Search

Objectives: This study aimed to investigate the physical properties of Indonesian local sheep skin collagen extracted by acid and enzymatic methods. Materials and Methods: Collagen was isolated from Pure Breed Garut Sheep (Ovis aries sp.) skin, 1.5 years old. The skins were obtained from a local slaughterhouse in Cirebon, Indonesia. The solvents used were CH3COOH and three different enzymes: neutrase, alcalase, and bromelain. Results: The highest yields of extracted collagen were bromelain-soluble collagen (BSC), which reached 37.07%. The range of Ph values for all samples started from 4.01 to 4.76. The viscosity values (cP) of acid-soluble collagen (ASC), neutrase-soluble collagen (NSC), alcalase-soluble collagen (LSC), and BSC were 3.42, 3.90, 3.45, and 3.12, respectively. Regarding SDS-PAGE analyses, Garut sheepskin collagen is categorized as collagen type I, which has a molecular weight of about 140.99 to 148.74 kDa for α1 and around 110 to 111.86 kDa for α2. The results of FTIR and DSC analyses for all samples show the same motif with commercial collagen motifs based on the literature. Conclusion: Garut sheep skin has the potential to be an alternative raw material source for producing collagen. Collagen extracted using a combination of CH3COOH and bromelain enzyme showed the most desirable results in almost every characteristic. [J Adv Vet Anim Res 2024; 11(3.000): 722-728]

Background and Aim: Halal restaurants participating in online food delivery services do not require halal certification. The Halal status of products through the Halal logo provides the consumer with information on the basis of which he decides to buy. Online transactions involve potential risks related to online processes, payment methods, and product quality. The aim of this study was to determine whether a declared Halal label is in accordance with the business processes implemented. Materials and Methods: Halal authentication of Gofood's meatball partner products in Yogyakarta and Solo Raya determined the incompatibility of meatball ingredients. Sixty meatball samples were collected from Yogyakarta and 30 samples from Solo Raya. Halal certification test was carried out using the thermal cycle polymerase chain reaction method at Universitas Gadjah Mada Animal Husbandry Laboratory and the results were used to identify pork contamination in meatballs. The addition of pork or pork meatballs was used as a control. Results: Eight meatball restaurants in the Solo Raya and Yogyakarta areas were found to be contaminated with pig DNA. The results of the tracing materials and processes, i.e., the grinding stage, are critical because all samples were supposed to be made from beef. It is known from interviews that contamination with pig DNA at the milling stage was accidental. Conclusion: Restaurants that sell meatballs are committed to adhering to product labels that are 91.1% safe from pork contamination. The Halal and original beef labels were in accordance with their statements. This study highlights the concept of Halal authentication with traceability to overcome pork contamination in meat products.

Leather tanning can be done by soaking the skin in pits or rotating in tannery drums. Technical soaking of rotate movement and static soaking affects the skin microstructure matrix. This study aims to compare the quality of wet blue leather tanned by static soaking in a vessel and rotating in a tannery drum, particularly in terms of chrome uptake and thermal stability. The penetration time in the soaking experiment varied from 8, 16, 24, 32, 40, 48, and 56 hours. Meanwhile, the control was processed in a small-scale tannery drum with two hours of penetration time. Then, each sample was subjected to basification using HCOONa and NaHCO3. The results showed that all samples increased in weight and thickness after tanning. After penetration, wet blue leather tanned in a tannery drum performed better blue-green colour evenness compared with the soaked ones. Tannery drum leather also showed better chromium uptake, shrinkage temperature, and thermal stability. When the drum rotates, the pickled pelt gets mechanical action, such as being stretched, bent, and slammed, helping the collagen fibre open and the chromium penetrates deeper and faster. This study revealed that darker wet blue leather indicates higher thermal stability and chromium uptake.

White egg contains the most significant protein source that has been explored to give more benefit for health purposes. This study evaluated the potential of antibacterial and antioxidant activity of white egg protein hydrolysate extracted from Indonesian avian eggs. The avian egg materials used local Indonesian chicken eggs (kampung chicken), chicken breed eggs, duck eggs, and muscovy duck eggs. The white egg was extracted by organic solvent and produced protein extracted which was dominated by ovalbumin and ovotransferrin. The protein extracted was hydrolyzed by pepsin and then powdered using a freeze dryer. Antibacterial and antioxidant activity was evaluated by agar well diffusion technique and 2,2-Diphenyl-1-picryl hydroxyl (DPPH) radical scavenging method. All samples showed antimicrobial activity against Salmonella sp., Escherichia coli, Staphylococcus aureus, Bacillus cereus, and Bacillus subtilis with a concentration of protein hydrolysate at 40 mg/mL. The antioxidant activity between avian species was different and dose-dependent. Protein hydrolysate extracted from duck white egg exhibited the highest radical scavenging activity (65%) at 10 mg/mL concentration. However, all white egg protein hydrolysate extracted from Indonesian avian eggs can potentially help reduce oxidation and microbial deterioration.

Collagen derived from the eggshell membrane, is an increasingly popular functional material. Native chicken is one of the leading local commodities whose industrial waste has the potential to be used as collagen raw material. This study aimed to evaluate the nutrients and morphology of the eggshell membrane of native chicken eggs as raw material for collagen production. The parameters observed were morphology using electron scanning microscopy, mineral composition, and collagen nutrient content (water and protein). SEM observations showed that the eggshell membrane of native chicken eggs was fibrous. The meshed fiber form represents the extracellular matrix present in collagen proteins. The eggshell membrane contains Cl, K, Ca, P, and Mg macrominerals at 1.696%, 1.796%, 14.30%, 0.437%, and 0.146%, respectively. Microminerals I and Mo were also found at 0.00034% and 0.00014%, respectively. The moisture content of the superior native chicken eggshell membrane decreased by 13.05% after the collagen extraction (p

During the COVID-19 outbreak, economic sectors slowed down and caused a significant impact on almost any level of society, especially the middle to lower class income. Thus, a strategy needs to be developed to overcome this situation. The Ngoro-Oro Village has potency in the livestock sector, especially in the development of superior hybrid Jawa super chicken. Therefore, the purposes of our community service in the Ngoro-Oro Village were to develop superior hybrid Jawa super chicken and use black soldier fly larvae as an alternative feed for chicken. We distributed 105 Jawa super hens aged ± three months and 21 superior free-range roosters. Furthermore, the hens and rooster were mated at the age of ± six months with a ratio of 5:1. The hybrid chickens were evaluated for their body weight and morphometric measurements until the age of four months. We also monitored the farmer community’s use of black soldier fly larvae as an alternativ e feed for chickens. The hybrid chicken at the age of 4 months old has a body weight of about 971.64 ± 271.06 grams with a height of about 41.73 ± 5.87 cm, head’s length of 5.01 ± 0.44 cm, body length of 22.82 ± 3.14 cm, body width of 10.68 ± 1.49 cm, wing’s length 19.14 ± 2.67 cm, thigh’s length 11.95 ± 1.71 cm, and leg’s length is about 7.91 ± 1.41 cm. Moreover, Ngoro-Oro farmers can improve the community’s economy by selling superior hybrid Jawa super chicken at a price 75,000 – 85,000 rupiahs per head. Through all of this community service program, it could be concluded that superior hybrid Jawa super chicken is potential to be developed as broiler, and the farmer community could develop black soldier fly larvae as an alternative feed for chicken.

Background and Aim: Gelatin is a dissolved protein that results from partial extraction of collagen, commonly from pig and bovine skin. There was no study on gelatin production from Kacang goat bones through enzymatic extraction. This study aimed to evaluate the chemical, physical, and functional properties of gelatin from bones of Kacang goat using alcalase and neutrase enzymes. Materials and Methods: Male Kacang goat bones aged 6-12 months and two commercial enzymes (alcalase and neutrase) were used for this study. Descriptive analysis and completely randomized design (one-way analysis of variance) were used to analyze the chemical, physical, and functional properties of gelatin. Kacang goat bone was extracted with four concentrations of alcalase and neutrase enzymes, namely, 0 U/g (AG-0 and NG-0), 0.02 U/g (AG-1 and NG-1), 0.04 U/g (AG-2 and NG-2), and 0.06 U/g (AG-3 and NG-3) with five replications. Results: The highest yield of gelatin extraction with alcalase obtained on AG-3 was 9.78%, and that with neutrase on NG-3 was 6.35%. The moisture content of alcalase gelatin was 9.39-9.94%, and that of neutrase gelatin was 9.15-9.24%. The ash and fat content of gelatin with alcalase was lower than that without enzyme treatment with higher protein content. The lowest fat content was noted in AG-1 (0.50%), with protein that was not different for all enzyme concentrations (69.65-70.21%). Gelatin with neutrase had lower ash content than that without neutrase (1.61-1.90%), with the highest protein content in NG-3 (70.89%). The pH of gelatin with alcalase and neutrase was 6.19-6.92 lower than that without enzymes. Melting points, gel strength, and water holding capacity (WHC) of gelatin with the highest alcalase levels on AG-1 and AG-2 ranged from 28.33 to 28.47°C, 67.41 to 68.14 g bloom, and 324.00 to 334.67%, respectively, with viscosity that did not differ, while the highest foam expansion (FE) and foam stability (FS) were noted in AG-1, which were 71.67% and 52.67%, respectively. The highest oil holding capacity (OHC) was found in AG-2 (283%). FS and OHC of gelatins with the highest neutrase levels in NG-2 were 30.00% and 265.33%, respectively, while gel strength, viscosity, FE, and WHC of gelatins with the highest neutrase levels did not differ with those without enzymes at all enzyme concentrations. B chain was degraded in all gelatins, and high-intensity a-chains in gelatin with alcalase and peptide fraction were formed in gelatin with neutrase. Extraction with enzymes showed loss of the triple helix as demonstrated by Fourier transform infrared spectroscopy. Conclusion: Based on the obtained results, the Kacang goat bone was the potential raw source for gelatin production. Enzymatic extraction can increase the quality of gelatin, especially the alcalase (0.02-0.04 U/g bone) method. This can be used to achieve the preferable quality of gelatin with a higher yield.

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Collagen have been interesting material for many utilization such as food, pharmaceutical and cosmetic in various products and target administration, consequently collagen should be prepared as well as type of application. The objective of this research is to prepare collagen from goat skin and investigate the character and their potency as an antioxidant. Kacang goat skin aged 2 years was used for collagen production. Small slice skin was extracted by curing with 0.1% (w/v) pepsin in acetic acid 0.5 M, for 24, 48, dan 72 h at 4°C. The variables observed were molecular weight by Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE), microstructure using scanning electron microscope, thermal stability by differential scanning calorimetric, and the antioxidant potency through 2,2-diphenyl-1-picrylhydrazyl (DPPH) inhibition analysis. The result showed the molecular weight range from 25 kDa to 180 kDa, microstructure showed the collagen fibril crosslink, collagen start to denature at 62,28°C, highest dissolved with 1% NaCl concentration and has highest DPPH inhibition at 60 min after hydrolysis. In conclusion, kacang goat skin collagen prepared by pepsin in acetic acid.

Meatballs are processed meat products that are susceptible to adulteration. Indonesia enforces a halal product guarantee regulation so that all products in circulation are free from non-halal ingredients. This study aimed to detect with the PCR method the contamination by pork and chicken of commercial beef meatballs. The samples of commercial meatballs were obtained from 36 meatball shops in Bojonegoro Regency, East Java, and Boyolali Regency, Central Java Province, Indonesia. Reference meatballs as a positive control were prepared in the laboratory. DNA isolation was performed on commercial sample meatballs, reference meatballs, and 13 species of fresh meat for specificity tests. DNA concentrations were measured using a spectrophotometer, and visualization of the isolation and PCR results was conducted using agarose gel electrophoresis and a UV transilluminator. DNA isolates were amplified by PCR using gene targets 1.711B bovine repeat for identifying bovine species, CR1 SINE repeat element for identifying chicken species, and mitochondrial gene subunit ND1 for identifying pork species. The results showed that there was contamination by chicken meat in meatballs labeled as beef meatballs in 30 of 36 samples in Bojonegoro Regency and 33 of 36 samples in Boyolali Regency. The results also showed that 22 samples of commercial beef meatballs in the Boyolali Regency contained pork. The implementation of the PCR method using the three specific primers proved the presence of meat contamination that did not match the label on the meatballs circulating in the Indonesian market. The contamination by pork if beef meatballs has violated the regulation on halal product guarantees.

Background and Aim: Angiotensin-converting enzyme (ACE) is one of the inhibitory enzymes isolated from animals for the treatment of hypertension. ACE inhibitor (ACE-I) peptides can be obtained by hydrolyzing proteins from various animal tissues, including muscle and connective tissues. However, the study on ACE-I activity from collagen of Kacang goat skin has not been conducted. This study explores the potency of collagen from Kacang goat skin as a source of an antihypertensive agent through ACE inhibition. Thermolysin will hydrolyze collagen and produce the peptide classified antihypertensive bioactive peptides. This study aimed to determine the potential of thermolysin to hydrolyze collagen of Kacang goat skin for ACE-I peptide production and to identify the production of ACE-I peptides. Materials and Methods: Collagen from Kacang goat skin was hydrolyzed with thermolysin and incubated at 37°C for 1 h. Molecular weight (MW) evaluation was performed by SDS PAGE; fractionation peptides at 5 kDa was 3.93±0.72 mg/mL, content of 3-5 kDa was 3.81±0.68 mg/mL, and that of

This research aims to determine the physical properties and the bacterial counts of chicken sausages that were given an edible coating made from a combination of bovine split hide gelatin and soy protein isolate with the addition of the enzyme transglutaminase during chilled storage. The parameters observed included, pH, moisture, protein content, weight loss, tenderness, and the bacterial counts. Data were analyzed with a completely randomized design (CRD) factorial pattern 4 x 4 with three replications. The first factor was the level of edible coating 0%, 5%, 10%, and 15% w/vol. The s factor was the storage time at 10°C which was 0, 5, 10, and 15 d. The results showed the pH and moisture during storage decreased, while the protein content, weight loss, tenderness, and the bacterial count sausages increased. Increasing the level of edible coating to hold sausage weight loss, while the pH and bacterial count of chicken sausage decrease. Increase the level of edible coating adds to the water content, protein content, and sausage tenderness. The use of a combined edible coating of bovine split hide gelatin and soy protein isolate with the addition of the enzyme transglutaminase to 15% could maintain the quality of chicken sausage based on national standard during 15 dof chilled storage BSN-3820-2015.

Red beetroot is rich in phenolic acids and betalain as natural food-coloring agents. Freeze-dried red beetroot that ground into powder can be used as a source of natural coloring to substitute the use of synthetic food color additives as well as filler to substitute tapioca. This study evaluates the function of red beetroot powder not only as filler but also as coloring agent on chicken sausage. Furthermore, its effects as filler (tapioca and beetroot) were also observed on the physical and sensory characteristics of the produced chicken sausage. The substitution of tapioca flour and beetroot powder in this study were 18:0, 17:1, 16:2, and 15:3 (%:%). Each treatment was consisted of three replications. The examined physical properties include pH, water-holding capacity (WHC) and sensory properties. The study found that WHC, color, texture profile and sensory properties were influenced by the increasing level of beetroot flour ratio, while different ratios had no effect on the pH. Chicken sausages made with higher ratio of beetroot flour had good acceptability on flavor and color. The conclusions of this study were substitution tapioca with 2% beetroot powder influenced physical quality (water holding capacity and tenderness) and sensory (color and flavor) of chicken sausage.

Wild boar meat (WBM) is non-halal meat widely abused in Indonesia. The most common case is mixing beef with WBM either in raw or processed foods. Therefore, it is necessary to develop a detection method of WBM contamination. The objective of this study was to employ polymerase chain reaction (PCR) and sequence analysis using species specific primer (SSP) targeting on wild boar mitochondrial cytochrome-b (CYTBWB2-wb) gene for the identification of WBM in a meatball. The specificity of primer was tested, and the amplicon size was confirmed with conventional PCR and agarose electrophoresis. The base sequences were analyzed using GeneStudio software and subjected to BLAST using NCBI. CYTBWB2-wb primer was also used to test the reference meatballs made from beef and WBM using real-time PCR. The result showed that CYTBWB2-wb amplified wild boar Cyt-B mt-DNA gene specifically. The amplicon size was 194 base pair (bp) with a similarity of 93–98% toward gen Cyt-B mt-DNA of several wild boar types. The primer is able to detect WBM on the reference meatballs up to 0.1% wt/wt with efficiency value of 108.0% and coefficient of determination (R2) of 0.970. The CYTBWB2-wb primer proved to be specific and could be used as a standard method to identify the presence of WBM contamination in meatball products for halal authentication studies.

Bovine and porcine gelatin are usually used as ice cream stabilizer. However, Muslims are forbidden to consume foods that contain porcine or its derivatives product. Hence, in our previous study, we developed a technique to produce gelatin from local sources such as fish, buffalo, and bovine. This study aimed to determine the effect of various gelatin on the physical, chemical, and sensory properties of ice cream. Bovine, fish, and buffalo gelatin with the same concentration of 0.3% are added as ice cream stabilizer. We evaluated the overrun, melting rate, viscosity, as well as the nutrient content. The sensory properties were tested using a hedonic test using a 7-point scale. The substitution of carboxymethyl cellulose (CMC) with various gelatin did not affect the overrun, the melting rate, ash and protein content as well as sensory attributes (p>0.05). On the other hand, ice cream with various gelatin significantly affected the viscosity, moisture, fat, and carbohydrate content (p

Leather products are parts of daily fashion in Indonesia, such as bags, shoes, jackets, and gloves. Adulteration of raw materials for leather products can occur if there are no labels on these products. Various methods such as PCR, GC-MS, HPLC, and FTIR have been carried out to distinguish the origin of leather products. The FTIR method is known as an easy and inexpensive method to use. The objective of this study was to evaluate the capability of FTIR spectroscopy and Principle Component Analysis (PCA) for lipid identifcation and initial analysis to distinguish the original materials on leather products. Lipid extracts obtained from the various skin were scanned using an FTIR spectrophotometer at 4000–450 cm-1. It resulted in spectral differences in several wavenumbers (3000-2800 cm-1 and 1200-1000 cm-1). The same result is also found in lipid spectra from leather product extraction. The FTIR spectroscopy and PCA can differentiate pigskin and goatskin through specifc peaks in infrared spectra. This can be used as an initial analysis on determining the existence of skin adulteration in leather products. This study is prospective to be continued by chemometrics as quantitative analysis.

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/μL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The repeatability analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency value of 206 %. These figures confirm that the method employed in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.

Objective: The objective of this study was to employ real-time or quantitative polymerase chain reaction (q-PCR) using novel species specific primer (SSP) targeting on mitochondrial cytochrome-b of wild boar species (CYTBWB2-wb) gene for the identification of non-halal meat of wild boar meat (WBM) in meatball products. Materials and Methods: The novel SSP of CYTBWB2-wb was designed by our group using PRIMERQUEST and NCBI software. DNA was extracted using propanol-chloroform-isoamyl alcohol method. The designed SSP was further subjected for validation protocols using DNA isolated from fresh meat and from meatball, which include specificity test, determination of efficiency, limit of detection and repeatability, and application of developed method for analysis of commercially meatball samples Results: The results showed that CYTBWB2-wb was specific to wild boar species against other animal species with optimized annealing temperature of 59°C. The efficiency of q-PCR obtained was 91.9% which is acceptable according to the Codex Allimentarius Commission (2010). DNA, with as low as 5 pg/μl, could be detected using q-PCR with primer of CYTBWB2-wb. The developed method was also used for DNA analysis extracted from meatball samples commercially available. Conclusion: q-PCR using CYTBWB2-wb primers targeting on mitochondrial cytochrome-b gene (forward: CGG TTC CCT CTT AGG CAT TT; Reverse: GGA TGA ACA GGC AGA TGA AGA) can be fruitfully used for the analysis of WBM in commercial meatball samples. [J Adv Vet Anim Res 2019; 6(3.000): 300-307]

This study intends to find out the impact of green tea leaves’ concentration and heating temperature on the physical quality of the antimicrobial edible film (AmEF) made from chicken bone gelatin. This study also utilizes chicken bone waste, in oder to increase both monetary value and the usefulness of that waste. The bone gelatin will then be utilized as AMeF and combined with green tea leaves’ extract (Camellia sinensis) that used as sausage wrapper. Several stages have been taken placed as follow: chicken bone gelatin production; green tea leaves extraction; and tea leaves’ extract-AMeF production. cCompletely randomized design with the factorial pattern was used in this study. Data was statistically analyzed using uni-variate analysis with 5% significance rate. Duncan’s Multiple Range Test (DMRT) will later be used to further test if there is a difference between each treatment. The physical qualities of AmEF that tested in this study include clarity, color, and thickness. The result of this study shows that a clarity value of AmEF was ranged between 0.62-2.12 abs, color was 0.87-2.60 abs, and 0.015-0.023 mm of thickness. The addition of tea extract and heating temperature have significant (P

Contamination that decreased chicken meat quality could be prevented using natural preservatives. Bay leaves (Syzygium polyanthum) contain volatile fatty acids, tannin, and flavonoid that possess bacteriological and fungicidal activity as well as preventing bacterial spore growth. The purpose of this study was to determine the effect of fresh bay leaf infusion on microbiological, chemical, and physical qualities of chicken meat. This study used bay leaves, water, chicken meat, eight strain of bacteria, chemicals and materials for the analysis of chicken meat. The experiment consisted of two steps, the first was the antibacterial properties of bay leaves and the second was the application of bay leaf infusion for chicken meat. Eight bacteria was used for the bacterial inhibition of bay leaf at the concentration of 0, 5, 10, 15 and 20%. The experiment on antibacterial properties of bay leaf (Syzygium polyanthum) used one way randomized design with five concentration treatments, while the application of bay leaf infusions on chicken meat using factorial completely randomized design 2x5 (2 types of soaking and 5 observation time). At the second step, chicken meat was divided into 2 groups, the first group was soaked in water only and the second group was soaked in 15% bay leaf infusion. They were then stored for 0 (control), 2, 4, 6, and 8 hours at the room temperature. Each treatment was repeated four times. The microbiological, chemical, physical qualities of chicken meat were observed. The results showed that bay leaf infusion had the ability to inhibit the growth of bacteria (P

The aim of this study was to determine of cattle and buffalo species based on cytochrome b gene using PCR-RFLP. Cattle and buffalo hides were obtained from a slaughterhouse in Yogyakarta and Kudus Regency. To confirm the effectiveness and specificity of this fragment, there are seven of DNA mixture samples in various levels. Isolate DNA samples were amplified using universal primer of cytochrome b gene, then PCR amplicon was digested by RsaI restriction enzyme.. The result showed that mitochondrial cytochrome b gene successfully amplified fragments of 359 bp. RsaI restriction enzyme was able to cleave buffalo cytochrome b gene into two fragment (326 and 23 bp), while the cytochrome b gene of the skin cattle DNA was uncleaved. . In conclusion, this study indicated that mixture DNA of cattle and buffalo hides could be digested by RsaI restriction enzyme and determination of the buffalo hides in mixture samples could be detected into 10% level. Furthermore, RsaI enzyme could be used to specific identification buffalo species. PCR-RFLP technology has a potential and reliable method to identify of the existence of r buffalo hides in the mixture with other hides.

This study examined the characteristics of the edible film mixture gelatin bovine split hide and soy protein isolate, cross-linked using transglutaminase enzyme with addition level of glycerol as a plasticizer.The material used gelatin combination (Gelatin bovine split hide: soy proteinisolate = 90: 10 with 30 Utransglutaminase enzyme levels ), and glycerol. Data were analyzed using completely randomized design each treatment was replicated thrice of glycerol as a treatment level ( 10%, 20% dan 30%). The results showed that the glycerol level significantly affected the thickness, elongation, solubility, degree of cross-linking and WVTR, but not the tensile strength.The addition of glycerol causing the film becomes more elastic and the surface is more homogeneous and compact. Increasing the level to 30% glycerol affects the mechanical properties of an edible film.

This research was carried out to examine the functional properties of beef lung protein concentrates. The extraction was performed as a function of pH and time. The pI method was applied in the precipitation of proteins from beef lung. Beef lung protein concentrates contained 85.13% protein. The functional properties of the protein concentrates were compared to those of some commercial ingredients as whey protein concentrates, and casein. Protein from beef lung exhibited better foaming property than casein and better emulsifying property than whey protein. The use of beef lung proteins appears to be an interesting opportunity to obtain added value slaughterhouse by-products.

Consumer awareness in meat and meat products is generally recognized as a good source of food, with high biological value protein, B group vitamins, minerals and minor elements like several other bioactive compounds that are beneficial to the human body. But in many cases, a processing error is affecting the bioactive compounds of functional foods and consumer impression are relatively negative to some levels of substances in meat such as fat, cholesterol, saturated fatty acids, salt and other substances, which however also involves a diseases of western society such as cardiovascular diseases, respiratory, carcinogenesis, obesity, impaired immune system and accelerate the aging process. Hence there is a need for adequate information related to favorable nutritional value of meat that has not been widely disclosed. Bioactive components in the meat can be anserin, karnosin and bioactive peptides. The generation of bioactive components in the meat in the form of bioactive peptides can be done in three ways: (1) aging or storage of meat, (2) meat fermentation, and (3) the enzyme treatment. Functional properties of bioactive components in meat varies greatly as an antioxidant, antihypertensive, antimicrobial, anticancer and immunomodulatory.

This research aimed to investigate the rabbit meat hydrolysate potential as an angiotensin-converting enzyme (ACE) inhibitor. Indonesian local rabbit meats were used in this study. The research was conducted in Department of Animal Product Technology, Faculty of Animal Science, Universitas Gadjah Mada, from August 2016 to February 2017. The local rabbit meats were hydrolyzed by pepsin, trypsin, and pancreatic. The obtained hydrolysates were then analyzed to identify the water-soluble protein content. The molecular weight of the hydrolysates were also confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The ACE inhibitory properties of the hydrolysates were analyzed in vitro. The results showed that pepsin, trypsin, and pancreatic hydrolysis showed a significant effect on the water-soluble protein content of rabbit meat (p

The objective of this study was to evaluate the application of the use optimization methods of Simplex Lattice Design (SLD) with special cubic models in the preparation formula of hard capsule based on goatskin gelatin. Three types of filler materials have been used in the manufacture of capsule shells, namely MgCO3, tapioca starch (TS) and sago starch (SS). The basic ingredient was uses goatskin gelatin and aquadest as a solvent. The material formulation was calculated according to Simplex Lattice Design (SLD) using the equations Y = β1 (A) + β2 (B) + β3(C) + β12 (A)(B) + β13 (A)(C) + β23 (B)(C) + β123 (A)(B) (C). Based on these equations obtained seven formulas (three proportions formula 100% each component, three proportional formulas 50%: 50% for the mixture of two components and one formula 33.33% for the mixture of three components). The results obtained data related to the proportion of filler use in a mixture of materials. The superimposed contour plot shows that the proportion of the use of three types of filler (MgCO3: TS: SS) in each mixture are (0.224 part: 0.055 part and 0.721 parts). Next, after further testing of the formula is then obtained properties of the capsule shell prototype, namely: thickness (0.35 mm), solubility (66.64%), and water vapor transmission rate (WVTR) (0.67 g.H2O.m-2 h-1). The data obtained that the type of SS filler is the most dominant factor influencing in increasing the thickness and solubility properties of the capsule shell, while the filler TS is the most dominant increase in the nature of WVTR. The results of the study concluded that the application of the SLD optimization method could be applied in the preparation of hard capsule formulations made from goatskin gelatin with better properties.

Methanol dehydrogenase (MDH) enzyme was purified from Bradyrhizobium japonicum USDA110 cell-free extract. The bacteria were grown in a culture medium with direct 0.5% methanol addition aimed to stimulates the MDH catalytic enzyme activation. Bradyrhizobium japonicum USDA110 MDH enzyme was purified by using 25 mM 2-(N-morpholine) ethanesulfonic acid/MES pH 5.5 buffer and 1 M sodium chloride/NaCl which separated into three columns, the first column was PD-10 for buffer exchange; the second column was HiTrap Sepharose HP to obtain unbonded fraction in the column; and the third column was Mono S 5/50 GL integrated with two pumps HPLC (high-performance liquid chromatography) to obtain pure MDH enzyme for serial changing of 1 M NaCl-25mM MES pH 5.5 with the flow rate at 1 ml/min. The protein concentration and MDH catalytic enzyme activity were observed on each purification process starting from the cell-free extract to pure MDH enzyme. The pure MDH enzyme was obtained by Mono S 5/50 GL-HPLC purification which showed a single band on SDS PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The MDH enzyme purification from Bradyrhizobium japonicum USDA110 showed 90-fold purification, a sub-molecular weight of 63 kDa, specific activity at 2.69 U/mg, and optimum activity at a 35oC temperature and pH 9.

The aim of this research was to optimize the protease purification from Bacillus cereus TD5B by ammonium sulfate precipitation. The material used was protease enzyme from Bacillus cereus TD5B. It was produced and purified in a liquid medium using ammonium sulfate precipitation. The optimization was performed using various levels (50, 60, 70 and 80 %) of ammonium sulfate as precipitation agent of crude microbial enzymes. Separation process of precipitate and supernatant was conducted by 3,500 rpm centrifugation for 30 min at 4°C. The specific activity of protease enzyme, and protein content was observed on precipitate and supernatant of each levels treatment of the ammonium sulfate. Based on specific enzyme activity and protein content, the measurement showed that 70 % ammonium sulfate level treatment has the highest specific enzyme activity (78.296 U/mg) and highest protein content (2.689 mg/mL). This specific enzyme activity was three times higher compared to specific enzyme activity before purification treatment (24.12 U/mg). In conclusion, the purification of crude Bacillus cereus TD5B enzyme by ammonium sulfate purification can increase the specific enzyme activity.

Acid soluble collagen (ASC) from Indonesian Local of “Kacang” Goat skin was extracted and characterized. The skin was obtained from local slaughter house. Optimization of collagen extraction was investigated using one factor of response surface methodology. One hundred grams of skin was extracted with 0.5 M acetic acid for 24, 48, 72 h. The extract was filtered with Whatman No.1 paper. The collagen was precipitated by adding NaCl to final concentration of 2.6 M. The resulting sediment was collected by centrifuging at 7,000 g for 30 min and then re-dissolved in 0.5 M acetic acid. The resulting solutions were dialyzed with 0.1 M acetic acid and distilled water sequentially. The properties of Goat skin collagen were characterized by amino acid analysis, FT-IR, and scanning electron microscopy (SEM). The optimal condition to obtain the highest yield of acid soluble collagen was 48 h hydrolysis. The result of the research showed collagen contained 30.52 glycineresidues/1,000 residues amino acid and this amino acid is a major amino acid residue in collagen. FT-IR spectra showed regions of amides A, I, II, and III were 3,433.04, 1,631.66, 1,550.65, and 1,404.07cm-1 respectively. The scanning electron microscopy of goat skin collagen revealed a complicated network. Inconclusion “Kacang” goat skin displayed suitable source of collagen.

This research aims to understand the effect of metal ions bioabsorption which belong on different elemental groups to the methanol dehydrogenase (MDH) enzymatic activity in nitrogen-fixing bacteria Bradyhizobium japonicum USDA 110. Ten metal ions with each have 30μM concentration were added to grow Bradyhizobium japonicum USDA 110 in 10-1 diluted nutrient medium. The MDH activity test showed a similar result between the bacteria grown in medium without metal ions addition (control) and the bacteria were grown in a calcium ion/Ca2+ added media. The highest MDH enzymatic activity was shown on the bacteria grown in a magnesium/Mg2+ added medium, which showed 0.08 (U/mg) enzymatic activities. The addition of magnesium/Mg2+ metal ion accelerates the bacterial growth by 2.6 times and MDH activity by 1.28 times compared to control. The MDH enzyme is essential, especially for bacteria which exist in the soil environment, to adapt to high methanol concentration and to support bacterial anaerobic growth capacity along with plant symbiotic process. Moreover, the MDH activity staining method could also act as pollutant indicators like metal ions and hydrocarbon derivates. This research concluded that metal ions biosorption (calcium/Ca2+ and magnesium/Mg2+) are required for bacterial cells reproduction and oxidation of single carbon chain compounds like methanol. The nitrogen-fixing symbiotic bacteria, Bradyhizobium japonicum USDA 110 showed high MDH activity after the two metal ions absorption. However, contrary results were shown on vanadium/V3+, manganese/Mn2+, iron/Fe3+, copper/Cu2+, zinc/Zn2+, and aluminum/Al3+ absorption, which showed low MDH activity and cells biomass.

Society services activity on cattle waste management system have been implemented in Sido Mulyo Livestock Farmers Group at Pulosari, Jumoyo, Salam, Magelang. Animal byproducts that consist of feces and urine of cattle wastewas processed into organic fertilizer compost and liquid fertilizer. Sido Mulyo Livestock Farmer Group has one unit of 20 m3 biodigester to accommodate the feces from approximately 30 cattle owned by the group member. Biogas has been used as a fuel source for family group members located around the cage. Slurry resulted from anaerobic digestion of biodigester disposed to pastures located on the right side of the cage. Ownership system in the groupis every group member hasa responsibility for taking care of their own cattle. The number of livestock owned by each member of the SidoMulyoLivestock Farmers Group ranged between 1 to 4 cattle. Society services methods that have been implemented was in the form of mentoring for a member of the Sido Mulyogroup.The other activities that have been implemented was the training and development of cattle industry, especially the handling of livestock waste in the form of feces, urine, and the feed residue. The activities was continued by the manufacture of compost packaging design, followed by the last series of activities such as monitoring and program development. The enthusiasm of the group members in joining to the extension activities is very good. The timing of the extension are determined in the afternoon after members of the group have finished searching feed for their cattle. The sustainability forwaste processing into organic fertilizer compost and liquid organic fertilizer becomes a major concern, because it is highly dependent on consumer demand.

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

The use of glycerol as a plasticizer in the film solution mixture was identified to the physical properties of edible film. The objectives of this study was to evaluate the physical characteristics of edible films using gelatin from Bligon goat skin as a raw material with glycerol as a plasticizer. The experiment was conducted in a laboratory experiment using completely randomized design (CRD) method. There were three concentrations of glycerol as a plasticizer, namely: 80%, 90% and 100% (calculated from the amount of gelatin is 9%). The variables of this study were thickness, tensile strength and elongation et break. The results of this study showed that the difference in the concentration of glycerol as a plasticizer in the gelatin of 9% gave no significant effect on the thickness and tensile strength of edible films, however very significant effect on the elongation et break. It was proven that glycerol concentration of 80% as a plasticizer had been better physically. Key words: edible film, gelatin, Bligon goat skin, glycerol, plasticizer

Artikel dalam bentuk PDF

Artikel dalam bentuk PDF

Penelitian bertujuan untuk mengetahui pengaruh perbedaan proporsi filler tepung mocaf (Modified Cassava Flour) terhadap kualitas fisik, sensoris dan kadar kolesterol nugget ampela ayam. Penelitian dilakukan dengan menggunakan 5 level filler tepung mocaf dan ampela dengan imbangan 0 : 100; 5 : 95; 10 : 90; 15 : 85; dan 20 : 80. Data yang diambil adalah kualitas fisik (pH, keempukan, daya ikat air), kualitas sensoris (warna, rasa, tekstur, daya terima) dan kadar kolesterol. Data kualitas fisik dan kadar kolesterol dianalisis dengan analisis variansi Rancangan Acak Lengkap pola searah atau One Way Anova dan data kualitas sensoris dianalisis dengan analisis non-parametrik dengan uji Hedonik Kruskal Wallis. Perbedaan rerata diuji dengan uji Duncan’s New Multiple Range Test. Hasil penelitian menunjukkan bahwa perbedaan level filler tepung mocaf berpengaruh pada penurunan keempukan dan peningkatan daya ikat air tetapi tidak mempengaruhi nilai pH. Peningkatan level filler tepung mocaf meningkatkan skor tekstur tetapi tidak mempengaruhi warna, rasa dan daya terima. Peningkatan level filler tepung mocaf tidak berpengaruh terhadap penurunan kadar kolesterol nugget ampela. Kesimpulan dari penelitian adalah bahwa makin tinggi level filler tepung mocaf yang ditambahkan pada nugget ampela akan meningkatkan daya ikat air dan tekstur serta menurunkan keempukan, tetapi tidak merubah daya terima dan kadar kolesterol dari nugget ampela. (Kata kunci: Nugget ampela, Filler, Tepung mocaf, Kualitas fisik, Kualitas sensoris, Kadar kolesterol)

Penelitian bertujuan untuk mengetahui pengaruh penggunaan minyak buah merah (MBM) pada pakan terhadap penampilan produksi ayam broiler. Delapan puluh ekor ayam broiler umur sehari (DOC) ditempatkan pada empat kelompok perlakuan pakan yang berbeda, yaitu: P0 (pakan kontrol/tanpa penambahan minyak), P1 (2% MBM), P2 (4% MBM), dan P3 (6% MBM). Setiap kelompok perlakuan terdiri dari empat ulangan masing-masing dengan lima ekor. Ayam broiler dipelihara selama 41 hari. Rancangan yang digunakan adalah Rancangan Acak Lengkap (RAL) dengan analisis variansi pola searah dan diuji lanjut dengan Duncan’s New Multiple Range Test (DMRT). Hasil penelitian menunjukkan bahwa konsumsi pakan berbeda nyata (P

File lengkap ada dalam bentuk PDF dibawah ini

File lengkap ada dalam bentuk PDF dibawah ini

Penelitian ini bertujuan untuk mengetahui pengaruh jus daun sirih (Piper betle Linn) pada proses precuring dan lama penyimpanan terhadap komposisi kimia dan angka peroksida dendeng ayam petelur. Daging direndam jus daun sirih (0, 5, 10, dan 15%) kemudian diolah menjadi dendeng. Produk dendeng disimpan pada suhu kamar selama 0, 2, 4, 6, dan 8 minggu. Variabel yang diukur meliputi kadar air, kadar protein, kadar lemak, pH, dan angka peroksida. Rancangan penelitian yang digunakan adalah Rancangan Acak Lengkap pola faktorial 4 x 5 dan dilanjutkan dengan uji Tukey. Hasil penelitian menunjukkan bahwa semakin tinggi konsentrasi jus daun sirih berpengaruh nyata (P

Penelitian bertujuan memanfaatkan gelatin kulit kaki ayam yang dikombinasikan dengan soy protein isolate sebagai bahan baku edible film. Materi penelitian adalah gelatin kulit kaki ayam dan soy protein isolate. Penelitian terbagi atas dua tahap yaitu tahap pertama adalah pembuatan gelatin kulit kaki ayam yang direndam dengan NaOH 0,1%, asam sulfat 0,1%, dan asam sitrat 0,4%. Tahap kedua yaitu pembuatan edible film yang dikombinasikan dengan soy protein isolate pada perbandingan (75:25, 80:20, 85:15, 90:10, dan 95:5). Analisis data mengunakan variansi pola searah, apabila terdapat beda nyata diteruskan uji Duncan’s New Multiple Range Test. Profil protein dianalisis dengan SDS-PAGE dan menunjukkan sebagai molekul kolagen. Hasil analisis kandungan asam amino edible film menggunakan HPLC dihasilkan komposisi residu asam amino terbesar adalah glysin yaitu 29,42%, 37,88%, 38,32%, 39,28% dan 39,17% pada masing-masing perlakuan. Hal itu menggambarkan bahwa profil protein edible film dapat dipastikan sebagian besar berasal dari kolagen gelatin. Pengamatan dengan scaning electron microscope menunjukkan telah terbentuk cross linking antara molekul protein gelatin dan molekul soy protein isolate dan yang ditunjukan semakin berkurangnya retakan seiring dengan meningkatnya konsentrasi gelatin. Perbedaan kombinasi gelatin kulit kaki ayam dan soy protein isolate untuk membentuk edible film tidak memberikan pengaruh nyata pada kekuatan tarik (tensile strenght), dan kemuluran (elongation), namun berpengaruh nyata pada laju transmisi uap air (Water Vapour Transmision Rate). Kombinasi 95:5 protein gelatin kulit kaki ayam dan soy protein isolate menghasilkan edible film yang terbaik. (Kata kunci: Edible film, Gelatin kaki ayam, Soy protein isolate)

The objective of the experiment study was to determine the effect of canary shell liquid smoke on the chemical, physical and sensory qualities of beef stored at room temperature. Beef samples were dipped in liquid smoke solution with the concentration of 0, 4, 8, and 12% (v/v) during 15 minutes and then stored for 0,2, and 4 days at room temperature. Each treatment was carried out three times and the variables measured were water, phenol and acid content, pH, water-holding capacity, cooking loss and sensory properties of samples. Data on chemical and physical qualities were analyzed using analysis of variance (Completely Randomized Design/CRD) with factorial 4x3. The sensory properties were analyzed by a non parametric h-test. The results showed that liquid smoke concentration up to 12% significantly (p

Gelatin is a product of hydrolysis of collagen protein from animals that are partially processed. Gelatin used in food and non food industries. Gelatin is produced when many import of raw skins and bones of pigs and cows. Goat skins potential as a raw material substitution that still doubt its halal. Process production of gelatin determine the properties of gelatin. The objectives of this research were to determine amino acid profile, group of functional and molecular weight distribution of gelatin made from goat skins which was produced through a process of acid. The skin of male Bligon goat, 1.5 to 2.5 year old was used as raw materials. Process production of gelatin was using acid type acetic acid (CH3COOH 0.5 M) (v/v) as curing material. The experimental design applied in this study and commercial gelatin was used as control. The results showed that gelatin produced from goat skin through the process of acid had properties identical with commercial gelatin. It can be concluded that the gelatin has the potential substitute product of commercial gelatin. Keywords: collagen, gelatin, goat skin, curing, acid process

A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10%) was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b) gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR) method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang menghasilkan fragmen DNA sebesar 359 bp. Untuk mengetahui ada tidaknya kontaminasi babi dalam adonan daging tersebut diaplikasikan enzim restriksi BseDI yang dapat memotong DNA dari gen cytochrome b babi. Hasil penelitian menunjukkan bahwa gen cytochrome b dari babi dapat terpotong menjadi dua fragmen yaitu sebesar 228 bp dan 131 bp. Untuk desain primer spesifik digunakan gen amelogenin yang mempunyai sekuen yang berbeda diantara ke empat spesies uji yaitu babi, sapi, ayam dan kambing. Primer spesifik didesain pada panjang fragmen sebesar 353 dan 312 bp. Hasil penelitian menunjukkan bahwa kontaminasi daging babi sebesar 1% masih dapat terdeteksi dengan metode PCR-RFLP tetapi pengujian dengan primer spesifik yang ditujukan hanya untuk deteksi DNA babi masih menunjukkan reaksi silang dengan spesies hewan lain yaitu sapi, kambing dan ayam. Pengujian dengan PCR-RLP pada gen cytochrome b menghasilkan hasil yang lebih baik dan jelas untuk pengujian kontaminasi babi dibandingkan dengan PCR dengan primer spesifik. Metode PCR-RFLP merupakan metode yang potensial untuk analisis deteksi keberadaan unsur babi pada produk olahan pangan khususnya untuk deteksi status kehalalan. Kata kunci: Identifikasi, daging babi, gen cytochrome b, amelogenin, polymerase chain reaction