Search

BackgroundA hepatocellular carcinoma (HCC) prediction model (ASAP), including age, sex, and the biomarkers alpha-fetoprotein and prothrombin induced by vitamin K absence-II, showed potential clinical value in the early detection of HCC. We validated and updated the model in a real-world cohort and promoted its transferability to daily clinical practice.MethodsThis retrospective cohort analysis included 1012 of the 2479 eligible patients aged 35 years or older undergoing surveillance for HCC. The data were extracted from the electronic medical records. Biomarker values within the test-to-diagnosis interval were used to validate the ASAP model. Due to its unsatisfactory calibration, three logistic regression models were constructed to recalibrate and update the model. Their discrimination, calibration, and clinical utility were compared. The performance statistics of the final updated model at several risk thresholds are presented. The outcomes of 855 non-HCC patients were further assessed during a median of 10.2 months of follow-up. Statistical analyses were performed using packages in R software.ResultsThe ASAP model had superior discriminative performance in the validation cohort [C-statistic = 0.982, (95% confidence interval 0.972–0.992)] but significantly overestimated the risk of HCC (intercept − 3.243 and slope 1.192 in the calibration plot), reducing its clinical usefulness. Recalibration-in-the-large, which exhibited performance comparable to that of the refitted model revision, led to the retention of the excellent discrimination and substantial improvements in the calibration and clinical utility, achieving a sensitivity of 100% at the median prediction probability of the absence of HCC (1.3%). The probability threshold of 1.3% and the incidence of HCC in the cohort (15.5%) were used to stratify the patients into low-, medium-, and high-risk groups. The cumulative HCC incidences in the non-HCC patients significantly differed among the risk groups (log-rank test, p-value ConclusionsThe ASAP model is an accurate tool for HCC risk estimation that requires recalibration before use in a new region because calibration varies with clinical environments. Additionally, rational risk stratification and risk-based management decision-making, e.g., 3-month follow-up recommendations for targeted individuals, helped improve HCC surveillance, which warrants assessment in larger cohorts.

Background In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. Methods The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. Results The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. Conclusion With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Background: Identification of accurate targets is essential for a successful development of targeted therapy in cancer. Studies have shown that matrine has antitumor activity against many types of cancers, including lung cancer, breast cancer, liver cancer, pancreatic cancer, ovarian cancer and leukemia, etc. However, the direct target in cancer cells of its anticancer effect has not been identified. The purpose of this study was to find the molecular target of matrine to inhibit the proliferation of cancer cells and explore its mechanism of action. Methods: The effect of matrine on the proliferation of cancer cells were examined by MTT assay. Pull-down assay with matrine-amino coupling resins (MA beads) and liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) were performed to explore the target of matrine. The target of matrine was further validated by competitive binding assay, cellular thermal shift assay (CETSA) and drug affinity responsive target stability (DARTS). A series of in vitro and in vivo experiments were conducted to reveal the mechanisms by which matrine targeted Src to regulate the downstream signaling pathways of Src in cancer cells. Results: Herein we showed that matrine inhibited the proliferation of cancer in vitro and in vivo. Pull-down assay with MA beads and LC-MS/MS identified Src as the target of matrine. The findings provided solid evidences that matrine directly bound to Src and Src kinase domain is required for its interaction with matrine and Ala392 in the kinase domain participated in matrine-Src interaction. Intriguingly, matrine was proven to inhibit Src kinase activity in a non-ATP-competitive manner by blocking the autophosphorylation of Tyr419 in Src kinase domain. Matrine down-regulated the phosphorylation levels of MAPK/ERK, JAK2/STAT3 and PI3K/Akt signaling pathways via targeting Src.Conclusions: Collectively, matrine targeted Src, inhibited its kinase activity and down-regulated its downstream MAPK/ERK, JAK2/STAT3 and PI3K/Akt phosphorylation signaling pathways to inhibit the proliferation of cancer cells.

Background To evaluate the ability of peripheral blood inflammatory markers in predicating the typing of COVID‐19, prognosis, and some differences between COVID‐19 and influenza A patients. Methods Clinical data on 285 cases laboratory‐confirmed as SARS‐CoV‐2 infection were obtained from a Wuhan local hospital's electronic medical records according to previously designed standardized data collection forms. Additional 446 Influenza A outpatients’ hematologic data were enrolled for comparison. Results NLR, SII, RLR, PLR, HsCRP, and IL‐6 were significant higher and LMR was lower in severe COVID‐19 patients than in mild COVID‐19 patients (p, To evaluate the ability of peripheral blood inflammatory markers in predicating the typing of COVID‐19, prognosis, and some differences between COVID‐19 and influenza A patients.

BACKGROUND The aim of this study was to investigate the antimicrobial property of peptide LL-37 sequences. MATERIAL AND METHODS Humanized antibacterial peptide LL-37 and the mutant were prepared by chemical synthesis. The physicochemical properties of antibacterial peptide LL-37 were analyzed by SWISS-MODEL online prediction tool. Molecular docking between antibacterial peptide LL-37 fragments and palmitoyl transferase PagP was made with Lamarckian genetic algorithm by AutoDock1.5.6. RESULTS The systems contacted each other at 8.75 picosec. After 20 picsec, the system had no trend of dissociation, and the bond energy of weak bond -C-O-H…NH2-CH2- was calculated. The hydrophobic groups were important factors that led to contact and merged the two parts. The contacted weak bond -C-O-H…NH2-CH2- was the bridge for contacting LL-37 with palmitoyl transferase PagP. The binding sites of antibacterial peptide LL-37 and palmitoyl transferase PagP mainly included LYS8, GLU11, LEU28, LYS12, PHE27, ILE13, and PHE6 of antibacterial peptide LL-37 and ARG94, TRP89, ASN65, SER3, GLU90, GLU90, ASN100, HIS102, and THR92 of palmitoyl transferase PagP. CONCLUSIONS Antibacterial peptide LL-37 had stronger antibacterial effect via inhibition of activity of PagP.

Infection with human papillomavirus (HPV), particularly HPV16 and HPV18, is the main cause of invasive cervical cancer, although other factors such as herpes simplex virus (HSV) may act in conjunction with HPV in this context. To explore the possibility of developing a system for rapid diagnosis and clinical screening of cervical cancer, we developed a multiplex real-time PCR assay that can simultaneously detect and quantify HPV16/18 and HSV1/2. To evaluate its possibilities and practical uses, 177 samples collected from patients with suspected HPV and HSV infection in exfoliated cervical cells, genital herpes or labial herpes were tested by multiplex real-time PCR and compared with results obtained by DNA sequencing. Each virus was detected over a range from 1.0 × 10 1 to 1.0 × 10 7 copies/reaction. The clinical sensitivity was 100% for HPV16/18 and HSV1/2. The clinical specificity was 97.1% for HPV16, 98.1% for HPV18, 97.0% for HSV1 and 96.0% for HSV2. The kappa value was 0.96 for HPV16, 0.92 for HPV18, 0.94 for HSV1 and 0.93 for HSV2, when DNA sequencing was used as the reference standard. In summary, this novel multiplex real-time PCR allows the rapid and specific detection of HPV16/18 and HSV1/2, as well as coinfection with HPV and HSV, in clinical samples. In the future, this multiplex real-time PCR assay will assist in cervical cancer screening, viral treatment evaluation and epidemiological studies in which high throughput analysis is required.

To explore the possibilities of a novel multiplex real-time PCR system for rapid diagnosis, genetic typing of serovars and clinical application in NGU, we developed a multiplex real-time PCR system for the simultaneous diagnosis of Chlamydia trachomatis, Ureaplasma parvum and Ureaplasma urealyticum and molecular detection of serovars of C. trachomatis and U. parvum in NGU using the SNP technology and TaqMan-LNA probe. In 57 pathogen-positive clinical specimens, we identified the following C. trachomatis serovars: D (20.05%, 12/57), E (36.84%, 21/57), F (19.30%, 11/57), G (8.77%, 5/57), H (5.26%, 3/57), J (3.51%, 2/57), and K (5.26%, 3/57). In 115 pathogen-positive clinical specimens, we identified the following U. parvum serovars: 1 (0.87%, 2/115), 3 (55.65%, 64/115), 6 (20.87%, 24/115) and 14 (21.74%, 25/115). Our fast pathogen diagnosis and serotyping assay using real-time TaqMan-LNA PCR may improve our ability to study the pathogenesis and epidemiology of NGU.

Objective: There are a lot of disagreements in the studies on hepatitis B virus (HBV) DNA polymerase mutation rate associated with nucleos(t)ide analogues (NAs) in treatment-naive chronic hepatitis B (CHB) patients. This is the first study aimed to investigate the prevalence of spontaneous HBV resistance mutations in Central China. Methods: This study included treatment-naive patients with CHB from June 2012 to May 2015 receiving care at the Institute of Liver Disease in Central China. All patients completed a questionnaire covering different aspects, such as family medical history, course of liver disease, medication history, alcohol use, among others. Mutations in HBV DNA polymerase associated with NAs resistance were detected using INNO-LiPA assay. Results: 269 patients were infected with HBV genotype B (81.4%), C (17.9%), and both B and C (0.7%). Mutations in HBV DNA polymerase were detected in 24 patients (8.9%) including rtM204I/V (n = 6), rtN236T (n = 5), rtM250V (n = 2), rtL180M (n = 2), rtT184G (n = 1), rtM207I (n = 1), rtS202I (n = 1), rtM204V/I & rtL180M (n = 5), and rtM204I & rtM250V (n = 1). Conclusion: Spontaneous HBV resistance mutations in HBV DNA polymerase were found in treatment-naive patients with CHB in Central China. These findings suggest that we should analyze HBV DNA polymerase resistance mutation associated with NAs before giving antiviral therapy such as lamivudine (LAM), adefovir (ADV), and telbivudine (LdT). Keywords: Hepatitis B virus, Chronic hepatitis B, Viral resistance mutations

Persistent infection with high-risk HPV, particularly Type HPV 16 and 18, is necessary in the development of cervical cancer, but apart from HPV infection, other causative factors of most cervical cancers remain unknown. The aim of this study was to determine the prevalence of HPV 16 and HPV 18 and HSV 1 and HSV 2 in cervical samples, and to assess the role of HSVs in cervical carcinogenesis. Two hundred thirty-three healthy controls and 567 cases (333 of cervicitis, 210 of cervical intraepithelial neoplasia, and 24 of squamous cell carcinoma) in cervical exfoliative cells were tested for HPV 16, HPV 18, HSV 1, and HSV 2 DNA using the triplex real-time polymerase chain reaction method. In contrast to healthy women, positive rate of HPV is related significantly to cervical lesions (odds ratios (ORs) = 4.1, P0.01 for cervical intraepithelial neoplasia; ORs = 24.9, P0.01 for squamous cell carcinoma), but not cervicitis (ORs = 2.3, P0.05). HSV 2 prevalence in cervical intraepithelial neoplasia and squamous cell carcinoma was higher than in healthy women (ORs = 4.9, P0.05 for cervical intraepithelial neoplasia; ORs = 4.7, P0.05 for squamous cell carcinoma). HSV 2 coinfection with HPV in cervical intraepithelial neoplasia and squamous cell carcinoma was strongly higher than in healthy women (ORs = 34.2, P0.01 for cervical intraepithelial neoplasia; ORs = 61.1, P0.01 for squamous cell carcinoma). The obtained results indicated that the presence of HPV is associated closely with cervical cancer, and that HSV 2 infection or co-infection with HPV might be involved in cervical cancer development, while HSV 1 might not be involved.

Schistosomiasis is a major infectious disease and a public health concern in many areas in China and other countries. Sensitive method for detection of the parasite is critical for early diagnosis and for monitoring of effective treatment of the disease. In this study, we developed a highly sensitive TaqMan real-time PCR assay for the detection of Schistosoma japonicum DNA in mouse feces and serum samples. This assay was based on the DNA sequence of the S. japonicum 18S rRNA gene and was able to detect 10 fg of S. japonicum genomic DNA, which is 100 times more sensitive than conventional PCR. We were able to detect the S. japonicum DNA one week post-infection in mouse sera and 4 weeks post-infection in feces, which was one week earlier than egg detection by microscopy in feces. This assay was also highly specific for Asian Schistosomes which are causative species of human Schistosomiasis. In single sex male cercariae infected mice, parasite DNA was only detected in the first 4 weeks post-infection, suggesting that the DNA was derived from decaying worms’ corpse in the first 4 weeks whereas the DNA was mainly from decaying parasite eggs afterwards. Therefore we conclude that the established TaqMan real-time PCR assay is a sensitive, specific and convenient method that could be used for the early diagnostic evaluation of S. japonicum infection in humans and for monitoring outbreaks in endemic areas with low prevalence.