Search

Abstract CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P

Abstract Background Rheumatoid arthritis (RA) is an autoimmune disease characterized by inflammatory reactions and tissue damage in the joints. Long-term drug use in clinical practice is often accompanied by adverse reactions. Extracorporeal photopheresis (ECP) is an immunomodulatory therapy with few side effects, offering a potential and safe therapeutic alternative for RA through the induction of immune tolerance. This study aimed to investigate the therapeutic effects of ECP on RA using a collagen-induced arthritis (CIA) murine model, as well as to explore its immunomodulatory effects in vivo. Additionally, particular attention was given to the significant role of monocytes during the ECP process. Methods A murine model of rheumatoid arthritis was established by administering two injections of bovine type II collagen to DBA/1J mice. ECP, ECP-MD (mononuclear cells were depleted during the ECP), MTX, and PBS treatment were applied to the CIA mice. During the treatment process, clinical scores and body weight changes of CIA mice were closely monitored. After six treatment sessions, micro-CT images of the hind paws from live mice were captured. Ankle joints and paws of the mice were collected and processed for histological evaluation. Spleen samples were collected to measure the Th17/Treg cells ratio, and serum samples were collected to assess cytokine and anti-type II collagen IgG levels. Monocytes and dendritic cells populations before and after ECP in vitro were detected by flow cytometry. Result ECP therapy significantly attenuated the progression of CIA, alleviated the severity of clinical symptoms in CIA mice and effectively suppressed synovial hyperplasia, inflammation, and cartilage damage. There was an expansion in the percentage of CD3 + CD4 + CD25 + FoxP3 + Tregs and a decrease in CD3 + CD4 + IL17A + Th17 cells in vivo. Furthermore, ECP reduced the serum levels of pro-inflammatory cytokines IL-6 (53.47 ± 7.074 pg/mL vs 5.142 ± 1.779 pg/mL, P

Objective To investigate the clinical characteristics and antibody distribution as well as evaluate the transfusion efficacy in unexpected antibody positive patients. Methods A total of 12 235 patients from January 1, 2022 to March 31, 2023 who hospitalized in our hospital and applied for blood transfusion were selected, and those with unexpected antibody were included. The clinical data, including gender, age, diagnosis, blood type, history of transfusion and pregnancy were collected for antibody distribution analysis. Patients who received transfusion were grouped according to the DAT results and the components of red blood cells transfused, and the Hb values of each group before and after transfusion were compared. Results Among12 235 patients, 118 were positive for antibody screening, with a prevalence of 0.96%. The antibodies from Rh system were the most common (27.43%, 48/175), followed by MNS system (8.57%, 15/175) and Lewis system (6.29%, 11/175), mainly anti-E (18.29%, 32/175), anti-M (8.00%, 14/175) and anti-Lea (5.71%, 10/175). In addition, 62 transfused patients were divided into group A with suspended red blood cell transfusion and group B with washed red blood cell transfusion for positive DAT, and group C for negative DAT. Hb values (g/L) pre- and post-transfusion were 59.19±15.67 vs 77.52±15.09 in group A, 56.35±14.08 vs 74.44±15.63 in group B, 56.00±12.06 vs 75.00±4.73 in group C, respectively. The Hb values of post-transfusion for three groups were all higher than those of pre-transfusion (P

Objective To investigate the preventive effects of early apoptotic splenic mononuclear cells induced by extracorporeal photopheresis (ECP) on acute graft versus host disease (aGVHD) in mice and explore the underlying mechanisms. Methods 1) Splenic mononuclear cells were extracted from C57BL/6 mice and treated with different concentrations of 8-MOP (50 ng/mL, 100 ng/mL, 200 ng/mL, 300 ng/mL, 600 ng/mL). After treatment, irradiate the cells with 2 J/cm2 of ultraviolet light. Then, use the Annexin V-FITC/PI apoptosis detection kit to assess the early apoptosis rate of the cells and determine the optimal concentration of 8-MOP for the experiment.2) There were 35 SPF-grade female BALB/C mice (H-2Kd) aged 6-8 weeks. After whole-body irradiation with 8Gy X-rays, the mice were divided into five groups: sham irradiation group received intravenous infusion of 0.2 mL of normal saline, the syngeneic bone marrow transplantation group received intravenous infusion of 0.2 mL of BALB/C mouse bone marrow nucleated cell suspension (including a cell count of 1×107), the allogeneic bone marrow transplantation group received intravenous infusion of 0.2 mL of C57BL/6 mouse bone marrow nucleated cell suspension (including a cell count of 1×107), the aGVHD group received intravenous injection of a mixture of C57BL/6 mouse bone marrow nucleated cells (including a cell count of 1×107) and splenic mononuclear cells (including a cell count of 1×107) in 0.2 mL, the ECP prevention group received pre-transplant intravenous infusion of 0.2 mL of ECP-treated splenic mononuclear cells of C57BL/6 mice (including a cell count of 1×107 ) 48 hours before transplantation, and on the day of transplantation, intravenous injection of a mixture of C57BL/6 mouse bone marrow nucleated cells (including a cell count of 1×107) and splenic mononuclear cells (including a cell count of 1×107 ) in 0.2 mL.The preventive effects of ECP on aGVHD were observed, and the concentrations of IFN-γ, IL-2, TNF, IL-4 and IL-6 in mouse serum were measured using CBA. Th1 cell counts were determined by flow cytometry. Results Different concentrations of 8-MOP (50 ng/mL,100 ng/mL, 200 ng/mL, 300 ng/mL, 600 ng/mL) were used to treat mouse splenic mononuclear cells. The early apoptosis rates (%), observed after treatment were as follows: (14.18±0.865) vs (16.76±0.407) vs (18.83±0.404) vs (19.27±0.404) vs (14.5±0.529). The appropriate concentration of 8-MOP was determined to be 200 ng/mL.In vivo experiment, the results showed that the aGVHD group had decreased survival rate, reduced body weight, and increased clinical scores compared to the syngeneic and allogeneic bone marrow transplantation groups (P

Warming coupled with precipitation changes induced by climate change profoundly affect desert ecosystem functions in global drylands. Arbuscular mycorrhizal fungi (AMF) play a crucial role in such ecosystems by regulating energy and nutrient exchange. However, little is known about how AMF communities respond to warming coupled with reduced precipitation (W + RP). We evaluated the impacts of 0.5 °C and 1.5 °C increase in temperature coupled with 5 % and 8 % reductions in total annual precipitation (0.5 °C W + 5 % RP, 1.5 °C W + 8 % RP) on AMF communities and the main ecological processes structuring AMF community assemblies in the rhizosphere soil of typical winter annual plants in the Tengger Desert, northwest China. The results showed that warming coupled with reduced precipitation could significantly alter the composition, abundance, and diversity of AMF communities. Both AMF biomass and AMF diversity increased in the 0.5 °C W + 5 % RP treatment but decreased in the 1.5 °C W + 8 % RP treatment. The 1.5 °C W + 8 % RP treatment significantly reduced root biomass and the AMF colonization rate but increased the specific root length, indicating a trade-off between fine roots and their symbiotic AMF. The AMF community was phylogenetically random in the 0.5 °C W + 5 % RP treatment but appeared clustered in the 1.5 °C W + 8 % RP treatment, implying that more pronounced warming coupled with reduced precipitation can promote the deterministic assembly of the AMF community. We provide a conceptual framework for comprehending the mechanisms underlying the effects of warming coupled with reduced precipitation on AMF communities, incorporating biological and geochemical processes. Overall, the findings of this study suggest that AMF abundance and diversity and the main ecological processes driving AMF assemblages respond differently to more pronounced compared to less intensive warming coupled with reduced precipitation. Importantly, higher warming coupled with a reduction in precipitation reduced plant dependence on AMF and resulted in stronger environmental filtration by significantly reducing soil water content.

Steatosis is the hepatic manifestation of metabolic syndrome (MetS) and its developing is closely associated with insulin resistance. Shortened sleep has adverse effects on hepatic steatosis and the underlying mechanism remains unknown. We conceived to evaluate whether sleep duration was a lifestyle factor modifying the association between insulin resistance and hepatic steatosis and whether it was varied in different status of metabolic disturbances. We performed a cross-sectional analysis on 2264 adults of United States representing a population of 138,319,512 with MetS or pre-MetS from National Health and Nutrition Examination Survey (NHANES) 2017-March 2020. Participants underwent hepatic transient elastography and laboratory tests. The sleep duration was obtained from interviews. Results showed that insulin resistance was significantly associated with hepatic steatosis among participants with metabolic disturbances (OR = 1.85, 95% CI: 1.30–2.65). Significant moderation of sleep duration on the association between insulin resistance and hepatic steatosis was observed when sleep duration was dichotomized by 6.5- (P = 0.042) or 9.5-hour (P = 0.031). The risk of hepatic steatosis associated with insulin resistance was increased when sleep duration was ≤ 6.5 h and > 9.5 h. Furthermore, the moderation effect of 6.5-hour sleeping was only significant among participants with pre-MetS while that of 9.5-hour sleeping was only significant among participants with MetS. In conclusion, insufficient or excessive sleep increased the risk of hepatic steatosis associated with insulin resistance. Appropriate sleep duration was advocated and varied in different status of metabolic disturbances. Ensuring adequate sleep should be highlighted before MetS occurs and excessive sleep should be prevented for participants with MetS.

This paper describes and critiques how surveillance is situated and evolving in higher education settings, with a focus on the surveillance of teaching and learning. It argues that intensifying practices of datafication and monitoring in universities echo those in broader society, and that the Covid-19 global pandemic has both exacerbated these practices and made them more visible. Surveillance brings risks to learning relationships, academic and work practices, as well as reinforcing economic models of extraction and inequalities in education and society. Responses to surveillance practices include resistance, advocacy, education, regulation and investment, and a number of these responses are examined here. Drawing on scholarship and practice, the paper provides an in-depth overview of this topic for people in university settings including those in leadership positions, learning technology roles, educators and students. The authors are part of an international network of researchers, educators and university leaders who are working together to develop new approaches to surveillance futures for higher education: https://aftersurveillance.net/. Authors are based in Canada, South Africa, the United Kingdom and the United States, and this paper reflects those specific contexts.

BackgroundMitral valve surgery (MVS) is an effective treatment for mitral valve diseases. There is a lack of reliable personalized risk prediction models for mortality in patients undergoing mitral valve surgery. Our aim was to develop a risk stratification system to predict all-cause mortality in patients after mitral valve surgery.MethodsDifferent machine learning models for the prediction of all-cause mortality were trained on a derivation cohort of 1,883 patients undergoing mitral valve surgery [split into a training cohort (70%) and internal validation cohort (30%)] to predict all-cause mortality. Forty-five clinical variables routinely evaluated at discharge were used to train the models. The best performance model (PRIME score) was tested in an externally validated cohort of 220 patients undergoing mitral valve surgery. The model performance was evaluated according to the area under the curve (AUC). Net reclassification improvement (NRI) and integrated discrimination improvement (IDI) were compared with existing risk strategies.ResultsAfter a median follow-up of 2 years, there were 133 (7.063%) deaths in the derivation cohort and 17 (7.727%) deaths in the validation cohort. The PRIME score showed an AUC of 0.902 (95% confidence interval [CI], 0.849–0.956) in the internal validation cohort and 0.873 (95% CI: 0.769–0.977) in the external validation cohort. In the external validation cohort, the performance of the PRIME score was significantly improved compared with that of the existing EuroSCORE II (NRI = 0.550, [95% CI 0.001–1.099], P = 0.049, IDI = 0.485, [95% CI 0.230–0.741], P < 0.001).ConclusionMachine learning-based model (the PRIME score) that integrate clinical, demographic, imaging, and laboratory features demonstrated superior performance for the prediction of mortality patients after mitral valve surgery compared with the traditional risk model EuroSCORE II.Clinical Trial Registration[http://www.clinicaltrials.gov], identifier [NCT05141292].

Abstract Fierce competition exists between most stem‐twining lianas and the trunks of host trees. However, Merremia boisiana, a vigorous invasive twining liana, never strangles the host tree. Here, we investigated how M. boisiana stems adjust their twining growth to avoid intense competition with host trees, and how hydraulic conductivity is maintained for rapid asexual reproduction. We evaluated the effects of competition on twining M. boisiana stems (Em) and host tree trunks (Eh), compared differences in secondary growth between twining and creeping M. boisiana stems, calculated the total number of vessels (Nt), vessel density (Vmm−2), average vessel diameter (VDave), and percentage of vessels wider than 300 μm in diameter (P300) in the secondary xylem, and traced how these parameters change with increasing cross‐sectional area of stem (SA). The results showed that twining M. boisiana stems were competitively weaker, and mean Em (14.3%) was 21 times greater than that of Eh (0.7%). Secondary growth along the normal direction of the contact surface was significantly inhibited in stems twining on host trees. The lateral secondary growth of these stems was active, forming secondary vascular rings and/or arcs with abundant large vessels. Secondary growth in the central vascular cylinder was also significantly limited in extremely flat twining stems. Nt was positively and linearly correlated with SA. Vmm−2 and VDave fluctuated greatly in younger stems and tended to be stable in older stems. Nt and Vmm−2 did not significantly differ between twining and creeping stems, while VDave and P300 were both higher in twining stems compared to creeping stems of the same size. In conclusion, well‐developed lateral anomalous secondary growth prevents twining M. boisiana stems from fiercely competing with their host trees, while stable vessel density and wider, newly formed, vessels ensured sufficient hydraulic conductivity for the rapid asexual reproduction of twining M. boisiana stems.

Olive trees, which are planted widely in China, are economically significant. Timely and accurate acquisition of olive tree crown information is vital in monitoring olive tree growth and accurately predicting its fruit yield. The advent of unmanned aerial vehicles (UAVs) and deep learning (DL) provides an opportunity for rapid monitoring parameters of the olive tree crown. In this study, we propose a method of automatically extracting olive crown information (crown number and area of olive tree), combining visible-light images captured by consumer UAV and a new deep learning model, U2-Net, with a deeply nested structure. Firstly, a data set of an olive tree crown (OTC) images was constructed, which was further processed by the ESRGAN model to enhance the image resolution and was augmented (geometric transformation and spectral transformation) to enlarge the data set to increase the generalization ability of the model. Secondly, four typical subareas (A–D) in the study area were selected to evaluate the performance of the U2-Net model in olive crown extraction in different scenarios, and the U2-Net model was compared with three current mainstream deep learning models (i.e., HRNet, U-Net, and DeepLabv3+) in remote sensing image segmentation effect. The results showed that the U2-Net model achieved high accuracy in the extraction of tree crown numbers in the four subareas with a mean of intersection over union (IoU), overall accuracy (OA), and F1-Score of 92.27%, 95.19%, and 95.95%, respectively. Compared with the other three models, the IoU, OA, and F1-Score of the U2-Net model increased by 14.03–23.97 percentage points, 7.57–12.85 percentage points, and 8.15–14.78 percentage points, respectively. In addition, the U2-Net model had a high consistency between the predicted and measured area of the olive crown, and compared with the other three deep learning models, it had a lower error rate with a root mean squared error (RMSE) of 4.78, magnitude of relative error (MRE) of 14.27%, and a coefficient of determination (R2) higher than 0.93 in all four subareas, suggesting that the U2-Net model extracted the best crown profile integrity and was most consistent with the actual situation. This study indicates that the method combining UVA RGB images with the U2-Net model can provide a highly accurate and robust extraction result for olive tree crowns and is helpful in the dynamic monitoring and management of orchard trees.

Background: Radiotherapy (RT) for breast cancer (BC) may raise the risk of second primary cancers (SPCs), a relationship inadequately studied. Methods: We analyzed 248268 female BC patients from 9 SEER registries, 1988–2018, identifying SPCs >5 years after initial treatment, comparing SPC risks between RT and non-RT cohorts using Fine-Gray and Poisson regressions. Results: Of all participants, 55.4 % received surgery and RT. The RT group had a higher SPC incidence, with excess incidence significantly dropped from 6.9 % in 1990 to 0.2 % in 2012. The 30-year SPC incidence was 24.69 % in the RT cohort and 18.11 % in the NRT cohort. RT increased the risk of SPCs(HR, 1.29 [95%CI,1.26–1.33]; P

Inflammatory mediators tumor necrosis factor (TNF) and interleukin 1 beta (IL1β), primarily derived from hepatic macrophages in the liver, play a crucial role in the progression of nonalcoholic steatohepatitis (NASH). Meanwhile, intravenously injected exosomes are mainly distributed in the liver and predominantly taken up by hepatic macrophage. Herein, we aimed to evaluate the feasibility of targeted inhibition of TNF and IL1β expression in hepatic macrophages via exosomes as a potential therapeutic strategy for NASH. In this study, we demonstrated that antisense oligodeoxynucleotide targeting TNF (ASO-TNF) or 2-deoxy-d-glucose (2DG) effectively suppressed the expression of TNF and/or IL1β in macrophages. Exosomes loaded with ASO-TNF or 2DG were able to suppress the expression of TNF and/or IL1β in macrophages in vitro or in vivo. Furthermore, infusion of Exo/ASO-TNF or Exo/2DG significantly attenuated experimental steatohepatitis in choline deficient amino acid-defined (CDAA) or methionine and choline deficient (MCD) diet-fed mice. RNA-seq results showed that treatment with Exo/ASO-TNF or Exo/2DG significantly inhibited pro-inflammatory signaling pathways. Mechanistically, we observed that administration of Exo/ASO-TNF or Exo/2DG could attenuate NASH progression by up-regulating the expression of superoxide dismutase 1 (Sod1). Combined, our findings demonstrated that infusion of exosomes loaded with ASO-TNF or 2DG alleviated experimental steatohepatitis in murine models. Thus, infusion of exosomes loaded with anti-inflammatory agents holds promise as a potential therapeutic strategy for NASH treatment.

The surface structures and compositions of Au-Rh bimetallic nanoclusters on an ordered thin film of Al2O3/NiAl(100) were investigated, primarily with infrared reflection absorption spectra and temperature-programmed desorption of CO as a probe molecule under ultrahigh-vacuum conditions and calculations based on density-functional theory. The bimetallic clusters were formed by sequential deposition of vapors of Au and Rh onto Al2O3/NiAl(100) at 300 K. Alloying in the clusters was active and proceeded toward a specific structure--a fcc phase, (100) orientation, and Rh core-Au shell structure, regardless of the order of metal deposition. For Au clusters incorporating deposited Rh, the Au atoms remained at the cluster surface through position exchange and became less coordinated; for deposition in reverse order, deposited Au simply decorated the surfaces of Rh clusters. Both adsorption energy and infrared absorption intensity were enhanced for CO on Au sites of the bimetallic clusters; both of them are associated with the bonding to Rh and also a decreased coordination number of CO-binding Au. These enhancements can thus serve as a fingerprint for alloying and atomic inter-diffusion in similar bimetallic systems. [ABSTRACT FROM AUTHOR]

The operation of the hybrid form of developing and implementing software is described while also identifying several key factors shaping the collaboration between Free/Libre Open Source Software (FLOSS) firms and the community. The hybrid innovation of FLOSS demonstrates the advantage of acquiring resources both from the community and the commercial sector committing to the collective practices.