Search

Arachidonic acid can be converted to a large number of metabolites by various lipoxygenases, cyclooxygenase, and other enzymes. Because of the complex profiles of products formed by many types of cells, high-pressure liquid chromatography (HPLC) has proved to be an invaluable technique for their purification and analysis. In the present study we have developed improved methods for the analysis of complex mixtures of eicosanoids by HPLC using binary gradients containing trifluoroacetic acid (TFA), which allows considerable manipulation of the retention times of the cysteine-containing leukotrienes (LTs) LTC4, LTD4, and LTE4 relative to those of other eicosanoids. With a gradient between 0.003 and 0.005% TFA and a 4.6-mm-i.d. column of Spherisorb ODS-2, cysteinyl-LTs are very well resolved from one another and are separated as a group with retention times longer than those of all other major eicosanoids. These conditions can be used for the analysis of prostaglandin B2 (PGB2), LTB4, monohydroxyeicosatetraenoic acids (HETEs), and cysteinyl-LTs in only 30 min. Slightly longer analysis times must be used for the separation of more polar eicosanoids such as hydroxy metabolites of LTB4 and lipoxins. We have also developed methods for the analysis of eicosanoids using a midbore (3.2 mm i.d.) column containing Spherisorb ODS-2, which improves sensitivity and reduces solvent consumption. In this case higher concentrations (0.04 to 0.05%) of TFA have been used, resulting in retention times for cysteinyl-LTs between those of the cyclooxygenase product 12-hydroxy-5,8,10-heptadecatrienoic acid and the HETEs. This approach permits analysis of PGB2, LTB4, HETEs, and cysteinyl-LTs in only 20 min. Samples which also contain hydroxy-LTB4 and lipoxins can be analyzed in 40 min. The above techniques are highly reproducible and give baselines which are free of interfering peaks.

An important event in the formation of atherosclerotic lesions is the uptake of modified low density lipoprotein (LDL) by macrophages via scavenger receptors. Modification of LDL, which results in its recognition by these receptors, can be initiated by peroxidation of LDL lipids. The first step in this process is the formation of monohydroperoxy derivatives of fatty acids, which are subsequently degraded to the corresponding monohydroxy compounds, or to a variety of secondary oxidation products. In order to understand this process more completely, we have developed a mass spectrometric procedure to measure the amounts of specific hydroperoxy/hydroxy fatty acids formed by oxidation of the major unsaturated fatty acids in human LDL, oleic acid, linoleic acid, and arachidonic acid. Oxidation of human LDL in the presence of a relatively strong stimulus (20 microM CuSO4) resulted in very large increases in the amounts of the major monohydroxy derivatives of linoleic acid (9- and 13-hydroxy derivatives) and arachidonic acid (5-, 8-, 9-, 11-, 12-, and 15-hydroxy derivatives) in LDL lipids in the early stages of the reaction. After 20 h, the amounts of these products declined due to substrate depletion, but large amounts of monohydroxy derivatives of oleic acid (8-, 10-, and 11-hydroxy derivatives) were detected. Although thiobarbituric acid-reactive substances clearly increased under these conditions, the changes were not nearly so dramatic as those observed for monohydroxy fatty acids. Oxidation of LDL in the presence of endothelial cells, a much milder stimulus, resulted in 2.5- to 3-fold increases in the amounts of monohydroxy derivatives of linoleic and arachidonic acids, as well as thiobarbituric acid-reactive substances, with more modest increases in the amounts of hydroxylated derivatives of oleic acid. There was little positional specificity in the oxidation of the above fatty acids in the presence of either stimulus, suggesting that the formation of these products proceeds primarily by lipid peroxidation, rather than by catalysis by lipoxygenases. However, an important role for lipoxygenases in the initiation of these reactions cannot be excluded. In conclusion, oxidation of LDL in the presence of copper ions or endothelial cells results in the formation of a large number of monohydroxy derivatives of oleic, linoleic, and arachidonic acids. The relative amounts of products formed from each of these fatty acids depends on the strength of the stimulus as well as the incubation time.

In the process of sepsis, excessive occurrence of pyroptosis, a form of programmed cell death acting as a defense mechanism against pathogens, can disrupt immune responses, thus leading to tissue damage and organ dysfunction. Chitosan oligosaccharide (COS), derived from chitosan degradation, has demonstrated diverse beneficial effects. However, its impact on sepsis-induced pyroptosis remains unexplored. In the present study, ATP/LPS was utilized to induce canonical-pyroptosis in THP-1 cells, while bacterial outer membrane vesicles (OMV) were employed to trigger non-canonical pyroptosis in RAW264.7 cells. Our results revealed a dose-dependent effect of COS on both types of pyroptosis. This was evidenced by a reduction in the expression of pro-inflammatory cytokines, as well as crucial regulatory proteins involved in pyroptosis. In addition, COS inhibited the cleavage of caspase-1 and GSDMD, and reduced ASC oligomerization. The underlying mechanism revealed that COS acts an antioxidant, reducing the release of pyroptosis-induced ROS and malondialdehyde (MDA) by upregulation the expression and promoting the nuclear translocation of nuclear factor erythroid-2-related factor 2 (Nrf2), which led to an elevation of glutathione peroxidase 4 (GPX4) and superoxide dismutase (SOD). Notably, the actions of COS were completely reversed by the Nrf2 inhibitor. Consequently, COS intervention increased the survival rate of sepsis., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Objectives: To investigate the toxicokinetic differences of 3,4-methylenedioxy- N -methylamphetamine (MDMA) and its metabolite 4,5-methylene dioxy amphetamine (MDA) in rats after single and continuous administration of MDMA, providing reference data for the forensic identification of MDMA., Methods: A total of 24 rats in the single administration group were randomly divided into 5, 10 and 20 mg/kg experimental groups and the control group, with 6 rats in each group. The experimental group was given intraperitoneal injection of MDMA, and the control group was given intraperitoneal injection of the same volume of normal saline as the experimental group. The amount of 0.5 mL blood was collected from the medial canthus 5 min, 30 min, 1 h, 1.5 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h after administration. In the continuous administration group, 24 rats were randomly divided into the experimental group (18 rats) and the control group (6 rats). The experimental group was given MDMA 7 d by continuous intraperitoneal injection in increments of 5, 7, 9, 11, 13, 15, 17 mg/kg per day, respectively, while the control group was given the same volume of normal saline as the experimental group by intraperitoneal injection. On the eighth day, the experimental rats were randomly divided into 5, 10 and 20 mg/kg dose groups, with 6 rats in each group. MDMA was injected intraperitoneally, and the control group was injected intraperitoneally with the same volume of normal saline as the experimental group. On the eighth day, 0.5 mL of blood was taken from the medial canthus 5 min, 30 min, 1 h, 1.5 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h after administration. Liquid chromatography-triple quadrupole tandem mass spectrometry was used to detect MDMA and MDA levels, and statistical software was employed for data analysis., Results: In the single-administration group, peak concentrations of MDMA and MDA were reached at 5 min and 1 h after administration, respectively, with the largest detection time limit of 12 h. In the continuous administration group, peak concentrations were reached at 30 min and 1.5 h after administration, respectively, with the largest detection time limit of 10 h. Nonlinear fitting equations for the concentration ratio of MDMA and MDA in plasma and administration time in the single-administration group and continuous administration group were as follows: T =10.362 C -1.183 , R 2 =0.974 6; T =7.397 3 C -0.694 , R 2 =0.961 5 ( T : injection time; C : concentration ratio of MDMA to MDA in plasma)., Conclusions: The toxicokinetic data of MDMA and its metabolite MDA in rats, obtained through single and continuous administration, including peak concentration, peak time, detection time limit, and the relationship between concentration ratio and administration time, provide a theoretical and data foundation for relevant forensic identification.

Aims and Objectives: The aim of this study is to discuss the influence of endotoxin on insulin amyloid formation, to provide guidance for therapeutic insulin preparation and storage., Materials and Methods: The ThT and ANS binding assays were applied to characterize the dynamics curve of insulin amyloid formation with the presence or absence of endotoxin. The morphological structures of intermediate and mature insulin fibrils were observed with SEM and TEM. Secondary structural changes of insulin during fibriliation were examined with CD, FTIR and Raman spectral analysis. The cytotoxic effects of oligomeric and amyloidogenic insulin aggregates were detected using a cck-8 cell viability assay kit. The influence of endotoxin on insulin efficacy was analyzed by monitoring the activation of insulin signal transduction., Key Findings: ThT analysis showed that endotoxin, regardless of species, accelerated insulin fibrils formation in a dose-dependent manner, as observed with a shorter lag phase. ANS binding assay demonstrated endotoxin provoked the exposure of insulin hydrophobic patches. The results of SEM and TEM data displayed that endotoxin drove insulin to cluster into dense and viscous form, with thicker and stronger filaments. Based on CD, FTIR and Raman spectra, endotoxin promoted the transition of α-helix to random coil and β-strand secondary structures during insulin aggregation. Insulins in both oligomeric and amyloidogenic forms were cytotoxic to HepG2 cells, with the former being more severe. Finally, the efficacy of endotoxin treated insulin obviously decreased., Significance: Our studies revealed that endotoxin disrupts the structural integrity of insulin and promotes its amyloidosis. These findings offered theoretical guidance for insulin storage and safe utilization, as well as pointing up a new direction for insulin resistance research., Competing Interests: Declaration of competing interest The authors declared that the research was conducted in the absence of any commercial or financial relationship that could be construed as a potential conflict of interest., (Copyright © 2023 Elsevier Inc. All rights reserved.)

Background: The most common causes of outlet obstructive constipation (OOC) are rectocele and internal rectal prolapse. The surgical methods for OOC are diverse and difficult, and the postoperative complications and recurrence rate are high, which results in both physical and mental pain in patients. With the continuous deepening of the surgeon's concept of minimally invasive surgery and continuous in-depth research on the mechanism of OOC, the treatment concepts and surgical methods are continuously improved., Aim: To determine the efficacy of the TST36 stapler in the treatment of rectocele combined with internal rectal prolapse., Methods: From January 2017 to July 2019, 49 female patients with rectocele and internal rectal prolapse who met the inclusion criteria were selected for treatment using the TST36 stapler., Results: Forty-five patients were cured, 4 patients improved, and the cure rate was 92%. The postoperative obstructed defecation syndrome score, the defecation frequency score, time/straining intensity, and sensation of incomplete evacuation were significantly decreased compared with these parameters before treatment, and the differences were statistically significant ( P < 0.05). The postoperative anal canal resting pressure and maximum squeeze pressure in patients decreased compared with before treatment, and the differences were statistically significant ( P < 0.05). The initial and maximum defecation thresholds after surgery were significantly lower than those before treatment, and the differences were statistically significant ( P < 0.05). The postoperative ratings of rectocele, resting phase, and defecation phase in these patients were significantly decreased compared with those before treatment, and the differences were statistically significant ( P < 0.05)., Conclusion: The TST36 stapler is safe and effective in treating rectocele combined with internal rectal prolapse and is worth promoting in clinical work., Competing Interests: Conflict-of-interest statement: There is no conflict of interest issue., (©The Author(s) 2021. Published by Baishideng Publishing Group Inc. All rights reserved.)

Objective: Drug-related problems (DRPs) are common in hospitalized patients receiving Key Monitoring Drugs. Clinical pharmacy services have the potential to minimize drug-related harm and improve patient care. The aim of this study is to standardize the clinical application of Key Monitoring Drugs and reduce drug-related problems (DRPs) and associated costs, using clinical pharmacist interventions., Patients and Methods: Clinical pharmacists formulate management measures for Key Monitoring Drugs using evidence-based medicine and analyze the DRPs of Key Monitoring Drugs in China at the Shandong Provincial Third Hospital over a period of five years, from 2015 to 2019., Results: In 2019, the total cost of the use of Key Monitoring Drugs decreased by 10.12 million CNY, in comparison with the cost in 2015. The proportion of revenue generated from Key Monitoring Drugs also decreased by 11.49% compared with 2015. In addition, the cost per capita of Key Monitoring Drugs has gradually decreased; this resulted in a saving of 580.07 CNY per capita in 2019 compared with 2015. Over this time, the DRPs associated with Key Monitoring Drugs decreased by 45.50%. Through administrative intervention, prescription review, information management, and pharmaco-economic evaluation, a scientific management system for Key Monitoring Drugs has been established over this time, which standardizes the use of Key Monitoring Drugs and reduces their associated costs., Conclusions: Clinical pharmacists' interventions can assist in the early detection of drug-related problems associated with Key Monitoring Drugs and prevent any resulting harm to patients.

Objective: To evaluate the effect on bleeding volume and postoperative recovery of regional cerebral oxygen saturation (rSO(2)) guides controlled hypotension in elderly patients with hypertension undergoing spinal surgery. Methods: One hundred and twenty elderly patients who underwent spinal surgery in the department of anesthesiology of Qingdao Municipal Hospital and the Affiliated Hospital of Qingdao University from January 2017 to December 2019 were selected and divided into 2 groups according to the random number table method ( n= 60): rSO(2) guides the controlled hypotension group (group A) and control group (group C). Both groups were performed with endotracheal intubation for general anesthesia, maintain anesthesia with sevoflurane and remifentanil, rSO(2) were monitored throughout the procedure. If necessary, sodium nitroprusside or esmolol were used to control blood pressure. In group A, the goal of controlled hypotension was that rSO(2) decreased ≤ 10% of the basic value or maintained at 64±3 and the moderate operative field bleeding. Group C underwent routine anesthesia management. Intraoperative blood loss and urine output, the incidence of hypothermia after operation, postoperative delirium, chills, nausea and vomiting, the PACU residence time, postoperative drainage volume, eating time, postoperative hospital stay were compared between the two groups. Results: Compared with group C, the blood loss [(589±157) vs (764±213) ml] and urine output [(778±121) vs (1 079±239) ml] of group A were decreased ( t= -5.120, -8.712, all P< 0.05). The rates of hypothermia after operation (26.7% vs 45.0%), postoperative delirium (18.3% vs 36.7%), chills (10.0% vs 25.0%), nausea and vomiting (21.7% vs 40.0%) of group A were decreased (χ(2)=4.385, 5.057, 4.675, 4.728, all P< 0.05) . The PACU residence time [(56±9) vs (63±11) min], postoperative drainage volume [(217±66) vs (289±81) ml], eating time [(17.8±2.8) vs (22.3±4.1) h] and numbers of days in hospital [(7.2±2.7) vs (8.2±2.9) d] were decreased of group A ( t= -3.399, -5.334, -7.000, -2.031, all P< 0.05). Conclusion: The guidance of controlled hypotension with rSO(2) monitoring can reduce the blood loss and infusion volume during spinal surgery in elderly patients with hypertension, reduce postoperative related complications and enhance recovery after surgery.

Objective: To evaluate the effect of dual-tube epidural segmental injection of lidocaine analgesia on the delivery outcome and maternal and infant complications of persistent posterior occipital position postpartum or lateral occipital position postpartum patients with protracted active phase. Methods: The full and single-term primiparas ( n =216, 37 to 42 weeks gestation, 22 to 35 years) diagnosed as persistent posterior or lateral occipital position during the active period were selected from the Department of Obstetrics of Qingdao Municipal Hospital from January 2015 to October 2019. The subjects were randomly assigned into two groups: double-tube epidural block group ( n =108) and single-tube epidural block group ( n =108), 1% lidocaine was used for epidural analgesia respectively under ultrasound guidance. Senior midwife or obstetricians implement new partogram, and guide women to perform position management, and push or rotate the fetal head in a timely manner. Observation indicators: general condition, the use of non-pharmacological analgesic measures, analgesia related conditions and pain visual analogue scale (VAS) score, delivery-related indicator, cesarean section indication, anesthesia-related indicator, maternal and child complications. Results: (1) General condition: the age, weight, height, gestational age, the ratio of persistent lateral or posterior occipital position, cephalic score, and neonatal birth weight between the two groups of women were not statistically significant (all P >0.05). (2) The use of non-pharmacological analgesic measures: the women's Lamaze breathing method, Doula delivery companionship, percutaneous electrical stimulation, and other measures between two groups were compared, and there were not significant differences (all P >0.05). (3) Analgesia related conditions and VAS scores of women undergoing vaginal delivery: compared with the single-tube epidural block group ( n =40), the second-partum time of the women in the double-tube epidural block group ( n =59) was significantly shortened [(124±44) vs (86±33) minutes, P <0.01]; after 30 minutes of analgesia (4.4±0.5 vs 0.9±0.5, P <0.01), during forced labor in the second stage of labor (5.7±0.6 vs 1.3±0.4, P <0.01), the VAS scores of pain were also significantly reduced ( P <0.01). (4) Labor-related indicators: compared with the single-tube epidural block group, the natural delivery rate (21.3% vs 49.1%) and the delivery experience satisfaction rate (51.9% vs 98.1%) of women in the double-tube epidural block group were significantly increased (all P <0.01), cesarean section rate (63.0% vs 45.4%), instrument assisted rate (15.7% vs 5.6%) decreased significantly (all P <0.05). (5) Cesarean section indications: compared with the single-tube epidural block group, the cesarean section rate caused by prolonged labor or protracted active phase of women in the double-tube epidural block group was significantly reduced (38.0% vs 22.2%； P <0.05), and the fetal distress, intrauterine infection, and social factors caused by cesarean section between the two groups were compared, while the differences were not statistically significant (all P >0.05).(6) Anesthesia related indexes: the block planes of the maternal upper tube administration in the double-tube epidural block group were mostly T7, T8, T9-L2 and L3,While,the block planes in the single-tube epidural block group were mostly T10, T11-S1, S2, S3, and the modified Bromage score were all 0. (7) Maternal and child complications: compared with the single-tube epidural block group, the postpartum hemorrhage rate (18.5% vs 7.4%), the perineal lateral cut rate (20.4% vs 5.6%), the neonatal asphyxia rate (12.0% vs 3.7%), ICU rate of transferred neonates (13.9% vs 4.6%) in the double-tube epidural block group were significantly reduced (all P <0.05). Soft birth canal injury rate, puerperal disease rate and neonatal birth rate between two groups were compared, and there were not statistically significant differences (all P >0.05). Conclusion: Dual-tube epidural segmental injection of lidocaine analgesia could increase the natural delivery rate of women with posterior occipital or lateral occipital position with active stagnation, reduce the rate of cesarean section and the rate of transvaginal instruments, and reduce the complications of mother and child.

The deposition of aggregated human islet amyloid polypeptide (hIAPP) in the pancreas, that has been associated with β-cell dysfunction, is one of the common pathological features of patients with type 2 diabetes (T2D). Therefore, hIAPP aggregation inhibitors hold a promising therapeutic schedule for T2D. Chitosan oligosaccharides (COS) have been reported to exhibit a potential antidiabetic effect, but the function of COS on hIAPP amyloid formation remains elusive. Here, we show that COS inhibited the aggregation of hIAPP and disassembled preformed hIAPP fibrils in a dose-dependent manner by thioflavin T fluorescence assay, circular dichroism spectroscopy, and transmission electron microscope. Furthermore, COS protected mouse β-cells from cytotoxicity of amyloidogenic hIAPP, as well as apoptosis and cycle arrest. There was no direct binding of COS and hIAPP, as revealed by surface plasmon resonance analysis. In addition, both chitin-oligosaccharide and the acetylated monosaccharide of COS and glucosamine had no inhibition effect on hIAPP amyloid formation. It is presumed that, mechanistically, COS regulate hIAPP amyloid formation relating to the positive charge and degree of polymerization. These findings highlight the potential role of COS as inhibitors of hIAPP amyloid formation and provide a new insight into the mechanism of COS against diabetes.

Background: The essential oil content of the water lily is extremely low; thus, finding a new method that can extract essential oil from water lilies with a high extraction rate and no residual organic solvents is essential. Objective: The optimal processing conditions for the ultrasound-enhanced subcritical fluid extraction of essential oil from Nymphaea alba var (red water lily) and the antioxidant activity of the essential oil in vitro are investigated to provide theoretical bases for identification and development. Methods: Single-factor experiments and orthogonal designs are performed to determine the effects of extraction conditions on essential oil yields. The chemical composition of essential oil is analyzed using GC-MS. Results: The optimum extraction parameters are established as follows: extraction temperature, 35°C; extraction time, 30 min/time for four times; ratio of material to liquid, 1:3; ultrasound power, 250 W/L; and ultrasonic frequency, 20 kHz. The extraction rate of essential oil is 0.315% under these conditions. Eleven components comprise more than 1% content. The main chemical constituents are 8-hexadecyne (31.04%) and 2,6,10-trimethyl-tetradecane (3.95%). The essential oil from N. alba var has an antioxidant activity in vitro; however, its antioxidant activity is weaker than that of butylated hydroxytoluene. Conclusions: Subcritical fluid is suitable for the extraction of essential oil from N. alba var , and the essential oil has a good antioxidant activity. Highlights: The essential oil content of N. alba var is 0.315%. Forty-seven chemical constituents are identified and isolated from N. alba var and analyzed by GC-MS.

Fumigaclavine C (FC), an active indole alkaloid, is obtained from endophytic Aspergillus terreus (strain No. FC118) by the root of Rhizophora stylosa (Rhizophoraceae). This study is designed to evaluate whether FC has anti-adipogenic effects in 3T3-L1 adipocytes and whether it ameliorates lipid accumulation in high-fat diet (HFD)-induced obese mice. FC notably increased the levels of glycerol in the culture supernatants and markedly reduced lipid accumulation in 3T3-L1 adipocytes. FC differentially inhibited the expressions of adipogenesis-related genes, including the peroxisome proliferator-activated receptor proteins, CCAAT/enhancer-binding proteins, and sterol regulatory element-binding proteins. FC markedly reduced the expressions of lipid synthesis-related genes, such as the fatty acid binding protein, lipoprotein lipase, and fatty acid synthase. Furthermore, FC significantly increased the expressions of lipolysis-related genes, such as the hormone-sensitive lipase, Aquaporin-7, and adipose triglyceride lipase. In HFD-induced obese mice, intraperitoneal injections of FC decreased both the body weight and visceral adipose tissue weight. FC administration significantly reduced lipid accumulation. Moreover, FC could dose-dependently and differentially regulate the expressions of lipid metabolism-related transcription factors. All these data indicated that FC exhibited anti-obesity effects through modulating adipogenesis and lipolysis., Competing Interests: CONFLICTS OF INTEREST: The authors declare no conflicts of interest.

Fibroblast-like synoviocytes (FLS) play a pivotal role in Rheumatoid arthritis (RA) pathogenesis through aggressive migration and invasion. Madecassoside (Madec), a triterpenoid saponin present in Centella asiatica herbs, has a potent anti-inflammatory effect. In the present study, Madec exerted an obvious therapeutic effect in reversing the histological lesions in adjuvant-induced arthritis (AIA) rats. To recognize the anti-rheumatoid potentials of Madec, we further investigated whether Madec interfered with FLS invasion and metalloproteinase (MMP) expression. In cultures of primary FLS isolated from the AIA rats, Madec (10 and 30 μmol·L -1 ) was proven to considerably inhibit migration and invasion of FLS induced by interleukin 1β (IL-1β), but exhibiting no obvious effect on cell proliferation. Madec repressed IL-1β-triggered FLS invasion by prohibiting the expression of MMP-13. Additionally, Madec suppressed MMP-13 transcription via inhibiting the MMP-13 promoter-binding activity of NF-κB. Our results further showed that Madec down-regulated the translocation and phosphorylation of NF-κB as demonstrated by Western blotting and immunofluorescence assays. In conclusion, our results suggest that Madec exerts anti-RA activity via inhibiting the NF-κB/MMP-13 pathway., (Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.)

Context: Melanin plays an important role in preventing skin photoageing by blocking ultraviolet B (UVB). However, East Asian women prefer light and fair skin, therefore they want to keep their skin from photoageing and at the same time reduce the melanin in their skin. Chrysin is a kind of natural flavonoid with luxurious biological activities, which has a very promising effect on achieving this goal., Objective: To elucidate the effects and mechanisms of chrysin on photoageing and melanogenesis., Materials and Methods: Human dermal fibroblasts (HDF) and B16 murine melanoma cells were incubated with chrysin (0-25 μM) for 48 h. Anti-photoageing activity was examined in HDF by assessment of synthesis/degradation of collagen I, antioxidative and antisenescent activities through ELISA and colorimetric method. Anti-melanogenesis activity was tested by assessment of melanin, tyrosinase (TYR), melanogenic proteins inhibition activities in B16 cells using colorimetric and ELISA method., Results: Chrysin increased collagen I secretion (50-121.54% at 6.25-25 μM) and chrysin showed anti-photoageing activity by decreasing the degradation of collagen I, repairing oxidation damage and reducing the rate of HDF senescence. Furthermore, chrysin exhibited inhibitory activities with 3.00-20.35% reduction of melanin content at 6.25-25 μM, and inhibited melanin synthesis through the inhibition of TYR activity and the suppression of melanogenic proteins (TYR, TYR-related protein-1/2 and microphthalmia-associated transcription factor) expressions., Discussion and Conclusion: Chrysin may have potential for developing a functional cosmetic agent because of its anti-photoageing and anti-melanogenesis activities.

Glucokinase (GK) activity, which is rapidly regulated by glucokinase regulatory protein (GKRP) in the liver, is crucial for blood glucose homeostasis. In this paper, the GK activation mechanisms of 1-deoxynojrimycin (DNJ), resveratrol (RES), oxyresveratrol (OXY), cyanidin-3-glucoside (C3G), and cyanidin-3-rutinoside (C3R) were compared. The results revealed that DNJ, RES, C3G, and C3R could differently improve glucose consumption and enhance intracellular GK activities. DNJ and RES significantly promoted GK translocation at 12.5 μM, whereas other ingredients showed moderate effects. DNJ, C3G, and C3R could rupture intramolecular hydrogen bonds of GK to accelerate its allosteric activation at early stage. RES and OXY could bind to a "hydrophobic pocket" on GK to stabilize the active GK at the final stage. Otherwise, RES, OXY, C3G, and C3R could interact with GKRP at the F1P binding site to promote GK dissociation and translocation. Enzymatic assay showed that RES (15-50 μM) and OXY (25-50 μM) could significantly enhance GK activities, which was caused by their binding properties with GK. Moreover, the most dramatic up-regulation effects on GK expression were observed in C3G and C3R groups. This work expounded the differences between GK activation mechanisms, and the new findings would help to develop new GK activators.

Consumption of herbal tea [flower buds of Cleistocalyx operculatus (Roxb.) Merr. et Perry (Myrtaceae)] is associated with health beneficial effects against multiple diseases including diabetes, asthma, and inflammatory bowel disease. Emerging evidences have reported that High mobility group box 1 (HMGB1) is considered as a key "late" proinflammatory factor by its unique secretion pattern in aforementioned diseases. Dimethyl cardamonin (2',4'-dihydroxy-6'-methoxy-3',5'-dimethylchalcone, DMC) is a major ingredient of C. operculatus flower buds. In this study, the anti-inflammatory effects of DMC and its underlying molecular mechanisms were investigated on lipopolysaccharide (LPS)-induced macrophages. DMC notably suppressed the mRNA expressions of TNF-α, IL-1β, IL-6, and HMGB1, and also markedly decreased their productions in a time- and dose-dependent manner. Intriguingly, DMC could notably reduce LPS-stimulated HMGB1 secretion and its nucleo-cytoplasmic translocation. Furthermore, DMC dose-dependently inhibited the activation of phosphatidylinositol 3-kinase (PI3K), phosphoinositide-dependent kinase 1 (PDK1), and protein kinase C alpha (PKCα). All these data demonstrated that DMC had anti-inflammatory effects through reducing both early (TNF-α, IL-1β, and IL-6) and late (HMGB1) cytokines expressions via interfering with the PI3K-PDK1-PKCα signaling pathway.

Abnormally increased levels of iron in the brain trigger cascade amplification in Alzheimer's disease patients, resulting in neuronal death. This study investigated whether components extracted from the Chinese herbs epimedium herb, milkvetch root and kudzuvine root could relieve the abnormal expression of iron metabolism-related protein in Alzheimer's disease patients. An APPswe /PS1ΔE9 double transgenic mouse model of Alzheimer's disease was used. The intragastric administration of compounds from epimedium herb, milkvetch root and kudzuvine root improved pathological alterations such as neuronal edema, increased the number of neurons, downregulated divalent metal transporter 1 expression, upregulated ferroportin 1 expression, and inhibited iron overload in the cerebral cortex of mice with Alzheimer's disease. These compounds reduced iron overload-induced impairment of the central nervous system, indicating a new strategy for developing novel drugs for the treatment of Alzheimer's disease.

Alzheimer's disease (AD) is a neurodegenerative brain disorder and the most common cause of dementia. New treatments for AD are required due to its increasing prevalence in aging populations. The present study evaluated the effects of the active components of Epimedium , Astragalus and Radix Puerariae on learning and memory impairment, β-amyloid (Aβ) reduction and brain iron load in an APP swe /PS1 ΔE9 transgenic mouse model of AD. Increasing evidence indicates that a disturbance of normal iron homeostasis may contribute to the pathology of AD. However, the underlying mechanisms resulting in abnormal iron load in the AD brain remain unclear. It has been hypothesized that the brain iron load is influenced by the deregulation of certain proteins associated with brain iron metabolism, including divalent metal transporter 1 (DMT1) and ferroportin 1 (FPN1). The present study investigated the effects of the active components of Epimedium , Astragalus and Radix Puerariae on the expression levels of DMT1 and FPN1. The treatment with the active components reduced cognitive deficits, inhibited Aβ plaque accumulation, reversed Aβ burden and reduced the brain iron load in AD model mice. A significant increase was observed in the levels of DMT1-iron-responsive element (IRE) and DMT1-nonIRE in the hippocampus of the AD mouse brain, which was reduced by treatment with the active components. In addition, the levels of FPN1 were significantly reduced in the hippocampus of the AD mouse brain compared with those of control mice, and these levels were increased following treatment with the active components. Thus, the present study indicated that the active components of Epimedium , Astragalus and Radix Puerariae may exert a neuroprotective effect against AD by reducing iron overload in the AD brain and may provide a novel approach for the development of drugs for the treatment of AD.

A previous study reported that 2',4'-dihydroxy-6'-methoxy-3',5'-dimethylchalcone (DMC) had a potential hepatoprotective effect through preventing acute liver injury in mice. This study further evaluated the preventive effects of DMC on lipopolysaccharide (LPS)-stimulated hepatic inflammation and the underlying mechanism in liver macrophage. DMC significantly suppressed LPS-stimulated secretion and nucleocytoplasmic translocation of high-mobility group box 1 (HMGB1). DMC could dose-dependently reduce the phosphorylation of phosphatidylinositol 3-kinase (PI3K), protein kinase C alpha (PKCα), and phosphoinositide-dependent kinase 1 (PDK1). Furthermore, HMGB1 phosphorylation, the interaction between PKC and HMGB1, and the expression of HMGB1-dependent inflammation-related molecules were dose-dependently inhibited by DMC. Finally, DMC could target binding to the B box of HMGB1 by molecular modeling studies. All of these results indicated that DMC exhibited a potential protective effect against hepatitis probably via inhibiting HMGB1 secretion and blocking HMGB1 pro-inflammatory activity.

Purpose of Work: The purpose of this study is to report a ι-carrageenase which degrades ι-carrageenan yielding neo-ι-carratetraose as the main product in the absence of NaCl. The gene for a new ι-carrageenase, CgiB&#95;Ce, from Cellulophaga sp. QY3 was cloned and sequenced. It comprised an ORF of 1,386 bp encoding for a protein of 461 amino acid residues. From its sequence analysis, CgiB&#95;Ce is a new member of GH family 82 and shared the highest identity of 32% in amino acids with ι-carrageenase CgiA2 from Zobellia galactanovorans indicating that it is a hitherto uncharacterized protein. The recombinant CgiB&#95;Ce had maximum specific activity (1,870 U/mg) at 45 °C and pH 6.5. It was stable between pH 6.0-9.6 and below 40 °C. Although its activity was enhanced by NaCl, the enzyme was active in the absence of NaCl. CgiB&#95;Ce is an endo-type ι-carrageenase that hydrolyzes β-1,4-linkages of ι-carrageenan, yielding neo-ι-carratetraose as the main product (more than 80% of the total product).

An alginate lyase-producing bacterial strain, Vibrio sp. QY105, was isolated from sea mud of Qingdao. It secreted 90 % of total enzyme activity within the first 20 h of fermentation. An alginate lyase, AlyV5, with an apparent MW of 37 kDa and a specific activity of 2152 U/mg was purified from the culture supernatant. It was most active at 38 °C and pH 7.0 in 20 mM Tris/HCl. The enzyme was stable over a broad pH range (6.0-9.0) and retained ~40 % activity after holding at 90 °C for 10 min. AlyV5 showed activities towards both polyguluronate and polymannuronate, but degraded the former more efficiently. AlyV5 mainly produced disaccharide, trisaccharide and tetrasaccharide from polyguluronate, trisaccharide, tetrasaccharide and pentasaccharide from polymannuronate., Purpose of Work: The purpose of this study is to find a polyG-preference alginate lyase for the saccharification of alginate combined with our polyM-preference alginate lyases.

Background and Aims: The brachial-ankle pulse wave velocity (baPWV) is a marker for early atherosclerotic changes. Serum total bilirubin (TB) is an effective antioxidant and has been associated with carotid intima-media thickness, cardiovascular disease, stroke and peripheral arterial disease, all of which may be caused by arteriosclerosis. This study aimed to investigate the association of TB with arterial stiffness., Methods and Results: In this cross-sectional study, we investigated the relationship between TB and baPWV in 2207 participants (1331 men, 876 women) in a general health examination. Different metabolic parameters were compared across TB quartiles. Age-adjusted mean values of baPWV gradually decreased with TB quartiles in men (Q1 = 1348, Q2 = 1266, Q3 = 1215, and Q4 = 1154 cm/s). However, the age-adjusted means of baPWV had no significance in women according to TB quartiles. Univariate analysis showed that age, smoking status, BMI, SBP, DBP, AST, ALT, GGT, TB, TG, and HDL-C were significantly associated with baPWV in men, whereas only age, BMI, SBP, DBP, TG and FPG were significantly associated with baPWV in women. In addition, BMI, SBP, TB, age, TG, and AST were significant factors in the multivariate model with baPWV in men; only BMI and FPG were significant factors with baPWV in women., Conclusion: The findings show that serum total bilirubin concentration is negatively correlated to arterial stiffness in Chinese men. Early detection of abnormal bilirubin levels could potentially serve as an early biomarker for arterial stiffness., (Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.)

Vibrio anguillarum is the etiological agent of vibriosis, an aquaculture disease that affects a wide range of farmed fish. The genome of V. anguillarum contains five flagellin genes, i.e. flaA, flaB, flaC, flaD, and flaE. In this study, we analyzed the vaccine potential and adjuvanticity of FlaA, FlaB, FlaD, and FlaE in a model of Japanese flounder (Paralichthys olivaceus). For this purpose, recombinant FlaA, FlaB, FlaD, and FlaE were expressed in and purified from Escherichia coli. In vivo immunogenicity analysis showed that antibodies against rFlaA, rFlaB, rFlaD, and rFlaE were detected in rat antiserum raised against live V. anguillarum, with the highest antibody level being that against rFlaB. When administered into flounder via intraperitoneal injection, rFlaA, rFlaD, and rFlaE induced comparable relative percent survival (RPS) rates, which were significantly lower than that induced by rFlaB. Specific serum antibodies were induced by all flagellins, however, the antibody level induced by rFlaB was significantly higher than those induced by other three flagellins. Compared to sera from fish vaccinated with rFlaA, rFlaD, and rFlaE, serum from fish vaccinated with rFlaB significantly reduced the infectivity of V. anguillarum against host cells. To examine the potential adjuvant effect of the flagellins, flounder were immunized with rEsa1, a D15-like surface antigen that induces protective immunity as a subunit vaccine, in the presence or absence of rFlaA, rFlaB, rFlaD, and rFlaE respectively. The results showed that rFlaE, but not other three flagellins, significantly increased the RPS of rEsa1. Compared to fish vaccinated with rEsa1, fish vaccinated with rEsa1 plus rFlaE exhibited a significantly higher level of serum antibodies and enhanced expression of the genes involved in innate and adaptive immunity. Taken together, these results indicate that FlaA, FlaB, FlaD, and FlaE have different immunological properties and, as a result, differ in vaccine and adjuvant potentials., (Copyright © 2012 Elsevier Ltd. All rights reserved.)

Objective: To observe beta-catenin expression of Wnt signaling pathway in rats with knee osteoarthritis, and influence of Bushen Huoxue decoction on beta-catenin and MMP-7 expression of synoviocytes in rats with knee osteoarthritis (OA)., Methods: Rats model with knee osteoarthritis were established by Hulth method. Primary synoviocytes and OA synoviocytes were cultured with collagenase digestion method. The cultured synoviocytes were divided into normal group, OA model group and Bushen Huoxue decoction group. Western blotting method was used to detect beta-catenin, MMP-7 protein expression of synoviocytes after acting by Bushen Huoxue decoction for 48 h; ELISA method was used to detect MMP-7 expression of synovial supernatant., Results: OA synoviocytes were cultured successfully. Western blotting showed that beta-catenin, MMP-7 expression in OA synoviocytes was significantly higher than normal group, Bushen Huoxue decoction could significantly reduce beta-catenin, MMP-7 expression; ELISA results showed that MMP-7 expression of OA synovial supernatant was significantly higher than normal synoviocytes supernatant, Bushen Huoxue decoction significantly regulated the level MMP-7 down., Conclusion: (1) High expression of beta-catenin in OA synoviocytes indicates that Wnt classical signal pathway is activated in rat with knee osteoarthritis; (2) High expression of MMP-7 expression in OA synoviocytes confirms the MMP-7 is downstream genes of Wnt/beta-catenin signal pathway; (3) Activation of Wnt signal pathway and increase of MMP-7 may cause degradation of articular cartilage, and promote the formation of osteoarthritis; (4) Bushen Huoxue decoction can reduce expression of MMP-7, and promote cartilage repair, which may be one of mechanisms of osteoarthritis.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Aim: Construct prokaryotic expression vector carrying mouse TRBP (TAR RNA-binding protein) gene and test the double-stranded RNA binding ability of TRBP., Methods: RT-PCR was used to obtain TRBP cDNA from mouse genomic DNA. Then, we built the His-tag fusion expression vector of TRBP and transformed it into E.coli BL21(DE3). Ni-NTA beads were used to isolate and purify the recombinant protein and vitro transcription was used to get Pre-miR-122. Finally, SDS-PAGE and ITC (isothermal titration calorimetry) assay were both used to validate TRBP's binding ability with Pre-miR-122., Results: We purified the recombinant protein TRBP whose molecular weight is 32.4 kDa. The purified bioactive TRBP protein binding on NI-NTA beads showed that it had a strong binding capacity on Pre-miR-122., Conclusion: We constructed TRBP prokaryotic expression system successfully and studied the double-stranded RNA binding ability of TRBP preliminarily.

In this paper, the hepatoprotective effects of 2',4'-dihydroxy-6'-methoxy-3',5'-dimethylchalcone (DMC) on CCl(4)-induced acute liver injury in Kunming mice were investigated. DMC was administered intraperitoneally (ip) (5, 10, or 20 mg/kg of body weight) for 7 days prior to the administration of CCl(4) (0.1%, ip). Pretreatment with DMC significantly decreased activities of serum hepatic enzymes, namely alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase, alkaline phosphatase, γ-glutamyl transferase, and total bilirubin, and decreased the elevation of lipid peroxidation, malondialdehyde, reactive oxygen species, and protein carbonyl content. Pretreatment with DMC markedly increased activities of enzymatic antioxidants such as superoxide dismutase, catalase, glucose-6-phosphate dehydrogenase, glutathione peroxidase, glutathione S-transferase, and glutathione reductase and increased levels of nonenzymatic antioxidant markers such as reduced glutathione, total sulfhydryl groups, vitamin C, and vitamin E in liver. These results combined with liver histopathology demonstrate that DMC has potential hepatoprotective effects, which may be related to the attenuation of oxidative stress, accelerating the antioxidant cascade and inhibition of lipid peroxidation.

Background & Objectives: Curcuma longa (turmeric) has a long history of use in Ayurvedic medicine as a treatment for inflammatory conditions. The purpose of the present study was to investigate the preventive effects of curcumin against acute pancreatitis (AP) induced by caerulein in mouse and to elucidate possible mechanism of curcumin action., Methods: Curcumin (50 mg/kg/day) was intraperitoneally injected to Kun Ming male mice for 6 days, followed by injection of caerulein to induce AP. GW9662 (0.3 mg/kg), a specific peroxisome proliferator-activated receptor gamma (PPARγ) antagonist, was intravenously injected along with curcumin. Murine macrophage RAW264.7 cells were treated with 100 μmol/l curcumin for 2 h, and then stimulated with 0.1 μ g/ml lipopolysaccharide (LPS). Serum amylase and transaminase levels were measured at 10 h after AP. TNF-α level in mouse serum and cell culture medium were detected by ELISA. Expression of PPARγ and NF-κB were analyzed by RT-PCR and Western blot., Results: Curcumin significantly decreased the pancreas injury and reversed the elevation of serum amylase, ALT and AST activities and TNF-α level in mice with AP. Curcumin treatment inhibited the elevation of NF-κB-p65 in the nucleus of mouse pancreas AP group and RAW264.7 cells, but significantly increased the expression of PPARγ. GW9662 could abolish the effects of curcumin on serum levels of amylase, ALT, AST, TNF-α, and NF-κB level., Interpretation & Conclusions: Our results suggest that curcumin could attenuate pancreas tissue and other organ injury by inhibiting the release of inflammatory cytokine TNF-α. These effects may involve upregulation of PPARγ and subsequent downregulation of NF-κB.

The toxicity of perfluorooctane sulfonate (PFOS), a persistent organic compound, is of great concern. Several studies have reported that PFOS decreases circulating thyroid hormone (TH) concentrations. However, the mechanisms involved remain to be determined. Female rats were exposed to (1) vehicle; (2) PFOS (0.2, 1.0, and 3.0 mg/kg); (3) propylthiouracil (PTU, 10 mg/kg); or (4) PTU (10 mg/kg) + PFOS (3.0 mg/kg) by gavage once a day for 5 consecutive days. Parameters including contents of total T4 (TT4) and total T3 (TT3) in both serum and bile, serum concentrations of transthyretin and thyroglobulin, as well as transcripts of transporters involved in hepatic uptake and efflux of T4 were determined in control and PFOS-exposed groups. TT4 and TT3 were also analyzed in PTU and PTU + PFOS groups in order to reflect the different hormone effects between PFOS, PTU, and PFOS + PTU. Results showed that serum TT4 and TT3 decreased, while bile TT4 and TT3 remained stable following PFOS exposure. Exposure to 3.0 mg/kg of PFOS significantly enhanced hepatic organic anion transporter OATP2 mRNA expression (1.43 times of control). Treatment with PFOS increased hepatic expression of multidrug resistance--associated protein MRP2, approximately 1.80 and 1.69 times of control in 1.0 and 3.0 mg/kg groups, respectively. Spearman's correlation coefficients revealed that MRP2 mRNA expression correlated well with serum TT4 level (r = -0.528, P = 0.012). Serum thyroglobulin and transthyretin levels remained stable. Serum TT3, bile TT4, and bile TT3 were significantly different between PFOS and PTU groups. No significant differences of TT4 and TT3 in both serum and bile were observed between PTU and PTU + PFOS (P > 0.05). In conclusion, PFOS increased hepatic expression of OAPT2, which could possibly enhance hepatic uptake and metabolism of T4 in rats. PFOS-induced TT4 deficiency is mainly due to the extrathyroidal metabolism of T4, which is probably different from the classic goitrogen, PTU.

In recent years, antibiotic resistance of bacteria has become a global health crisis. Especially, the new class of "superbug" was found in South Asia, which is resistant to almost known antibiotics and causes worldwide alarm. Through the underlying mechanisms of bacterial pathogenecity, the expression of many pathogen virulence factors is regulated by the process of quorum sensing. Screening efficient quorum sensing inhibitors is an especially compelling approach to the future treatment of bacterial infections and antibiotic resistance. This article focuses on bacterial quorum sensing system, quorum sensing screening model for in vitro and evaluation of animal models in vivo, recent research of quorum sensing inhibitors and so on.

Purpose: Purple sweet potato (PSP) pigments have been widely accepted as antioxidants but their radioprotective effect still remains unclear. In this study we investigated the effect of PSP pigments on ⁶⁰Co γ-ray-induced mitochondria-mediated apoptosis in murine thymocytes., Materials and Methods: The murine thymocytes were pretreated by PSP pigments before exposure to 4 Gy ⁶⁰Co γ-rays. Flow cytometry analysis was used to measure apoptotic cells and mitochondrial membrane potential. Reactive oxygen species (ROS) were detected using 2',7',-dichlorofluorescein diacetate (DCFH-DA) probe and the activity of antioxidant enzymes was tested by biochemical assay after irradiation. Cytochrome c, caspase-3 and poly ADP-ribose polymerase (PARP) were measured by Western blotting., Results: After treatment with PSP pigments and exposure to 4 Gy radiation the apoptosis of thymocytes was reduced and the mitochondrial transmembrane potential was maintained compared to control cells. In the presence of PSP pigments, ROS were reduced and the activities of glutathione peroxidase (GSH-px) and superoxide dismutase (SOD) were protected and in some cases increased. All the pro-apoptotic proteins (cytochrome oxidase, caspase 3 and PARP) decreased in PSP pigments pretreated thymocytes compared to irradiated cells in the absence of PSP pigments., Conclusions: Pre-treatment with PSP pigments significantly inhibited ⁶⁰Co γ-ray-induced mitochondria-mediated apoptosis. This radioprotective effect might be related to ROS scavenging, the enhancement of the activity of antioxidant enzymes, the maintenance of mitochondrial transmembrane potential, and the sequential inhibition of cytochrome c release and downstream caspase and PARP cleavage.

Perfluorooctane sulfonate (PFOS), an environmentally persistent organic pollutant, has been reported to be transferred to the developing organisms via both placenta and breast milk. A cross-foster model was used to determine whether prenatal or postnatal exposure to PFOS alone can disturb the TH homeostasis in rat pups, and if so, which kind of exposure is a major cause of TH level alteration. Pregnant rats were fed standard laboratory rodent diet containing 0 (control) or 3.2 mg PFOS/kg throughout gestation and lactation period. On the day of birth, litters born to treated and control dams were cross-fostered, resulting in the following groups: unexposed control (CC), pups exposed only prenatally (TC), only postnatally (CT) or both prenatally and postnatally (TT). Serum and liver PFOS concentrations, serum total thyroxine (T4), total triiodothyronine (T3), reverse T3 (rT3) levels, and hepatic expression of genes involved in TH transport, metabolism, and receptors were evaluated in pups at the age of postnatal days (PNDs) 0, 7, 14, 21, or 35. PFOS body burden level in pups in group CT increased, while those in group TC dropped as they aged. Neither total T3 nor rT3 in pups was affected by PFOS exposure. Gestational exposure to PFOS alone (TC) significantly (p < 0.05) decreased T4 level in pups on PNDs 21 and 35, 20.3 and 19.4% lower than the control on the same PND, respectively. Postnatal exposure to PFOS alone (CT) also induced T4 depression on PNDs 21 and 35, 28.6 and 35.9% lower than controls, respectively. No significant difference in T4 level (p > 0.05) was observed between TC and CT on these two time points. None of the selected TH related transcripts was affected by PFOS in pups on PND 0. Only transcript level of transthyretin, TH binding protein, in group TT significantly increased to 150% of the control on PND 21. The results showed that prenatal PFOS exposure and postnatal PFOS exposure induced hypothyroxinemia in rat pups to a similar extent, which suggested that in utero PFOS exposure and postnatal PFOS accumulation, especially though maternal milk, are matters of great concern.

The potential toxicity of perfluorooctane sulfonate (PFOS), an environmentally persistent organic pollutant, is of great concern. The present study examines the ability of PFOS to disturb thyroid function and the possible mechanisms involved in PFOS-induced thyroid hormone alteration. Male Sprague-Dawley rats were exposed to 1.7, 5.0, and 15.0 mg/L of PFOS in drinking water for 91 consecutive days. Serum was collected for analysis of total and free thyroxine (T4), total triiodothyronine (T3), and thyrotrophin (TSH). Thyroid and liver were removed for the measurement of endpoints closely related to thyroid hormone biosynthesis and metabolism following PFOS exposure. Determined endpoints were the messenger RNA (mRNA) levels for two isoforms of uridine diphosphoglucuronosyl transferases (UGT1A6 and UGT1A1) and type 1 deiodinase (DIO1) in liver, sodium iodide symporter (NIS), TSH receptor (TSHR), and DIO1 in thyroid as well as the activity of thyroid peroxidase (TPO). Serum total T4 level decreased significantly at all applied dosages, whereas total T3 level increased markedly only at 1.7 mg/L of PFOS. No statistically significant toxic effects of PFOS on serum TSH were observed. Hepatic UGTIA1, but not UGT1A6, mRNA was up-regulated at 5.0 and 15.0 mg/L of PFOS. Treatment with PFOS lowered hepatic DIO1 mRNA at 15.0 mg/L but increased thyroidal DIO1 mRNA dose dependently. The activity of TPO, NIS, and TSHR mRNA in thyroid were unaffected by PFOS treatment. These results indicate that increased hepatic T4 glucuronidation via UGT1A1 and increased thyroidal conversion of T4 to T3 via DIO1 were responsible in part for PFOS-induced hypothyroxinemia in rats.

Aim: Polypeptide from Chlamys farreri (PCF, molecular mass is 879) is a new marine polypeptide compound isolated from Chlamys farreri. This study investigates the possible protective roles and the mechanism of PCF against ultraviolet B (UVB)-induced apoptosis in murine thymocytes., Methods: The rate of apoptosis and caspase-3 activation was measured by flow cytometry. The expression of stress-response genes c-fos and c-jun was observed by RT-PCR. Western blot analysis was performed to determine the release of cytochrome c., Results: It was found that UVB induced murine thymocyte death. The cells treated with UVB showed an increase in cytochrome c release, caspase-3 activity, as well as in the expression of c-fos and c-jun. In addition, all were involved in UVB-induced cell apoptosis., Conclusion: Our present observations pointed to the ability of PCF to avert UVB-induced apoptosis in thymocytes by modulating c-fos and c-jun expression, cytochrome c release, and the consequent activation of caspase-3, which were essential components of the UV-induced cell apoptotic pathway. The results suggested that PCF is a promising protective substance against UV radiation.

Contrast to planktonic cells, biofilms are complex communities of microorganisms that develop on biotic or abiotic surfaces. Most of bacteria can form biofilms under proper conditions. Once biofilm form, the inner bacteria cells often exhibit reduced antibiotic susceptibility than their free-floating counterparts, so conventional methods of killing bacteria, such as antibiotics and disinfections are often ineffective with them. Biofilms may cause huge economic loss in equipment damage, product contamination, energy losses and medical infections. Therefore, bacterial biofilm is evolving as a focal problem and an active area of research. As a relatively new area, the progress of biofilm science depends on the development of a satisfactory set of methods. But the classic methods to study planktonic bacteria cannot fulfill the biofilm research, one for which there are few widely accepted methodological standards. Even though biofilms are complicated physical-chemical-biological systems, experience demonstrates that accessible research methods are feasible. In this paper, the theories, principles, merits and limitations of some methods currently used in bacterial biofilm researches, involving artificial biofilm forming and biofilm measurement, were discussed.

The C-terminal region of the merozoite surface protein 1 (MSP119) is one of the most promising vaccine candidates against the erythrocytic forms of malaria. In the present study, a gene encoding Plasmodium falciparum MSP119 was expressed in yeast Pichia pastoris. A non-glycosylated form of the recombinant protein MSP119 was purified from culture medium. This recombinant protein maintains its antigenicity. Significant immune responses were seen in C57BL/6 mice after the second immunization. Moreover, the specific antibodies recognized the native antigens of P. falciparum. The prevailing isotypes of immunoglobulin (Ig) G associated with immunization were IgG1, IgG2a and IgG2b. The antibodies isolated from mouse sera immunized with MSP119 can inhibit parasite growth in vitro. Based on these immunological studies, we concluded that MSP119 deserves further evaluation in pre-clinical immunizations against P. falciparum.

The gene (alyVI) encoding an alginate lyase of marine bacterium Vibrio sp. QY101, which was isolated from a decaying thallus of Laminaria, was cloned using a strategy of combined degenerate PCR and long range-inverse PCR (LR-IPCR), then sequenced and expressed in Escherichia coli. Gene alyVI was composed of a 1014 bp open reading frame (ORF) encoding 338 amino acid residues. The calculated molecular mass of alyVI product is 38.4 kDa, but a signal peptide is cleaved off, leaving a mature protein of 34 kDa. AlyVI was purified from culture supernatants to electrophoretic homogeneity using affinity chromatography. AlyVI was most active at pH 7.5 and 40 degrees C in the presence of 1 mM ZnCl2. A nine-amino-acid consensus region (YXRESLREM), which was only found in polyguluronate lyases, was also observed in the amino-terminal region of AlyVI. However, AlyVI could degrade both M block and G block. These results indicate that a novel alginate lyase-encoding gene has been cloned.

Aim: To explore the pathophysiological significance of delayed type hypersensitivity (DTH) reaction in mouse gastrointestinal tract induced by an allergen 2,4-dinitrochlorobenzene (DNCB)., Methods: BALB/c mice were randomly divided into control and DTH(1-6) groups. After sensitized by DNCB smeared on the abdominal skin, the mice were challenged with DNCB by gavage or enema. The weight, stool viscosity and hematochezia were observed and accumulated as disease active index (DAI) score; the gastrointestinal motility was represented by active charcoal propulsion rate; the colon pathological score was achieved by macropathology and HE staining of section prepared for microscopy; and the leukocyte migration inhibitory factor (LMIF) activity was determined by indirect capillary assay of the absorbance (A) of migrated leukocytes., Results: Active charcoal propulsion rates of small intestine in the DNCB gavages groups were significantly higher than that in the control group (P<0.01). The DAI scores and pathological score in DNCB enema groups were also higher than that in the control group (P<0.05), and there were significant rises in LMIF activity in DNCB enema groups as compared with control groups (P<0.01)., Conclusion: Mouse gastrointestinal DTH reaction could be induced by DNCB, which might facilitate the mechanism underlying the ulcerative colitis.

Aim: To investigate the antioxidant mechanisms of propylene glycol mannate sulfate (PGMS) in hyperlipidemic rats., Methods: Male Wistar rats were given high lipid emulsion diet to establish hyperlipidemic model. PGMS was given every day at different doses (37.8 and 75.6 mg.kg-1, ig) to hyperlipidemic rats for three weeks. In addition, diethyldithiocarbamate (DDC) was given 200 mg.kg-1.3 d-1 (i.p.) to inhibit SOD activity. Then, the MDA content was examined using TBA method to show the oxidation level, and the activities of SOD, GSH-Px and CAT were examined following the kit protocols to indicate the capability of eliminating OFR. RT-PCR was applied to study the expression of Cu, Zn-SOD mRNA in rat liver., Results: The MDA content of PGMS treatment groups decreased markedly compared with hyperlipidemic group, and the activities of SOD, GSH-Px and CAT increased distinctly. Cu, Zn-SOD mRNA expression was significantly increased by PGMS treatment. Furthermore, the application of DDC(the SOD inhibitor) reduced total SOD activity and Cu, Zn-SOD mRNA expression induced by PGMS, and the content of MDA increased correspondingly., Conclusion: PGMS can induce the activities of antioxidant enzymes and the mRNA expression of Cu, Zn-SOD, which contribute to the elimination of oxygen free radical. This may explain the molecular mechanism of antioxidant effects of PGMS.

Aim: To study the effects of prophylene glycol mannate sulfate (PGMS) on monocyte chemoattractant protein-1 (MCP-1) mRNA expression in hyperlipidemic rat aorta and to clarify the molecular mechanism of PGMS for the prevention of atherosclerosis., Methods: PGMS (37.8 and 75.6 mg.kg-1.d-1, ig) or PGMS (37.8 and 75.6 mg.kg-1.d-1, ig) combined with diethyldithiocarbamate (DDC, an inhibitor of SOD, 200 mg.kg-1 every three days, i.p.) were given to hyperlipidemic rats for three weeks. The MDA content and SOD activity were determined after 12 h of starvation, and MCP-1 mRNA expression in aorta was detected by reverse transcription-polymerase chain reaction (RT-PCR)., Results: There was significant decrease (29.46% or 58.40)% of MCP-1 mRNA expression in aortic after the therapy. The SOD activity increased markedly and the MDA content decreased at the same time. After treatment with DDC, the SOD activity was inhibited and the MDA content increased, but with no significant effect on MCP-1 mRNA expression., Conclusion: PGMS inhibited MCP-1 mRNA expression with no relation to its effect on decreasing MDA content.

Extracellular alginate lyase secreted by Vibrio sp. QY101, which was isolated from brown algae, was purified to homogeneity by a combination of ammonium sulfate precipitation, DEAE-Sepharose Fast Flow anion-exchange chromatography and Superdex 75 gel filtration chromatography. Its molecular mass was 39 kD as determined by SDS-PAGE analysis. The enzyme had an optimal temperature of 30 degrees for its activity, and was most active at pH 7.5. The thermal and pH stability were 0-30 degrees, and pH 6.5-8.5, respectively. The enzyme activity was stimulated by 0.5 mol/L NaCl, 1.0 mmol/L Ca(2+) or 5.0 mmol/L (Mn(2+), and inhibited by 5.0 mmol/L Ni(2+), 1.0 mmol/L Fe2+) or 1.0 mmol/L EDTA. Preliminary analysis on substrate specificity showed that this alginate lyase had activity on both poly-alpha 1,4-L-guluronate and poly-beta1,4-D-mannuronate substrates.

Gene targeting is a rising technology in molecular biology,which is defined as the introduction of exogeneous DNA to specific site in genome by homologous recombination,and consequently change the hereditary character of the cell. This technology provides a new and powerful means for research in developmental biology,molecular genetics,immunology and medicine. Progresses have been made in exploring gene structure and function,gene expression and regulation,transgene and gene therapy with the application of gene targeting. But there are some problems in gene targeting,especially for the low efficiency. This article just provided a review of the principle and program of gene targeting,and discussed the possible approaches to increase the efficiency of gene targeting.

Aim: To study the effect of propylene glycol mannate sulfate (PGMS) on blood lipids and lipoprotein lipase in hyperlipidemic rat, and its anti-hyperlipidemic mechanism., Methods: PGMS was administered ig at different doses (37.8 mg.kg-1.d-1 and 75.6 mg.kg-1.d-1) to hyperlipidemic rats for three weeks and blood serum was obtained after starved 12 h. Total cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL-C) and high density lipoprotein cholesterol (HDL-C) were examined. The mRNA expression of lipoprotein lipase (LPL) in liver, spleen and artery was detected by reverse transcription polymerase chain reaction (RT-PCR)., Results: PGMS significantly decreased the levels of TC, TG and LDL-C and increased that of HDL-C in hyperlipidemic serum dose-dependently. PGMS was shown to increase the level of LPL mRNA expression, which is related directly to the controlling effects of PGMS on blood lipids., Conclusion: PGMS modulated blood lipids by promoting mRNA expression of LPL. This may be one important mechanism of PGMS to modulate blood lipids.

Interleukin (IL) 12 treatment in the CSA1M and OV-HM, but not in Meth A tumor models,induces tumor regression that is associated with T-cell migration to tumor sites.Here, we investigated the role of the CC chemokine receptor (CCR)5 in T-cell migration induced after IL-12 treatment. In the two IL-12-responsive tumor models (CSA1M and OV-HM), IL-12 treatment up-regulated the mRNA expression of CCR5 in splenic T cells as well as ligands for CCR5, such as macrophage inflammatory protein (MIP) 1alpha and MIP-1beta in tumor masses. In contrast, the expression of CCR5 in spleens and MIP-1alpha/MIP-1beta in tumor masses was marginally induced before and even after IL-12 treatment in the Meth A model in which T-cell migration is not observed. T cells infiltrating tumor masses in the former two IL-12-responsive models expressed CCR5. Administration of a synthetic CCR5 antagonist TAK-779 to tumor-bearing mice during IL-12 immunotherapy prevented T-cell migration and tumor regression. Furthermore, anti-CCR5 antibody was found to inhibit T-cell migration in the lymphoid cell migration assay. Namely, although splenic T cells prepared from IL-12-treated CSA1M or OV-HM-bearing mice migrated into the corresponding tumor masses in recipient mice, the migration was inhibited when donor T cells were treated with anti-CCR5 antibody before the injection. These results indicate a critical role for CCR5 in the induction of T-cell migration to tumor sites after IL-12 treatment.