Search

Numerous studies confirmed that aberrant microRNA (miRNA) expression contributes to cancer development and progression. We carried out this study to explore the expression profile of miRNAs in intermediate risk acute myeloid leukemia (AML) and locate certain miRNAs as biomarkers. We profiled differentially expressed miRNAs by performing miRNA sequencing analysis in the patients' samples. Bioinformatic analysis showed the most significantly expressed genes mostly involved in cellular component organization, cell differentiation, and cell development. Reverse-transcription polymerase chain reaction validated the expression of miR-582-5p in different groups of AML samples. It was confirmed that miR-582-5p was downregulated in newly diagnosed AML and relapse/refractory AML compared with CR AML or controls. Among intermediate risk AML patients with normal cytogenetics, a lower level of miR-582-5p is correlated with an unfavorable outcome, and a shorter overall survival. Gain- and loss-of-function experiments revealed that miR-582-5p could inhibit proliferation, suppress migration, and invasion ability and induce apoptosis of leukemia cells. Furthermore, overexpression of miR-582-5p can increase sensitivity of cells to Ara-C. In conclusion, miR-582-5p can serve as an antioncogenic biomarker in intermediate risk AML with normal cytogenetics for risk classification and outcome prediction. These results showed a novel role for miR-582-5p in predicting the prognosis and promoting the tumor growth of AML.

Intensity-modulated radiotherapy (IMRT) is one of the most popular techniques for cancer treatment. However, existing IMRT planning methods can only generate one solution at a time and, consequently, medical physicists should perform the planning process many times to obtain diverse solutions to meet the requirement of a clinical case. Meanwhile, multiobjective evolutionary algorithms (MOEAs) have not been fully exploited in IMRT planning since they are ineffective in optimizing the large number of discrete variables of IMRT. To bridge the gap, this article formulates IMRT planning into a large-scale combinatorial many-objective optimization problem and proposes a coevolutionary algorithm to solve it. In contrast to the existing MOEAs handling high-dimensional search spaces via variable grouping or dimensionality reduction, the proposed algorithm evolves one population with fine encoding for local exploitation and evolves another population with rough encoding for global exploration. Moreover, the convergence speed is further accelerated by two customized local search strategies. The experimental results verify that the proposed algorithm outperforms state-of-the-art MOEAs and IMRT planning methods on a variety of clinical cases.

Multiple myeloma (MM), the second most commonly diagnosed hematologic neoplasm, is the most significant clinical manifestation in a series of plasma cell (PC) dyscrasia. Monoclonal gammopathy of undetermined significance (MGUS) and smoldering MM (SMM), approximately 1% or 10% of which, respectively, can progress to MM per year, are the premalignant stages of MM. The overall survival (OS) of MM is significantly improved by the introduction of proteasome inhibitors (PIs), but almost all MM patients eventually relapse and resist anti-MM drugs. Therefore, it is crucial to explore the progression of MM and the mechanisms related to MM drug resistance. In this study, we used weighted gene co-expression network analysis (WGCNA) to analyze the gene expression of the dynamic process from normal plasma cells (NPC) to malignant profiling PC, and found that the abnormal gene expression was mainly concentrated in the proteasome. We also found that the expression of one of the proteasomal subunits PSMB7 was capable of distinguishing the different stages of PC dyscrasia and was the highest in ISS III. In the bortezomib (BTZ) treated NDMM patients, higher PSMB7 expression was associated with shorter survival time, and the expression of PSMB7 in the BTZ treatment group was significantly higher than in the thalidomide (Thai) treatment group. In summary, we found that PSMB7 is the key gene associated with MM disease progression and drug resistance.

Multiple myeloma (MM) is an incurable disease caused by the infiltration of malignant plasma B cells into bone marrow, whose pathogenesis remains largely unknown. Long non‑coding RNAs (lncRNAs) have emerged as important factors in pathogenesis. Our previous study validated that lncRNA ST3 β‑galactoside α‑2,3‑sialyltransferase 6 antisense RNA 1 (ST3GAL6‑AS1) was upregulated markedly in MM. Therefore, the aim of the study was to investigate the molecular mechanisms of ST3GAL6‑AS1 in MM cells. ST3GAL6‑AS1 expression levels in MM cells was detected using reverse transcription‑quantitative PCR. ST3GAL6‑AS1 antisense oligonucleotides and small interfering RNAs were transfected into MM cells to downregulate expression. In vitro assays were performed to investigate the functional role of ST3GAL6‑AS1 in MM cells. RNA pull‑down, RNA immunoprecipitation and comprehensive identification of RNA‑binding proteins using mass spectrometry assays were used to determine the mechanism of ST3GAL6‑AS1‑mediated regulation of underlying targets. It was reported that knockdown of ST3GAL6‑AS1 suppressed the adhesion, migration and invasion ability of MM cells in vitro. Expression of ST3GAL6 was significantly reduced when ST3GAL6‑AS1 was knock downed in MM cells. Moreover, mechanistic investigation showed that ST3GAL6‑AS1 could suppress ST3GAL6 mRNA degradation via interacting with heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1). The present results suggested that upregulated lncRNA ST3GAL6‑AS1 promotes adhesion and invasion of MM cells by binding with hnRNPA2B1 to regulate ST3GAL6 expression.

Introduction: Circular RNAs (circRNAs) are a novel class of RNAs which occupy gene expression at the transcriptional or post-transcriptional level, involve in many physiological processes, and participate in many diseases, especially in cancer. Our previous study showed 1 altered circRNA named circ-anaphase promoting complex subunit 7 (ANAPC7) that was upregulated in acute myeloid leukemia (AML). To further clear the expression and clinical significance of circ-ANAPC7, we enlarged the sample size and illuminated the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. We assessed the correlation of circ-ANAPC7 and clinical variables using the Spearman correlation test. The receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Results: Circ-ANAPC7 was first found to be upregulated in AML, and its expression was correlated to white blood cell counts in peripheral blood and blast percentage in bone marrow. ROC curve analysis revealed that circ-ANAPC7 has a significant value of auxiliary AML diagnosis (area under the curve = 0.915, p < 0.001). Furthermore, the expression level of circ-ANAPC7 was changed accompanied with disease condition transformation. Conclusion: Circ-ANAPC7 was upregulated in newly diagnosed and relapsed AML. It may serve as potential biomarkers for AML patient’s diagnosis and monitoring.

Multiple myeloma (MM) is a disease in which abnormal plasma cells proliferate and secrete monoclonal immunoglobulin in the bone marrow. The main characteristic of plasma cells is the expression of the cell surface antigen syndecan-1 (CD138). However, the expression of CD138 is limited to terminally differentiated plasma cells during B cell development. A small subpopulation (2~5%) of human MM cells that lack CD138 expression has been shown to possess enormous proliferation potential in vitro experiment and in animal models, and they also can differentiate into CD138+ plasma cells. Thus, this small subset of MM cells was regarded as myeloma cancer stem cell (MCSC). However, its characteristics associated with the pathogenesis of MM remain unclear. In this study, we analyzed the gene expression data of CD138 cell lines downloaded from Gene Expression Omnibus (GEO) database. Limma package in RStudio was used to identify differentially expressed genes (DEGs). Genes enrichment and protein-protein interaction (PPI) network analysis were performed on DAVID and STRING databases. Furthermore, overall survival (OS) analysis in MM patient was utilized to screen out the hub-genes closely associate with the MM pathogenesis process. Hub-genes expression validation and receiver operating characteristic curve (ROC) analysis was performed in different stages of plasma cell disorder diseases. Finally, we verified these findings in MM patient samples. Through integrated bioinformatics analysis of MM CD138- and CD138+ cell lines, we found that CDC7, CDK1, and CHK1 are highly expressed in CD138- MM cells. These genes are crucial in the G2/M phase of the cell cycle pathway, which is closely related to the malignant proliferation in various tumor cells. Of note, we found that patients with high expression of CDC7, CDK1, and CHK1 had shorter overall survival time. The expression of CHK1 was significantly increased in MM cells compared with normal plasma cell (NPC) and MGUS. More importantly, we further clarified that the expression of CHK1 in release/refraction MM (R/R MM) has obviously increased compared with new diagnosed MM (ND MM).

Background Multiple Myeloma (MM) is a hematologic malignant disease whose underlying molecular mechanism has not yet fully understood. Generally, cell adhesion plays an important role in MM progression. In our work, we intended to identify key genes involved in cell adhesion in MM. Methods First, we identified differentially expressed genes (DEGs) from the mRNA expression profiles of GSE6477 dataset using GEO2R with cut-off criterion of p Results First of all, 1383 DEGs were identified. Functional and pathway enrichment analysis suggested that many DEGs were enriched in cell adhesion. 180 overlapped genes were screened out between the DEGs and genes in GO terms of cell adhesion. Furthermore, 12 genes were identified as hub genes based on a PPI network analysis. ROC curve analysis demonstrated that ITGAM, ITGB2, ITGA5, ITGB5, CDH1, IL4, ITGA9, and LAMB1 were valuable biomarkers for the diagnosis of MM. Further study demonstrated that ITGA9 and LAMB1 revealed prognostic values and clinical correlation in MM patients. GSEA and transcription factor (TF) prediction suggested that MYC may bind to ITGA9 and repress its expression and HIF-1 may bind to LAMB1 to promote its expression in MM. Additionally, pan-cancer analysis showed abnormal expression and clinical outcome associations of LAMB1 and ITGA9 in multiple cancers. Conclusion In conclusion, ITGA9 and LAMB1 were identified as potent biomarkers associated with cell adhesion in MM.

Introduction and objective To improve the complete remission (CR) rate of newly diagnosed acute myeloid leukemia (AML) patients and alleviate the severe side effects of double induction chemotherapy, we combined a standard regimen with granulocyte colony-stimulating factor (G-CSF) priming chemotherapy to compose a new double induction regimen for AML patients who failed to achieve CR after the first course. Patients and methods Ninety-seven patients with AML who did not achieve CR after the first course of standard chemotherapy were enrolled. Among them, 45 patients received G-CSF priming combined with low-dose chemotherapy during days 20–22 of the first course of chemotherapy, serving as priming group, 52 patients were administered standard chemotherapy again, serving as control group. Results Between the two groups there were no differences in the French–American–British (FAB) classification, risk status, the first course of chemotherapy, blood cell count or blasts percentage of bone marrow before the second course. But the CR rate was significantly higher and the adverse effect was much lower in the priming group than the control group. Cox multivariate regression analysis showed that WBC level before the second course and the selection of the second chemotherapy regimen were two independent factors for long survival of patients. Discussion These results elucidate that standard chemotherapy followed by G-CSF priming new double induction chemotherapy is an effective method for AML patients to improve CR rate and reduce adverse effects.

Long non-coding RNAs (lncRNAs) are transcripts longer than 200 nt that are involved in tumorigenesis and play a key role in cancer progression. To determine whether lncRNAs are involved in acute myeloid leukemia (AML), we analyzed the expression profile of lncRNAs and mRNAs in AML. Five pairs of AML patients and iron deficiency anemia (IDA) controls were screened by microarray. Through coexpression analysis, differently expressed transcripts were divided into modules, and lncRNAs were functionally annotated. We further analyzed the clinical significance of crucial lncRNAs from modules in public data. Finally, the expression of three lncRNAs, RP11-222K16.2, AC092580.4, and RP11-305O.6, were validated in newly diagnosed AML, AML relapse, and IDA patient groups by quantitative RT-PCR, which may be associated with AML patients' overall survival. Further analysis showed that RP11-222K16.2 might affect the differentiation of natural killer cells, and promote the immunized evasion of AML by regulating Eomesodermin expression. Analysis of this study revealed that dysregulated lncRNAs and mRNAs in AML vs IDA controls could affect the immune system and hematopoietic cell differentiation. The biological functions of those lncRNAs need to be further validated.

Multiple myeloma (MM) is a disease in which abnormal plasma cells proliferate and secrete monoclonal immunoglobulin in the bone marrow. The main characteristic of plasma cells is the expression of the cell surface antigen syndecan-1 (CD138). However, the expression of CD138 is limited to terminally differentiated plasma cells during B cell development. A small subpopulation (2~5%) of human MM cells that lack CD138 expression has been shown to possess enormous proliferation potential in vitro experiment and in animal models, and they also can differentiate into CD138+ plasma cells. Thus, this small subset of MM cells was regarded as myeloma cancer stem cell (MCSC). However, its characteristics associated with the pathogenesis of MM remain unclear. In this study, we analyzed the gene expression data of CD138 cell lines downloaded from Gene Expression Omnibus (GEO) database. Limma package in RStudio was used to identify differentially expressed genes (DEGs). Genes enrichment and protein-protein interaction (PPI) network analysis were performed on DAVID and STRING databases. Furthermore, overall survival (OS) analysis in MM patient was utilized to screen out the hub-genes closely associate with the MM pathogenesis process. Hub-genes expression validation and receiver operating characteristic curve (ROC) analysis was performed in different stages of plasma cell disorder diseases. Finally, we verified these findings in MM patient samples. Through integrated bioinformatics analysis of MM CD138- and CD138+ cell lines, we found that CDC7, CDK1, and CHK1 are highly expressed in CD138- MM cells. These genes are crucial in the G2/M phase of the cell cycle pathway, which is closely related to the malignant proliferation in various tumor cells. Of note, we found that patients with high expression of CDC7, CDK1, and CHK1 had shorter overall survival time. The expression of CHK1 was significantly increased in MM cells compared with normal plasma cell (NPC) and MGUS. More importantly, we further clarified that the expression of CHK1 in release/refraction MM (R/R MM) has obviously increased compared with new diagnosed MM (ND MM).

Aims To investigate the role and mechanism of insulin-like growth factor 1(IGF-1)-mediated EMT on multiple myeloma (MM) growth and metastasis. Materials and methods The expression data from GEO datasets were utilized to explore the expression levels of IGF-1 and epithelial-mesenchymal transition (EMT) markers in MM. Western blotting and flow cytometry analysis were performed to detect the protein levels of EMT markers as well as key components of the PI3K/Akt pathway. Cell proliferation ability was assessed using colony formation assay and EdU incorporation assays. Transwell migration and invasion assays were performed to assess cell metastasis properties. Vimentin was knocked down by using electro-transfection with small interfering RNA (siRNA) to detect the effect of IGF-1-mediated EMT on MM cell growth and metastasis. Key findings First of all, the analysis of GEO database revealed that IGF-1 was excessively expressed and closely correlated with the expression of the EMT markers in MM patients. Furthermore, we demonstrated that IGF-1 enhanced the acquisition of mesenchymal features in a time-dependent manner. Additionally, in vitro studies revealed that IGF-1-mediated mesenchymal phenotype promoted MM migration, invasion and colony formation. Finally, the mechanism study showed PI3K/Akt signaling pathway was involved in the IGF-1-induced EMT in MM cells. Significance IGF-1-induced mesenchymal phenotype contributed to MM progression via the PI3K/Akt pathway regulation.

Proteasome inhibitor bortezomib is one of the most effective drugs currently available for the treatment of multiple myeloma (MM). However, the intrinsic and acquired resistance to bortezomib can limit its effectiveness. The activation of heat shock response has been characterized as a potential resistance mechanism protecting MM cells from bortezomib-induced cell death. In this study, in response to bortezomib therapy, we discovered that HSP70 is one of the most substantially upregulated heat shock proteins. In order to further explore approaches to sensitizing bortezomib-based treatment for MM, we investigated whether targeting HSP70 using a specific inhibitor VER-155008 combined with bortezomib could overcome the acquired resistance in MM. We found that HSP70 inhibitor VER-155008 alone significantly decreased MM cell viability. Moreover, the combination of VER-155008 and bortezomib synergistically induced MM cell apoptosis markedly in vitro. Notably, the combined treatment was found to increase the cleavage of PARP, an early marker of chemotherapy-induced apoptosis. Importantly, the reduction of anti-apoptotic Bcl-2 family member Bcl-2, Bcl-xL, and Mcl-1 and the induction of pro-apoptotic Bcl-2 family member BH3-only protein NOXA and Bim were confirmed to be tightly associated with the synergism. Finally, the ER stress marker CHOP (CCAAT-enhancer binding protein homologous protein), which can cause transcriptional activation of genes involved in cell apoptosis, was markedly induced by both VER-155008 and bortezomib. Taken together, our finding of a strong synergistic interaction between VER-155008 and bortezomib may support for combination therapy in MM patients in the future. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s12192-020-01078-0) contains supplementary material, which is available to authorized users.

Frequent loss of expression of platelet factor 4 (PF4) in multiple myeloma (MM) was revealed in several previous researches. The predictive analysis of serum PF4 level in newly diagnosed MM has not been well elucidated. This study is to assess if serum PF4 could be a prognostic factor in predicting treatment response and survival of MM treated with thalidomide and VAD regimens.Sera of 122 MM were gained pre- and post-treatment of chemotherapy and oral thalidomide. Serological PF4 measurements were performed by ELISA. Kaplan-Meier method was employed for survival analysis. Log rank test was used significance analysis. Multivariate analysis of overall survival used Cox-regression.Our data showed that the median serum PF4 concentration was negatively associated with MM response and a significant correlation between serum PF4 level and unfavorable clinical features (β2-microglobulin, ISS stage, del17p and creatinine). MM with lower serum PF4 concentration at diagnosis were prone to gain complete remission and very good partial remission after two courses of chemotherapy. Besides del17p, β2-microglobulin, treatment response, the low serum PF4 concentration was an independent variable associated with a poor overall survival by univariate analysis and multivariate analysis.We speculate serum PF4 is a promising response and prognostic factor in newly diagnosed MM treated with thalidomide and VAD regimens.

Background: The aim of this study was to detect the expression of long noncoding RNA small nucleolar RNA host gene 18 (SNHG18) andsemaphorin 5A (SEMA5A) genes in multiple myeloma (MM) patients and to explore the correlation of the expression of these genes with the clinical characteristics and prognosis of MM patients. Methods: Forty-seven newly diagnosed MM, 18 complete remission MM, 13 refractory/relapse MM, and 22 iron deficiency anemia (serving as control) samples were extracted at the Department of Hematology, Second Affiliated Hospital of Xian Jiaotong University between January 2015 and December 2016. The clinical features of the MM patients are summarized. Real-time quantitative PCR was performed to analyze the relative expression levels of the SNHG18 and SEMA5Agenes. The clinical characteristics and overall survival (OS) of the MM patients were statistically analyzed while measuring different levels of SNHG18 and SEMA5Agene expression. At the same time, the correlation between the expression of SNHG18 and SEMA5A was also analyzed. Results: The analysis confirmed that SNHG18 and its possible target gene SEMA5A were both highly expressed in newly diagnosed MM patients. After analyzing the clinical significance of SNHG18 and SEMA5A in MM patients, we found that the expression of SNHG18 and SEMA5A was related to the Durie-Salmon (DS), International Staging System (ISS), and Revised International Staging System (R-ISS) classification systems, and the Mayo Clinic Risk Stratification for Multiple Myeloma (mSMART; p < 0.05). Moreover, we observed a significant difference in OS between the SNHG18/SEMA5A high expression group and the low expression group. We found a positive correlation between SNHG18 and SEMA5A expression (r = 0.709, p < 0.01). Surprisingly, the expected median OS times of both the SNHG18 and SEMA5Ahigh expression groups were significantly decreased, which was in contrast to those of both the SNHG18 and SEMA5Alow expression groups and the single-gene high expression group (p < 0.05). Conclusion: High expression of both SNHG18 and SEMA5A is associated with poor prognosis in patients with MM.

Oral squamous cell carcinoma (OSCC) is the most common type and most threatening head and neck cancer worldwide. Here, we aim to study the relationship between the WNT7A-β-Catenin signaling pathway and the chemotherapy resistance of OSCC patients. We analyzed 42 OSCC patients and 19 adjacent non-tumor tissues, evaluated the expression levels of WNT7A mRNA, and subsequently studied WNT7A dependent cisplatin resistance in OSCC cell line KB cells. Moreover, we also utilized an in vivo mouse model to validate our findings. We first found a significant upregulation of WNT7A mRNA in OSCC patients. Our results showed that the knockdown of WNT7A sensitized KB cells to cisplatin. Moreover, our results revealed that nuclear β-catenin was dramatically reduced and cleaved caspase-3 and cleaved PARP were dramatically induced when WNT7A was knocked down in cisplatin treated KB cells. Besides, we found that the knockdown of WNT7A significantly reduced the weight and volumes of xenograft tumors. Moreover, we examined apoptotic cells and found that the combination of WNT7A knockdown and cisplatin treatment resulted in many more apoptotic cells than cisplatin treatment alone, suggesting that the knockdown of WNT7A sensitized KB cells to cisplatin treatment in vivo. Our results revealed that inhibition of WNT7A-β-catenin signaling sensitizes OSCC to cisplatin, which has provided insights into the molecular diagnosis and treatment of OSCC.

Background/Aims: Circular RNAs (circRNAs) are a family of novel non-coding RNAs associated with various diseases, especially cancer. Recent studies have demonstrated that circRNAs participate in pathogenesis mainly by acting as microRNA (miRNA) sponges. The expression profile of circRNAs in acute myeloid leukemia (AML) has rarely been reported. Methods: Profiles of circRNAs were analyzed using an Arraystar human circRNA microarray with 5 bone marrow samples from patients with newly diagnosed AML and 5 from patients with iron-deficiency anemia. Quantitative reverse transcription PCR was used to validate the expression pattern of circRNAs. Furthermore, circRNA–miRNA network, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were applied. Results: CircRNA microarray analysis revealed that 698 circRNAs were differentially expressed in AML patients, with 282 circRNAs found to be upregulated and 416 to be downregulated. Quantitative reverse transcription PCR showed that circ-ANAPC7 was significantly upregulated in AML. Bioinformatics analysis predicted that circ-ANAPC7 acts as a sponge for the miR-181 family, KEGG analysis revealed that it is associated with cancer-related pathways, and GO analysis indicated that most of its target genes are involved in biological processes. Conclusions: These findings show that circ-ANAPC7 is a promising biomarker for AML, and that it might participate in AML pathogenesis by acting as a sponge for the miR-181 family.

Aims Multiple myeloma (MM) is an incurable hematological cancer with a higher rate of relapse. Alterations in the function of long non-coding RNAs (lncRNAs) promote the progression and metastasis of cancer. We carry out this study to explore the expression profile of differently expressed lncRNAs in newly diagnosed MM. Main methods The Bone marrows we analyzed were obtained from five MM and five IDA patients (serving as controls). Arraystar Human LncRNA Array V4.0 was used to profile expression of lncRNAs and mRNAs. Gene ontology (GO) and pathway analysis were utilized to understand the biological roles of differently expressed genes, while Database for Annotation, Visualization and Integrated Discovery (DAVID) was used for constructing the lncRNA-mRNA co-expression network. Quantitative polymerase chain reaction (qRT-PCR) was performed to confirm the expressions of dysregulated lncRNAs. Key findings Bioinformatic analysis of the lncRNA expression identified >3000 dysregulated lncRNAs (difference ≥ 2-fold) in MM samples. GO and pathway analysis revealed that ECM-receptor and cell cycle pathway-related genes were significantly associated with MM. Four dysregulated lncRNAs were confirmed by qRT-PCR. Among them, the expression of ST3GAL6-AS1, LAMA5-AS1and RP11-175D17.3wereassociated with stage and risk status of MM. On the basis of GEO public database analysis, LAMA5-AS1 was related with an overall survival rate of MM patients. Significance These results reveal the feasible functions of lncRNAs in pathogenesis of MM. Further studies are required to explore whether these lncRNAs could serve as candidate therapeutic targets and new molecular biomarkers for MM.

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P < 0.05 was defined as a significant difference. Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P < 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P < 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P < 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P > 0.05) (Figure 1D). Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation. Figure 1 Disclosures No relevant conflicts of interest to declare.

Background: Acute myeloid leukemia (AML) is the most common form of hematological malignant tumors that threatens human health. In the last decades, the rapid evolution in cytogenetics and molecular abnormalities made a breakthrough in the diagnosis and prognosis prediction of AML. However, there still has high heterogeneity among AML patients. Recently, researchers focused on long non-coding RNAs (lncRNAs), which once were addressed as products of "junk DNA", may play a key role in the initiation and progression of AML. Furthermore, a study from Ohio State's Comprehensive Cancer Center built a useful prognostic lncRNA score system for elder patients (>60 years) with cytogenetically normal AML by 48 lncRNAs [Garzon et al. PNAS 2014; 111:18679-84]. It can be expected that lncRNAs will promote the diagnosis and risk categories of AML in the near future. In this study, a risk scoring system was constructed upon 3 lncRNAs in de novo AML patients. We also sought to explore the functionality of these lncRNAs. Methods: By using Arraystar Human LncRNA Array V4.0, we obtained deregulated transcripts in AML, including 3,499 lncRNAs and 3,105 mRNAs (GSE103828). Expression patterns of all deregulated transcripts were extracted from 151 AML patients of The Cancer Genome Atlas (TCGA) RNA sequencing data. Through mathematical modeling, we identified 3 lncRNAs whose expression levels were independently associated with overall survival (OS). We then constructed a risk scoring system based on the 3 lncRNAs, age and 2008 WHO risk categories. Then the Receiver Operating Characteristic (ROC) was used to identify its test power and the best threshold score for 3-year survival status. Bone marrow samples from patients with AML and iron deficiency anemia (IDA) were collected. qRT-PCR was performed to verify the expression of lncRNAs in AML patients and IDA controls. Results: In the TCGA dataset, the area under ROC curve was 0.765, which indicated the risk scoring system has a good efficiency to predict 3-year survival status for AML patients, and the threshold score 1.639 was recommended to distinguish the high and low risk score groups (Figure A). Patients with higher risk score had a shorter OS (median 440.31 days vs. 886.16 days, p Conclusion: We identified 3 deregulated lncRNAs in AML and constructed a risk scoring system based on the it, which provided distinct insights into the clinical and biological implications of lncRNAs expression in de novo AML patients. It may improve the risk stratification of newly-diagnosed AML patients. Further studies on the mechanisms of the lncRNAs are in process. Figure. Figure. Disclosures No relevant conflicts of interest to declare.

Introduction: Acute myeloid leukemia (AML) is a malignant clonal proliferative disease originating from hematopoietic stem cells, characterized by anemia, hemorrhage, infection and organ infiltration. Most of the patients had poor prognosis and the molecular mechanism of AML is not clear. Therefore, it is urgent to find new molecular markers and therapeutic targets for AML. Long noncoding RNAs (lncRNAs) are a class of RNAs, which are longer than 200nt and without the ability of encoding functional proteins [A. Fatica et al., 2014]. Accumulating studies have found that lncRNAs play an important role in the development of hematological tumors, especially in AML [Huang J et al., 2014; Xing C-y et al., 2015]. In order to investigate the mechanism of lncRNAs in AML, we screened the differentially expressed RNAs in 5 AML patients and 5 IDA controls by microarray (GSE103828), and lncRNA AC092580.4 was verified markedly low expressed in AML (fold change=15.25, P= 0.0002). Then, We further explored the relationship between the expression levels of AC092580.4 and the clinical characteristics and prognosis of AML. Methods: Bone marrow (BM) samples from patients with AML and iron deficiency anemia (IDA) were collected and qRT-PCR was performed to verify the expression levels of AC092580.4 in AML patients and controls. The Receiver Operating Characteristic (ROC) was established to analyze whether AC092580.4 could be used as a bio-marker for newly diagnosed AML patients. The clinical data, including age, gender, percentage of blast cells in BM, chromosome and gene abnormalities, risk stratification, white blood cell counts and overall survival were collected. The correlation between the expression levels of AC092580.4 and clinical characteristics were analyzed by SPSS22.0. Results: The expression levels of AC092580.4 in newly diagnosed AML (n=83) was significantly lower (Figure A) than IDA (n=24) (p < 0.0001). The ROC (Figure B) was established and the area under curve was 0.868 (p < 0.001, CI: 0.780 - 0.957), which indicated that AC092580.4 could be used as an effective index to distinguish the newly diagnosed AML from the controls. Clinical data were collected from 83 newly diagnosed AML patients, 67% was the mean value of the percentage of blast cells in BM . It was found that the expression levels of AC092580.4 were significantly different between the high (≥67%) and low( Conclusions: Our study sheds light on a novel lncRNA AC092580.4 in AML, and provides its possible functional mechanism preliminary. Whether it can be used as a new powerful therapeutic target for AML treatment remains to be further studied. Figure. Figure. Disclosures No relevant conflicts of interest to declare.

Introduction: Multiple myeloma (MM) is a fatal B-cell malignancy characterized by abnormal proliferation of plasma cells (PCs) in bone marrow (BM). Despite the remarkable improvements have been done in knowledge on the pathobiology of MM, treatment and patients care, MM is still an incurable disease. Long non-coding RNAs (lncRNAs) are a new sort of noncoding RNA longer than 200 nucleotides and without the function of translating into canonical functional proteins. Increasing evidence suggests that lncRNAs have huge impact on adjusting gene expression through the processes of transcription and post-transcription regulation, genomic imprinting, and chromatin modification. We have validated several dysregulated lncRNAs in MM by microarray and bioinformatic analysis. Among them, we focused on the function and mechanism of ST3 beta-galactoside alpha-2,3-sialyltransferase 6 antisense RNA 1(ST3GAL6-AS1), which was upregulated markedly in MM patients. In our previous study, we verified the upregulation level and the co-expression relationship of ST3GAL6-AS1 and ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3GAL6) in bone marrow samples from MM patients. Methods: MM cell lines MM1.S and RPMI-8226 were confirmed to have high expression levels of ST3GAL6-AS1 at RNA level compared with healthy controls. Knockdown of ST3GAL6-AS1 was conducted in MM1.S and RPMI-8226 cells using lncRNA Smart Silencer from Ribobio (Guangzhou, China). ST3GAL6-AS1 knockdown and ST3GAL6 expression were confirmed by quantitative real-time PCR (qRT-PCR) at RNA level. We next evaluated the effects of ST3GAL6-AS1 knockdown on MM cell adhesion to human umbilical vein endothelial cell (HUVEC), fibronectin and collagen I coated plates after MM1.S and RPMI-8226 was labeled by CFSE. Migration and invasion to complete medium were assessed using transwell plates comparing ST3GAL6-AS1 knockdown cells to NC controls. Matrigel matrix was coated at transwell plates in invasion analysis. Cell count in adhesion analysis was conducted by Image J software, while migration and invasion analysis were evaluated by flow cytometer. Results: ST3GAL6-AS1 (Genebank number: NR_046683.1) was a 769bp antisense RNA, which located in chromosome 3. Its expression level was decreased dramatically after transfection of ST3GAL6-AS1 smart silencer or control siRNA into MM1.S and RPMI-8226 cells (Figure 1A). There was a significant reduction in the ability of knockdown MM1.S and RPMI-8226 cells to adhere to HUVEC, fibronectin and collagen I in vitro compared to NC controls (Figure 1B). Migration and invasion ability of MM cells transfected with lncRNA smart silencer in response to complete medium were also decreased obviously (Figure 1C). However, there was no significant difference in the ability of proliferation and apoptosis between ST3GAL6-AS1 knockdown group and NC controls. Furthermore, the expression level of ST3GAL6 was decreased in ST3GAL6-AS1 knockdown MM cells (Figure 1D). Conclusions: Knockdown of ST3GAL6-AS1 in MM cells significantly inhibits adhesion, migration and invasion in vitro, indicating that ST3GAL6-AS1 may play an important role in the malignant behavior of MM cells. The co-expression between ST3GAL6-AS1 and gene ST3GAL6 has been demonstrated in our previous study, which was further confirmed in present study. Researches are ongoing to address the potential mechanism among them in MM. Figure 1. Figure 1. Disclosures No relevant conflicts of interest to declare.

Background: The ubiquitin proteinase system is involved in the pathogenesis of blood malignant tumors. Preliminary study of our group found that increased serum ubiquitin activase E1 (UBE1) fragment were in newly diagnosed and refractory & relapsed acute myeloid leukemia (AML), and its relative intensity was negatively correlated with AML's remission process and prognosis. The inhibition of UBE1 activity can promote AML cell apoptosis and may be related to the mechanism of endoplasmic reticulum stress. The current study is to clarify the role and mechanism of endoplasmic reticulation-derived transcription factor CHOP in apoptosis of leukemia cells induced by inhibiting ubiquitin activase E1 (UBE1) activity. Methods: UBE1-shRNA lentivirus carrier and CHOP-siRNA plasmid co-infected leukemia cells (U937, K562, NB4, THP-1). The protein expression of antiapoptosis molecules, endoplasmic reticulum stress protein and death receptors (Bcl-2, TRB3, ERO1α, DR5 and Bax) were detected by Western Blot. MTT and flow cytometry were used to detect cell proliferation inhibition and apoptosis. The model of leukemia cell bearing nude mouse was constructed. UBE1-shRNA and/or CHOP-siRNA were injected into the tumor. The tumor size, lifetime changes and tumor pathological changes were observed. Western Blot and RT-PCR were used to detect endoplasmic reticulum stress molecules and apoptosis molecules. Results: Infection of UBE1-shRNA significantly inhibited proliferation of leukemia cells (U937, K562, NB4, THP-1), while the inhibition of UBE1-shRNA and CHOP-siRNA co-transfected leukemia cells was decreased (p=0.032). The apoptosis rate in UBE1-shRNA leukemia cells was lower than that in UBE1-shRNA and CHOP-siRNA co-transfected leukemia cells (p=0.026). UBE1-shRNA can reduce the expression of apoptosis molecule Bcl-2 and increase the expression of TRB3, ERO1α, death receptor DR5, Bax protein. CHOP-siRNA can increase the expression of Bcl-2 in leukemia cells and reduce the expression of TRB3, ERO1α, death receptor DR5 and Bax protein. shRNA-UBE1 inhibited the leukemia cell xenograft, while siRNA-CHOP reversed the growth inhibition of shRNA-UBE1 on leukemia cell xenograft (p=0.002). A larger number of leukemia cells were degenerative necrosis in the UBE1-shRNA group comparing with the UBE1-shRNA and siRNA-CHOP co-transfected groups (p=0.023), and damaged membrane, different sizes, blurred outline, and nuclear pyknosis and karyorrhexis could be observed. The average survival time of mice with co-transfection of shRNA-UBE1 and siRNA-CHOP was shorter than the average survival time of mice with shRNA-UBE1 (p=0.016). Compared with the shRNA-UBE1 group, there was no difference in expression of endoplasmic reticulum stress molecules in co-transfection of UBE1-shRNA and siRNA-CHOP group, but TRB3, ERO1α, DR5, Bax expression were decreased, and Bcl-2 was increased (p Conclusion: The inhibition of UBE1 activity can induce AML cell apoptosis by endoplasmic reticulum stress CHOP pathway. It will provide new clues for the treatment of acute myeloid leukemia. Disclosures: No relevant conflicts of interest to declare. Disclosures No relevant conflicts of interest to declare.

Background: Acute monocytic leukemia (M5) is one common type in acute myeloid leukemia (AML). The present study found that a few M5 had special reproducible chromosomal abnormalities and molecular abnormalities. The heterogeneity and complexity of M5 lead to lack of specific tumor-associated markers for molecular diagnosis and targeted therapy. CLINPROT system, with unique advantages, is a firenew and distinctive proteomics technology and has been widely used in the researches of solid tumor and hemopathic malignancies. This study was to screen a panel of serum peptides associated with M5 different disease states for molecular diagnosis and monitoring minimal residual disease. Methods: 92 M5 were enrolled for the study from those who were newly diagnosed (ND) in the Second Affiliated Hospital of Xi'an Jiao Tong University from January 2009 to July 2014. The median age was 45 years old (range 18-73) and 57.6% were male. Diagnosis was made according to bone marrow cell morphology, cytochemical staining and cellular immune phenotype. 90 healthy cases (HC) (age range 19-70, median age 43 years old, male/female 51/39) were recruited from those who came to our hospital to undergo healthy physical examination and had no any abnormal symptoms and results. Sera of 92 M5 were gained pre- and post-treatment of chemotherapy. Weak cation exchange magnetic bead combined with matrix assisted laser desorption/ ionization time of flight mass spectrometry were used to compare and analyze serum peptidome of M5 with different disease states. Spearman method was used to do correlation analysis of two variables. Statistical significance was defined as p Results: A total of 42 peptides in the molecular weight range of 700-10000 Da were detected using ClinProt system and statistically different between adult M5 and healthy controls. Among them, 9 peptides were elevated and 33 were decreased in M5. Genetic algorithm (GA) was used to obtain a diagnostic model consisting of 6 peptides that could discriminate M5 from controls with a high sensitivity (100%) and specificity (96.67%). Mass charge ratios (m/z) were 6041.91, 4662.15, 7823.02, 9210.97, 1108.91 and 3263.37 respectively. Blind test verified that this model correctly identified 60 cases out of total 62 M5 and 57 cases from 60 healthy controls. The relative intensities of peptides with m/z of 6041.91 and 4662.15 were increased in the ND group and non-complete remission (CR) group, when comparing with the CR group and HC group(p=0.002; p Conclusion: This panel of peptides has encouraging efficiency in discriminating M5 from HCs and potential value in monitoring M5 minimal residual disease. Disclosures No relevant conflicts of interest to declare.

Background: Acute monocytic leukemia(AML-M5), a common hematological malignancy, is serious harm to human health with dangerous clinical prognosis and extramedullary infiltration. Monocytic leukemia associated antigen-34(MLAA-34) gene (GenBank no. AT288977.2) was first discovered in M5 in an effort to identify monocytic leukemia associated antigens by serological identification of antigens by recombinant expression cloning (SEREX). Studies showed that MLAA-34 gene was a new anti-apoptotic molecule associated with acute monocytic leukemia cell U937 through JAK/STAT3 and Wnt signal pathways. Previous clinical studies showed that MLAA-34 was highly expressed in M5 patients involved with extramedullary infiltration and poor survival rate. Further researches on MLAA-34 revealed that MLAA-34 protein expressed in very few cases of lung, colon and stomach cancer and overall survival of these patients were significantly poorer. Objective: This study aims to explore the expression of MLAA-34 in variety of acute myeloid leukemic patients and its correlation with extramedullary infiltration so as to further identify mechanisms of tumor invasive of MLAA-34. Method: Collected bone marrow and peripheral blood samples of 52 newly diagnosed acute myeloid leukemic patients and 14 healthy volunteers, then RT-PCR based on Taqman probe technology was constructed to detect MLAA-34 mRNA and found the relationship between the MLAA-34 expression and extrameduulary infiltration. Blood cell lines including monocytic leukemia cells(THP1, U937), promyelocytic leukemia cell(NB4), myeloid leukemia cell(K562), lymphocytic leukemia cells(RS4;11, Jurkat), myeloma cells(RPMI8226, U266,H929)and solid tumor cells including hepatoma carcinoma cells(MHCC97H, Hep3B, SMMC7721), colon cancer cells(SW480, SW620), breast cancer cells(MCF7, MDA-MB 231), lung carcinoma cells(A549, PC9, H1975) were tested. The total RNA was extracted from cells and patients by TRIzol Reagent (Invitrogen). RT-PCR and Western blot were performed to detect MLAA-34 mRNA and protein express. Short hairpin RNAs (shRNA) targeting MLAA-34 gene were designed and successfully transfected into U937 cells. The efficient knockdown MLAA-34 in U937 cells were constructed to observe MLAA-34 effect on tumor metastasis by transwell invasion experiment. Results: We focused on MLAA-34 gene expression in different subtypes of acute myeloid leukemia (AML). M5 and acute myelomonocytic leukemia (M4) patients expressed high levels of MLAA-34 mRNA, which accompanied with high rates of extramedully lesion. The group of extramedullary infiltration patients presented significantly higher levels of MLAA-34 mRNA than those who did not(P Conclusion: MLAA-34 plays an important role in extremedullay infiltration and MLAA-34 is specifically positively correlated with the invasive ability of cancer cell. Figure 1 MLAA-34 mRNA expression in different cell lines. Figure 1. MLAA-34 mRNA expression in different cell lines. Figure 2 MLAA-34 expression correlates with the cell invasive ability Figure 2. MLAA-34 expression correlates with the cell invasive ability Figure 3 MLAA-34 mediates tumor invasion in acute myeloid leukemia cell U937.***:P Disclosures No relevant conflicts of interest to declare.

Background: Renal impairment (RI) is relatively common in patients with newly diagnosed MM (NDMM), ~20-40%, and forms one of the defining features for diagnosis of symptomatic disease. RI has a negative prognostic impact in patients with MM, with an increased risk of early death and a reduction in median survival of up to 50% compared with MM patients without RI. Identification of the early RI in MM and prompt intervention can effectively reverse the RI and prolong the survival of patients. Considering serum creatinine (SCr), blood urea nitrogen (BUN) and creatinine clearance (CrCl) are difficult to reflect early RI, cystatin C (Cys-C), as a new biomarker, has certain value for the diagnosis of early glomerular impairment in MM. However, the early stage of RI in MM was mainly renal tubular injury. Low molecular urine protein (retinol-binding protein, β-microglobulin) are effective in early renal tubular injury, but they are affected by urea PH value. This study was to screen a panel of serum peptides associated with early RI in MM. Methods: 164 MM patients were selected from those who were newly diagnosed in the Second Affiliated Hospital of Xi'an Jiao Tong University during a given period of time (2009.1-2014.1). Their diagnoses were made according to the diagnostic criteria from the International Myeloma Working Group. The median age was 65 years old (range 36-83) and 60.4% were male. RI was defined as having a CrCl Results: Serum peptidome of MM including 104 without RI and 50 with RI were analysed. 18 statistically different expressed peptide peaks were obtained in the molecular weight range of 700-10000Da (P40ml/min,38/50MM). Spearman correlation analysis showed that relative intensities of peptides with molecular weight of 3908.85Da, 3216.06Da and 2990.08Da were correlated with SCr(r=0.81, p Conclusion: Peptides(3908.85Da, 3216.06Da and 2990.08Da) associated with MM RI obtained by serum peptidome technology can provide new clue for early assess and diagnose MM RI in clinical. Disclosures No relevant conflicts of interest to declare.