolated protein TMs were shown to be pure and aggregate-free by gel electrophoresis and dynamic light scattering (DLS). IgG isolated by this method was further characterized by peptide mass fingerprinting. PEGylated protein A was used to demonstrate the recyclability and scale-up potential of PEG-RM. IgG isolated by this method from blood serum of a hepatitis C-vaccinated individual was tested for its binding to sheep antihuman IgG by UV spectroscopy, and its bioactivity was ascertained by comparison of its enzyme-linked immunosorbent assay (ELISA) result to that of a blood sample from the same individual. Reciprocity of RM and TM was ascertained using PEGylated salicylic acid to obtain pure serum albumin, and PEGylated serum albumin was utilized for near-exclusive isolation of one drug from an aqueous equimolar mixture of three drugs (salicylic acid, 91%; capecitabine, 6%; and deferiprone, 3%). Advantages of this approach, including target specificity and general applicability and celerity, over other affinity methods for the isolation of proteins are discussed at a molecular level., Competing Interests: The authors declare no competing financial interest., (© 2021 The Authors. Published by American Chemical Society.)

The present study aimed to find out the levels of anti-HBsAb among vaccinated children in a rural community in Fars Province, Southern Iran. Blood samples were taken from 550 children, aged 1-12 years (mean 6.4 ± 3.5), in 2017 from three villages in the area. A structured questionnaire was used to get the sociodemographic data of the subjects along with determinants concerning the Hepatitis B. Sera samples were examined for anti-HBsAb, using an ELISA commercial kit. Anti-HBsAb were detected in 468 (85.1%) of the subjects. Of the seropositive subjects, 37 (45.1%) were female and 45 (54.9%) were male. In the age group of 0-5 years, 88.7% of the subjects were seropositive. This rate was 84.3% and 78.1% in the age group of 6-10 years old and older than 10 years, respectively. There was a significant association ( p < .05) between the anti-HBsAb and age. Findings of the current study revealed that children living in a rural community in southern Iran have appropriate protection against HBV even more than 10 years after being vaccinated. The decline in seropositivity rate of anti-HBsAb with age may further point out the need for a booster dose of HBV vaccine.

Fascioliasis is a human and veterinary concern in Iran. This cross-sectional population-based study was conducted to determine the seroprevalence of human fascioliasis among nomadic people in Kohgiluyeh and Boyer-Ahmad province located in the southwest of Iran. Venous blood samples were collected from 933 nomads in the area. A predesigned questionnaire containing basic epidemiological information was filled out for each subject during the sampling. Sera were evaluated for anti-Fasciola antibodies, using excretory-secretory (ES) antigen of Fasciola hepatica in an ELISA system. Of 933 recruited subjects, 726 (77.8%) were females and 206 (22.1%) were males. The mean age of the participants was 43.1 (±16.7) years old. Most of the subjects (24.6%) were in the age group of 21-30 years old. Anti-Fasciola antibodies were detected in 24 (2.6%) out of 933 cases. Of 24 seropositive cases, 3 (12.5%) were male and 21 (87.5%) were female. The differences between the seropositivity and sex, age, level of education and residence area were not statistically significant (p >0.05). Findings of the current study demonstrated that the seroprevalence of fascioliasis in the studied nomadic population was significant, and that preventive and control measures should be taken to prevent the disease from spreading and causing even greater health and economic problems in this area.

This article was migrated. The article was marked as recommended., (Copyright: © 2019 Kojuri J et al.)

Background/aims: One of the main concerns for maxillofacial and orthopedic surgeons is finding a method to improve regeneration of large craniofacial bone defects. The aim of this study was to investigate the healing and regenerative effects of fibrin glue associated with adipose-derived stem cells (ADSCs) and fibrin glue scaffold alone with autologous bone grafts in experimental mandibular defects of the rabbit., Methods: Bilateral uni-cortical osteotomies were performed in the mandible of 20 male Dutch rabbits. The animals were randomly divided into 2 equal groups. In one group, the defect on the right side was treated by fibrin glue associated with ADSCs and the defect on the other side remained as the control. In another group, the defect on the right side was treated with fibrin glue and on the left side with autologous bone graft. After 28 and 56 days, five rabbits from each group were evaluated by computed tomography (CT) and histopathological examinations., Results: Coronal CT showed a remarkable reconstruction of cortical bone in the fibrin glue associated with ADSCs group at 28 and 56 days post-surgery. Histopathologically, new cortical bony bridge formation was seen increasingly in the fibrin glue, fibrin glue associated with ADSCs, and autologous bone graft groups after 28 days. Statistical analysis of the thickness of new cortical bone in the treatment versus control groups showed a significant difference between fibrin glue alone and fibrin glue associated with ADSCs groups (P = 0.02). No significant difference was found between the fibrin glue associated with ADSCs and the autologous bone graft groups (P > 0.05)., Conclusions: The healing process had a significant increase in the thickness of new cortical bone when fibrin glue scaffold associated with ADSCs was used., (© 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Statement of the Problem: Accurate measurement of the available bone height is an essential step in the pre-surgical phase of dental implantation. Panoramic radiography is a unique technique in the pre-surgical phase of dental implantations because of its low cost, relatively low-dose, and availability., Purpose: This article aimed to assess the reliability of dental panoramic radiographs in the accurate measurement of the vertical bone height with respect to the horizontal location of the alveolar crest., Materials and Method: 132 cone-beam computed tomography (CBCT) of the edentulous mandibular molar area and dental panoramic radiograph of 508 patients were selected. Exclusion criteria were bone abnormalities and detectable ideal information on each modality. The alveolar ridge morphology was categorized into 7 types according to the relative horizontal location of the alveolar crest to the mandibular canal based on CBCT findings. The available bone height (ABH) was defined as the distance between the upper border of the mandibular canal and alveolar crest. One oral radiologist and one oral surgeon measured the available bone height twice on each modality with a 7-dayinterval., Results: We found a significant correlation between dental panoramic radiographs and cone-beam computed tomography values (ICC=0.992, p < 0.001). A positive correlation between the horizontal distance of the alveolar crest to the mandibular canal and measured differences between two radiographic modalities had been found (r=0.755, p < 0.001). For each single unit of increase in the horizontal distance of the alveolar crest to the mandibular canal, dental panoramic radiographs showed 0.87 unit of overestimation ( p < 0.001)., Conclusion: Dental panoramic radiographs can be employed safely in the pre-surgical phase of dental implantation in posterior alveolus of mandible, especially in routine and simple cases.

Background: Expansion of the C9orf72 hexanucleotide repeat (GGGGCC) n ·(GGCCCC) n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH 4.5-6.2), facilitating the formation of intercalated i-motif structures., Methods: Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer., Results: We show that the repeats with lengths of 4, 6, and 8 units, form intercalated quadruplex i-motifs at low pH (pH < 5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH ≥ 8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures., Conclusions: In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo., General Significance: DNA conformational plasticity exists over broad range of solution conditions., (Copyright © 2018 Elsevier B.V. All rights reserved.)

Background: An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures., Methods: Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + ., Results: The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules., Conclusions: For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules., (Copyright © 2018 Elsevier Inc. All rights reserved.)

Background: Restoration of craniofacial bone defects has been a concern for oral and maxillofacial surgeons. In this study, the healing effect of fibrin glue scaffold was compared with autologous bone graft in mandibular defects of rabbit., Methods: Bilateral unicortical osteotomy was performed in the diastema region of 10 male Dutch rabbits. The subjects were randomly divided into 2 equal groups. The mandibular defect on the right side was treated with fibrin glue scaffold and the defect on the left side with autologous bone graft provided from iliac crest. After 4 and 8 weeks, five rabbits from each group were sacrificed and the defects were evaluated morphologically, by coronal computed tomography scanning (CT-scan) and by histological examinations., Results: The healing effect of fibrin glue scaffold and autologous bone graft was similar with appropriate osteogenesis in comparison to the control group., Conclusion: Using fibrin glue can be a non-invasive treatment of choice in mandibular defects and maxillofacial surgeries when compared with autologous bone graft., Competing Interests: The authors declare no conflict of interest.

Microsatellite expansion disorders are pathologically characterized by RNA foci formation and repeat-associated non-AUG (RAN) translation. However, their underlying pathomechanisms and regulation of RAN translation remain unknown. We report that expression of expanded UGGAA (UGGAA exp ) repeats, responsible for spinocerebellar ataxia type 31 (SCA31) in Drosophila, causes neurodegeneration accompanied by accumulation of UGGAA exp RNA foci and translation of repeat-associated pentapeptide repeat (PPR) proteins, consistent with observations in SCA31 patient brains. We revealed that motor-neuron disease (MND)-linked RNA-binding proteins (RBPs), TDP-43, FUS, and hnRNPA2B1, bind to and induce structural alteration of UGGAA exp . These RBPs suppress UGGAA exp -mediated toxicity in Drosophila by functioning as RNA chaperones for proper UGGAA exp folding and regulation of PPR translation. Furthermore, nontoxic short UGGAA repeat RNA suppressed mutated RBP aggregation and toxicity in MND Drosophila models. Thus, functional crosstalk of the RNA/RBP network regulates their own quality and balance, suggesting convergence of pathomechanisms in microsatellite expansion disorders and RBP proteinopathies., (Copyright © 2017 Elsevier Inc. All rights reserved.)

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. Our previous work demonstrated that at high concentrations of H-Tel, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. The aggregates display circular dichroism (CD) spectra similar to that of an all-parallel structure. In the current work, we present data for 19 ODNs for which we have modified the loop sequences of H-Tel in order to learn if concentration-dependent self-aggregation is a general phenomenon and to probe the contribution of the loops to the self-association of these ODNs. Our studies use CD spectroscopy and spectroscopically monitored heat denaturation. Our data show that the concentration-dependent formation of parallel G-quadruplex aggregates is a general phenomenon. We propose that one of the factors that might affect this process is the association of partially unfolded antiparallel structures., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Statement of the Problem: Anatomic variations of the maxillary sinus can be detected in cone-beam computed tomography (CBCT) and may assist to locate the posterior superior alveolar artery (PSAA) and define the maxillary sinus morphology more accurately for a more strict surgical treatment plan., Purpose: The study aimed to determine normal variations of the maxillary sinus with the aid of CBCT in a sample population in south of Iran., Materials and Method: This cross-sectional prevalence study was based on evaluation of 198 projection data of CBCT scans of some Iranian patients aged 18-45 who referred to a private oral and maxillofacial radiology center in Shiraz from 2011 to 2013. CBCT scans were taken and analyzed with NewTom VGi device and software. The anatomic variations which were evaluated in the axial images included the presence of alveolar pneumatization, anterior pneumatization, exostosis, and hypoplasia. Moreover the location and height of sinus septa, and the location of PSAA were assessed. SPSS software (version 17.0) was used to analyze the data., Results: In a total of 396 examined sinuses, maxillary sinus alveolar pneumatization was the most common anatomic variation detected. Anterior pneumatization was detected in 96 sinuses (24.2%). Antral septa were found in 180 sinuses (45.4%) and were mostly located in the anterior region. Meanwhile, PSAA was mostly detected intra-osseous in 242 sinuses (65.7%)., Conclusion: Anatomic variations of the maxillary sinus were common findings in CBCT of the maxilla. Preoperative imaging with CBCT seems to be very helpful for assessing the location of PSAA and the maxillary sinus morphology, which may be used to adjust the surgical treatment plan to yield more successful treatments.

Statement of the Problem: Jaw bone lesions are common pathologic conditions. The role of ultrasonography in evaluation of the extra-osseous lesions is confirmed, however, this imaging modality is not the diagnostic routine for the intra-osseous jaw lesions., Purpose: The purpose of this study was to evaluate the efficiency of ultrasonography in diagnosis of intra-osseous jaw lesions concerning their size and content and also to study its correlation with the histopathological findings., Materials and Method: For this study, 15 patients with intra-osseous jaw lesions in the maxilla and mandible were selected from those referred to the Department of Oral Surgery. Panoramic imaging, computed tomography (CT) or cone beam computed tomography (CBCT) and ultrasonography (USG) were performed for all the lesions. The size of the lesions was measured by USG and then compared with CT or CBCT. Moreover, the correlation amongst the echographic patterns and histopathologic results was evaluated., Results: In 12 cases, size values were in complete agreement with CT or CBCT. The size of 3 lesions could not be measured by the radiologist due to the thickness of buccal cortical plate., Conclusion: Findings of this study suggested that USG might be feasible in estimating the size of intra-osseous jaw lesions with little underestimation. This study also confirmed that ultrasound imaging was a very useful imaging technique which could provide significant diagnostic information regarding the content of jaw bone lesions where the buccal bone thickness was thin enough.

Unusual DNA/RNA structures of the C9orf72 repeat may participate in repeat expansions or pathogenesis of amyotrophic lateral sclerosis and frontotemporal dementia. Expanded repeats are CpG methylated with unknown consequences. Typically, quadruplex structures form by G-rich but not complementary C-rich strands. Using CD, UV and electrophoresis, we characterized the structures formed by (GGGGCC)8 and (GGCCCC)8 strands with and without 5-methylcytosine (5mCpG) or 5-hydroxymethylcytosine (5hmCpG) methylation. All strands formed heterogenous mixtures of structures, with features of quadruplexes (at pH 7.5, in K(+), Na(+) or Li(+)), but no feature typical of i-motifs. C-rich strands formed quadruplexes, likely stabilized by G•C•G•C-tetrads and C•C•C•C-tetrads. Unlike G•G•G•G-tetrads, some G•C•G•C-tetrad conformations do not require the N7-Guanine position, hence C9orf72 quadruplexes still formed when N7-deazaGuanine replace all Guanines. 5mCpG and 5hmCpG increased and decreased the thermal stability of these structures. hnRNPK, through band-shift analysis, bound C-rich but not G-rich strands, with a binding preference of unmethylated > 5hmCpG > 5mCpG, where methylated DNA-protein complexes were retained in the wells, distinct from unmethylated complexes. Our findings suggest that for C-rich sequences interspersed with G-residues, one must consider quadruplex formation and that methylation of quadruplexes may affect epigenetic processes., (© The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Statement of the Problem: Due to shortage of ICU beds in hospitals, knowing what kind of orthognathic surgery patients more need ICU care after surgery would be important for surgeons and hospitals to prevent unnecessary ICU bed reservation., Purpose: The aim of the present study was to determine what kinds of orthognathic surgery patients would benefit more from ICU care after surgery., Materials and Method: 210 patients who were admitted to Chamran Hospital, Shiraz, for bimaxillary orthognathic surgery (2008-2013) were reviewed based on whether they had been admitted to ICU or maxillofacial surgery ward. Operation time, sex, intraoperative Estimated Blood Loss (EBL), postoperative complications, ICU admission, and unwanted complications resulting from staying in ICU were assessed., Results: Of 210 patients undergoing bimaxillary orthognathic surgery, 59 patients (28.1%) were postoperatively admitted to the ICU and 151 in the maxillofacial ward (71.9%). There was not statistically significant difference in age and sex between the two groups (p> 0.05). The groups were significantly different in terms of operation time (p< 0.001). Blood loss For ICU admitted patients was 600.00±293.621mL and for those who were hospitalized in the ward was 350.00±298.397 mL. Statistically significant differences were found between the two groups (p< 0.001). Moreover, there was a direct linear correlation between operation time and intraoperative estimated blood loss and this relationship was statistically significant (r=0.42, p< 0.001). Patients with maxillary impaction and setback plus mandibular advancement plus genioplasty were among the most ICU admitted patients (44%), while these patients were only 20% of all patients who were admitted to the ward. As a final point, the result illustrated that patients who were admitted to the ICU experienced more complication such as bleeding, postoperative nausea, and pain (p< 0.001)., Conclusion: Orthognathic surgery patients (maxillary impaction and setback plus mandibular advancement plus genioplasty) due to more intraoperative bleeding and postoperative nausea and pain would benefit from ICU admission after surgery.

This is a prospective study to evaluate the accuracy of clinical predictions related to surgical results in subjects who underwent maxillary superior repositioning without anterior-posterior movement. Surgeons' predictions according to clinical (tooth show at rest and at the maximum smile) and cephalometric evaluation were documented for the amount of maxillary superior repositioning. Overcorrection or undercorrection was documented for every subject 1 year after the operations. Receiver operating characteristic curve test was used to find a cutoff point in prediction errors and to determine positive predictive value (PPV) and negative predictive value. Forty subjects (14 males and 26 females) were studied. Results showed a significant difference between changes in the tooth show at rest and at the maximum smile line before and after surgery. Analysis of the data demonstrated no correlation between the predictive data and the surgical results. The incidence of undercorrection (25%) was more common than overcorrection (7.5%). The cutoff point for errors in predictions was 5 mm for tooth show at rest and 15 mm at the maximum smile. When the amount of the presurgical tooth show at rest was more than 5 mm, 50.5% of clinical predictions did not match the clinical results (PPV), and 75% of clinical predictions showed the same results when the tooth show was less than 5 mm (negative predictive value). When the amount of presurgical tooth shown in the maximum smile line was more than 15 mm, 75% of clinical predictions did not match with clinical results (PPV), and 25% of the predictions had the same results because the tooth show at the maximum smile was lower than 15 mm. Clinical predictions according to the tooth show at rest and at the maximum smile have a poor correlation with clinical results in maxillary superior repositioning for vertical maxillary excess. The risk of errors in predictions increased when the amount of superior repositioning of the maxilla increased. Generally, surgeons have a tendency to undercorrect rather than overcorrect, although clinical prediction is an original guideline for surgeons, and it may be associated with variable clinical results.

Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

The aim of this study is to evaluate outcome of bone availability after the secondary alveolar bone graft in 2 age groups: group 1 patients were between 9 and 13 years old and group 2 patients were above 14 years old. Acceptance success criteria (ASC) consisted of sufficient bone height (more than 10 mm), bone width (more than 4 mm), and adequate continuity between maxillary segments. The height and width of alveolar grafted bone were measured by using the cone-beam CT scans. We studied 45 patients who underwent a bone graft in their alveolar cleft in 2 groups (25 patients in group 1 and 20 in group 2). The results showed that as the patients' ages increased, the incidence of ASC significantly decreased. In group 1, 23 patients had ACS (92%), and in group 2, only 4 patients (20%) had ASC. Cleft type did not affect the ASC. The critical age for decreasing ASC was 14.5 years. Our study showed successful outcomes of grafted bone were good when done in the mixed dentition period. Additionally, bone availability was more predictable at the mixed dentition stage.