Search

Abstract OMA1 is an ATP-independent zinc metalloprotease essential for maintaining mitochondrial homeostasis and plays a vital role in tumorigenesis. Depending on the type of cancer, a decrease in OMA1 expression has been linked to a varying prognosis for patients. The role of OMA1 in human osteosarcoma (OS), one of the most prevalent malignant bone tumors, remains elusive. Here, we observed elevated OMA1 expression in OS tumor tissues from four patients with advanced OS. Knockout of OMA1 in OS cells significantly reduces OS tumor weight and size, and lung metastatic nodules in BALB/c nude mice. Immunohistochemistry analysis showed a significant decrease in Ki67 and an increase in Cleaved-caspase 3 in OMA1 knockout tumor samples. Mechanistically, we found that OMA1 deficiency increases the levels of PINK1 and Parkin and consequently induces excessive mitophagy, leading to increased apoptosis and reduced cell proliferation and invasion in OS cells. Specifically, OMA1 deficiency reduces the amount of cytosolic p53 and p53-associated cytosolic Parkin but increases mitochondrial p53, which may lead to enhanced apoptosis. Regarding the effect on cell proliferation and invasion, loss of OMA1 reduces mitochondrial ROS levels and increases cytosolic glycogen synthase kinase 3β (GSK3β) levels, thereby increasing interaction between GSK3β and β-catenin and then reducing cytosolic and nuclear β-catenin. This contributes to reduced cell proliferation and migration in OMA1-deficient cells. Moreover, we found that ciclopirox (CPX), an antifungal drug, induces OMA1 self-cleavage and L-OMA1 degradation in cultured OS cells. CPX also reduces tumor development of control OS cells but not OMA1-deficient OS cells in mice. These findings strongly support the important role of OMA1 in OS tumorigenesis and suggest that OMA1 may be a valuable prognostic marker and a promising therapeutic target for OS.

Abstract Osteoarthritis is a degenerative joint disease with joint pain as the main symptom, caused by fibrosis and loss of articular cartilage. Due to the complexity and heterogeneity of osteoarthritis, there is a lack of effective individualized disease-modifying osteoarthritis drugs in clinical practice. Chondrocyte senescence is reported to participate in occurrence and progression of osteoarthritis. Here we show that small molecule 10-hydroxy-2-decenoic acid suppresses cartilage degeneration and relieves pain in the chondrocytes, cartilage explants from osteoarthritis patients, surgery-induced medial meniscus destabilization or naturally aged male mice. We further confirm that 10-hydroxy-2-decenoic acid exerts a protective effect by targeting the glycosylation site in the Asp_Arg_Hydrox domain of aspartyl β-hydroxylase. Mechanistically, 10-hydroxy-2-decenoic acid alleviate cellular senescence through the ERK/p53/p21 and GSK3β/p16 pathways in the chondrocytes. Our study uncovers that 10-hydroxy-2-decenoic acid modulate cartilage metabolism by targeting aspartyl β-hydroxylase to inhibit chondrocyte senescence in osteoarthritis. 10-hydroxy-2-decenoic acid may be a promising therapeutic drug against osteoarthritis.

Abstract We report a theoretical investigation of the ultrafast dynamics of electrons and phonons in strained monolayer WS2 following photoexcitation. We show that strain substantially modifies the phase space for electron-phonon scattering, unlocking relaxation pathways that are unavailable in the pristine monolayer. In particular, strain triggers a transition between distinct dynamical regimes of the non-equilibrium lattice dynamics characterized by the emission of chiral phonons under high strain and linearly-polarized phonons under low strain. For valley-polarized electronic excitations, this mechanism can be exploited to selectively activate the emission of chiral phonons – phonons carrying a net angular momentum. Our simulations are based on state-of-the-art ab-initio methods and focus exclusively on realistic excitation and strain conditions that have already been achieved in recent experimental studies. Overall, strain emerges as a powerful tool for controlling chiral phonons emission and relaxation pathways in multivalley quantum materials.

Background: The mechanism by which chondrocyte senescence aggravate OA progression has not yet been well elucidated. The aim of this study was to investigate the chondrocyte senescence related gene biosignatures in OA, and to analyze on the underlying mechanisms of senescence in OA. Materials and methods: We intersected osteoarthritis dataset GSE82107 from GEO database and senescence dataset from CellAge database of human senescence-associated genes based on genetic manipulations experiments plus gene expression profilin, and screened out 4 overlapping genes. The hub genes were verified in vitro and in human OA cartilage tissues by qRT-PCR. We further confirmed the function of mitogen-activated protein kinase 12 (MAPK12) and Fos proto-oncogene (FOS) in OA in vitro and in vivo by qRT-PCR, western blotting, Edu staining, immunofluorescence, SA-β-gal staining, HE, IHC, von frey test, and hot plate. Results: 1458 downregulated and 218 upregulated DEGs were determined from GSE82107, and 279 human senescence-associated genes were downloaded from CellAge database. After intersection assay, we screened out 4 overlapping genes, of which FOS, CYR61 and TNFSF15 were upregulated, MAPK12 was downregulated. The expression of MAPK12 was obviously downregulated, whereas the expression profiles of FOS, CYR61 and TNFSF15 were remarkedly upregulated in H2O2- or IL-1β-stimulated C28/I2 cells, human OA cartilage tissues, and knee cartilage of aging mice. Furthermore, both MAPK12 over-expression and FOS knock-down can promote cell proliferation and cartilage anabolism, inhibit cell senescence and cartilage catabolism, relieve joint pain in H2O2- or IL-1β-stimulated C28/I2 cells and mouse primary chondrocytes, destabilization of the medial meniscus (DMM) mice. Conclusion: This study explored that MAPK12 and FOS are involved in the occurrence and development of OA through modulating chondrocyte senescence. They might be biomarkers of OA chondrocyte senescence, and provides some evidence as subsequent possible therapeutic targets for OA. The translational potential of this article: The translation potential of this article is that we revealed MAPK12 and FOS can effectively alleviate OA by regulating chondrocyte senescence, and thus provided potential therapeutic targets for prevention or treatment of OA in the future.

Abstract CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P

Abstract Global population aging poses a tremendous burden on the health care system worldwide. Frailty is associated with decreased physical reserve and is considered an important indicator of adverse events in the older population. Therefore, there is growing interest in the early diagnosis and intervention of frailty, but the cellular mechanisms responsible for frailty are still not completely understood. Chronic inflammation is related to decreased physical function and increased disease risk. Additionally, multiple human and animal studies suggest that inflammation probably plays the largest role in contributing to frailty. Some inflammatory markers have been proposed to predict physical frailty. However, there are still large gaps in knowledge related to the clinical application of these markers in frail patients. Therefore, understanding the biological processes and identifying recognized and reliable markers are urgent and pivotal tasks for geriatricians. In the present review, we broadly summarize the inflammatory markers that may have potential diagnostic and therapeutic use, thereby translating them into health care for older people with frailty in the near future.

Joint Waveform inversion (JWI) uses the results of reflection waveform inversion (RWI) as the initial model for full waveform inversion (FWI). Compared with the FWI, the JWI method can obtain more information about the structure of the subsurface medium. The reason is that the reflected waveform inversion can invert the long wavelength component in the middle and deep areas. In JWI, reflected waveform inversion is used to obtain the reflected wave information in the simulation record by demigration, which is computationally more expensive than FWI; the least squares reverse time migration (LSRTM) also obtains the reflected wave information in the simulated record by demigration. In order to effectively use the reflected wave information brought by the high computational amount of reverse migration in JWI, this paper proposes a simultaneous inversion method of JWI and LSRTM (JWI-LSRTM). This method can simultaneously perform an iterative update of the subsurface medium velocity of JWI and the migration imaging of LSRTM, which improves the calculation data utilization rate of each forward and inversion process. In the model test, the effectiveness of the method is proved.

Abstract How does the quantum-to-classical transition of measurement occur? This question is vital for both foundations and applications of quantum mechanics. Here, we develop a new measurement-based framework for characterizing the classical and quantum free electron–photon interactions and then experimentally test it. We first analyze the transition from projective to weak measurement in generic light–matter interactions and show that any classical electron-laser-beam interaction can be represented as an outcome of weak measurement. In particular, the appearance of classical point-particle acceleration is an example of an amplified weak value resulting from weak measurement. A universal factor, $$\exp \left(-{\Gamma }^{2}/2\right)$$ exp − Γ 2 / 2 , quantifies the measurement regimes and their transition from quantum to classical, where $$\Gamma$$ Γ corresponds to the ratio between the electron wavepacket size and the optical wavelength. This measurement-based formulation is experimentally verified in both limits of photon-induced near-field electron microscopy and the classical acceleration regime using a DLA. Our results shed new light on the transition from quantum to classical electrodynamics, enabling us to employ the essence of the wave-particle duality of both light and electrons in quantum measurement for exploring and applying many quantum and classical light–matter interactions.

Abstract Osteoarthritis (OA) is a full-joint, multifactorial, degenerative and inflammatory disease that seriously affects the quality of life of patients due to its disabling and pain-causing properties. ER stress has been reported to be closely related to the progression of OA. The inositol-requiring enzyme 1α/X-box-binding protein-1 spliced (IRE1α/XBP1s) pathway, which is highly expressed in the chondrocytes of OA patients, promotes the degradation and refolding of abnormal proteins during ER stress and maintains the stability of the ER environment of chondrocytes, but its function and the underlying mechanisms of how it contributes to the progression of OA remain unclear. This study investigates the role of IRE1α/ERN1 in OA. Specific deficiency of ERN1 in chondrocytes spontaneously resulted in OA-like cartilage destruction and accelerated OA progression in a surgically induced arthritis model. Local delivery of AdERN1 relieved degradation of the cartilage matrix and prevented OA development in an ACLT-mediated model. Mechanistically, progranulin (PGRN), an intracellular chaperone, binds to IRE1α, promoting its phosphorylation and splicing of XBP1u to generate XBP1s. XBP1s protects articular cartilage through TNF-α/ERK1/2 signaling and further maintains collagen homeostasis by regulating type II collagen expression. The chondroprotective effect of IRE1α/ERN1 is dependent on PGRN and XBP1s splicing. ERN1 deficiency accelerated cartilage degeneration in OA by reducing PGRN expression and XBP1s splicing, subsequently decreasing collagen II expression and triggering collagen structural abnormalities and an imbalance in collagen homeostasis. This study provides new insights into OA pathogenesis and the UPR and suggests that IRE1α/ERN1 may serve as a potential target for the treatment of joint degenerative diseases, including OA.

Abstract Background Diffuse large B-cell lymphoma (DLBCL) is an aggressive malignancy. Neutrophil extracellular traps (NETs) are pathogen-trapping structures in the tumor microenvironment that affect DLBCL progression. However, the predictive function of NET-related genes (NRGs) in DLBCL has received little attention. This study aimed to investigate the interaction between NRGs and the prognosis of DLBCL as well as their possible association with the immunological microenvironment. Methods The gene expression and clinical data of patients with DLBCL were downloaded from the Gene Expression Omnibus database. We identified 148 NRGs through the manual collection of literature. GSE10846 (n = 400, GPL570) was used as the training dataset and divided into training and testing sets in a 7:3 ratio. Univariate Cox regression analysis was used to identify overall survival (OS)-related NETs, and the least absolute shrinkage and selection operator was used to evaluate the predictive efficacy of the NRGs. Kaplan–Meier plots were used to visualize survival functions. Receiver operating characteristic (ROC) curves were used to assess the prognostic predictive ability of NRG-based features. A nomogram containing the clinical information and prognostic scores of the patients was constructed using multivariate logistic regression and Cox proportional risk regression models. Results We identified 36 NRGs that significantly affected patient overall survival (OS). Eight NRGs (PARVB, LYZ, PPARGC1A, HIF1A, SPP1, CDH1, S100A9, and CXCL2) were found to have excellent predictive potential for patient survival. For the 1-, 3-, and 5-year survival rates, the obtained areas under the receiver operating characteristic curve values were 0.8, 0.82, and 0.79, respectively. In the training set, patients in the high NRG risk group presented a poorer prognosis (p

Progranulin (PGRN) is a multifunctional growth factor involved in many physiological processes and disease states. The apparent protective role of PGRN and the importance of chondrocyte autophagic function in the progression of osteoarthritis (OA) led us to investigate the role of PGRN in the regulation of chondrocyte autophagy. PGRN knockout chondrocytes exhibited a deficient autophagic response with limited induction following rapamycin, serum starvation, and IL-1β-induced autophagy. PGRN-mediated anabolism and suppression of IL-1β-induced catabolism were largely abrogated in the presence of the BafA1 autophagy inhibitor. Mechanistically, during the process of OA, PGRN and the ATG5–ATG12 conjugate form a protein complex; PGRN regulates autophagy in chondrocytes and OA through, at least partially, the interactions between PGRN and the ATG5–ATG12 conjugate. Furthermore, the ATG5–ATG12 conjugate is critical for cell proliferation and apoptosis. Knockdown or knockout of ATG5 reduces the expression of ATG5–ATG12 conjugate and inhibits the chondroprotective effect of PGRN on anabolism and catabolism. Overexpression of PGRN partially reversed this effect. In brief, the PGRN-mediated regulation of chondrocyte autophagy plays a key role in the chondroprotective role of PGRN in OA. Such studies provide new insights into the pathogenesis of OA and PGRN-associated autophagy in chondrocyte homeostasis.

IntroductionIndividuals with 17-beta-hydroxysteroid dehydrogenase type 3 (17β-HSD3) deficiency face a multitude of challenges, primarily concerning genital appearance, potential malignancy risks, and fertility issues. This study reports our findings from an investigation involving five individuals affected by 17β-HSD3 deficiency, ranging in age from pre-adolescence to adolescence. Notably, we identified four previously unreported mutations in these subjects.MethodsOur study included a comprehensive evaluation to determine the potential occurrence of testicular tumors. The methods involved clinical examinations, genetic testing, hormone profiling, and patient history assessments. We closely monitored the progress of the study subjects throughout their treatment.ResultsThe results of this evaluation conclusively ruled out the presence of testicular tumors among our study subjects. Moreover, four of these individuals successfully underwent gender transition. Furthermore, we observed significant improvements in genital appearance following testosterone treatment, particularly among patients in the younger age groups who received appropriate treatment interventions.DiscussionThese findings underscore the critical importance of early intervention in addressing concerns related to genital appearance, based on our extensive clinical experience and assessments. In summary, our study provides insights into the clinical aspects of 17β-HSD3 deficiency, emphasizing the vital significance of early intervention in addressing genital appearance concerns. This recommendation is supported by our comprehensive clinical assessments and experience.

Objective To explore the recruitment strategy of blood donors under the situation of blood supply shortage during the COVID-19 epidemic. Methods The theory of planned behavior and the stage change model of behavior were used to analyze the recruitment strategy of blood donors during the COVID-19 epidemic. The recruitment practice strategies of some countries or regions, i. e. the United States, Japan, South Korea, and the European Union, during this period were investigated. Based on the theoretical analysis results and practical status, relevant reference strategies were proposed. Results The theoretical analysis showed that attitude, subjective norms and ethical norms played an important role in the recruitment of blood donors during the COVID-19 epidemic, but blood donation self-efficacy and promoting blood donation behavior were the two key factors. According to the survey, in terms of enhancing and maintaining attitudes, subjective norms, ethical norms and other elements that were jointly affected by the same strategy, most countries continued previous policies while some updated recruitment ideas. In terms of enhancing and maintaining the key elements of blood donation self-efficacy, more human and material support had been made. Conclusion During the COVID-19 pandemic, enhancing and maintaining blood donation self-efficacy and promoting blood donation behavior are the key elements to effectively improve the blood supply shortage. The blood donor recruitment strategy constructed accordingly has reference value for China.

Objective: To evaluate the effectiveness and safety of seven oral Chinese patent medicines (CPMs) as adjuvant therapy for cancer-related anemia (CRA) by network meta-analysis (NMA). Methods: A literature search to obtain randomized controlled trials (RCTs) of seven oral CPMs in the adjuvant treatment of CRA was conducted in multiple databases from the inception to April 2022. The RevMan5.3 and R 4.1.1 software were used for NMA. Results: We ultimately included 29 RCTs with 2140 patients. Traditional meta-analysis showed that Fufang E'jiao syrup (FFEJS), Shengxuebao mixture (SXBM), Shengxuening tablets (SXNT), Jianpi Shengxue granules (JPSXG), and Yixuesheng capsule (YXSC) combined with basic Western treatment (BWT) could improve the hemoglobin (HGB) level. JPSXG combined with BWT could improve the red blood cell (RBC). FFEJS combined with BWT improved the Karnofsky performance status (KPS). NMA showed that FFEJS, JPSXG, SXBM, and SXNT plus BWT improved HGB better than Shengxue tablets (SXT) plus BWT, with top three ranking results being JPSXG plus BWT > SXNT plus BWT > FFEJS plus BWT. FFEJS plus BWT, JPSXG plus BWT, SXBM plus BWT, SXNT plus BWT, and SXT plus BWT improved RBC better than BWT, with top three ranking results being SXNT plus BWT > JPSXG plus BWT > FFEJS plus BWT. In terms of the KPS score, compared with SXT plus BWT, FFEJS, JPSXG, SXBM, SXNT, and Yizhong Shengxue capsule (YZSXC) plus BWT had higher KPS, with top three ranking results being SXBM plus BWT > JPSXG plus BWT > FFEJS plus BWT. Conclusions: Our NMA demonstrated that seven oral CPMs used as adjuvant treatment of CRA had a definite clinical effect. JPSXG not only increases the levels of HGB and RBC to enhance the clinical effect but also improves patients' quality of life. More accurate conclusions need to be verified by more high-quality RCTs.

Abstract Background Aging is an inevitable process associated with impairments in multiple organ systems, which increases the risk of comorbidity and disability, and reduces the health-span. Metabolomics is a powerful tool in aging research, which can reflect the characteristics of aging at the level of terminal metabolism, and may contribute to the exploration of aging mechanisms and the formulation of anti-aging strategies. Methods To identify possible biomarkers and pathways associated with aging using untargeted metabolomics methods, we performed liquid chromatography–mass spectrometry (LC–MS)-based untargeted metabolomics profiling on serum samples from 32 older adults and 32 sex-matched young controls. Results Metabolite profiling could distinguish the two groups. Among the 349 metabolites identified, 80—including lysophospholipids whose levels gradually decline—are possible candidate aging biomarkers. Valine, leucine and isoleucine degradation and biosynthesis were important pathways in aging, with reduced levels of l-isoleucine (r = − 0.30, p = 0.017) and l-leucine (r = − 0.32, p = 0.010) observed in older adults. Conclusions We preliminarily revealed the metabolite changes associated with aging in Chinese adults. Decreases in mitochondrial membrane-related lysophospholipids and dysfunction of branched-chain amino acid metabolism were determined to be the characteristics and promising research targets for aging.

Abstract Background Diabetes is an independent risk factor of frailty, which increases adverse outcomes in patients with diabetes. Metformin is a common antidiabetic drug in clinical practice. Insulin resistance and chronic inflammation are the two common mechanisms of diabetes and frailty, as well as the main targets of metformin. Research suggested that metformin has anti-aging potential. However, few studies focus on the relationship between metformin and frailty. Thus, we aimed to explore whether metformin was associated with a low risk of frailty and other adverse outcomes in diabetic patients. Methods A total of 422 patients (≥ 40 years old) with type 2 diabetes were recruited. Frailty was defined by the Fried phenotype. General information and metformin exposure data were collected, and comprehensive geriatric assessment and laboratory tests were performed. Follow-up was conducted after 4.5 years. The primary outcome was the combined endpoint of cardiovascular events, cerebrovascular events, readmission, and death. Binary logistic regression analysis was used to analyze the association of metformin with frailty. Survival analysis was performed using Cox proportional hazards models. Results The total prevalence of frailty was 19.4% among the participants with diabetes. 13.1% of patients in the metformin group and 28.2% in the non-metformin group had frailty. Metformin was inversely associated with frailty after adjusting for age, sex, duration, blood glucose levels, target organ damage, comorbidities, and polypharmacy. Further longitudinal analysis showed that metformin was also independently associated with a low risk of combined primary outcomes after adjusting for multiple covariables, while frailty was related to an increased risk of the combined primary outcomes. In the non-frail group, metformin was associated with a decreased risk of combined primary outcomes after adjustment for age and sex. However, the protective effect of metformin on adverse outcomes was not found in frail participants with diabetes. Conclusions Metformin use is associated with a reduced risk of frailty. In addition, frailty may attenuate the protective effects of metformin on adverse outcomes in diabetic patients. The early identification and prevention of frailty progression may help enhance the benefits of metformin in patients with diabetes.

Abstract Plasma dynamics are governed by electron density (n e), electron temperature (T e), and radiative energy transfer as well as by macroscopic flows. However, plasma flow-velocity fields (v flow) inside laser-produced plasmas (LPPs) have rarely been measured, owing to their small sizes ( 3 × 1024 m−3) and for a relatively long time (> 10 ns), resulting increment of total EUV light emission. These results indicate that controlling the plasma flow can improve EUV light output and that there is potential to increase the EUV output further.

Sheath rot disease (SRD) is one of the most devastating diseases of Manchurian wild rice (MWR) (Zizania latifolia Griseb). Pilot experiments in our laboratory have shown that an MWR cultivar “Zhejiao NO.7”exhibits signs of SRD tolerance. To explore the responses of Zhejiao No. 7 to SRD infection, we used a combined transcriptome and metabolome analysis approach. A total of 136 differentially accumulated metabolites (DAMs, 114 up- and 22 down-accumulated in FA compared to CK) were detected. These up-accumulated metabolites were enriched in tryptophan metabolism, amino acid biosynthesis, flavonoids, and phytohormone signaling. Transcriptome sequencing results showed the differential expression of 11,280 genes (DEGs, 5,933 up-, and 5,347 downregulated in FA compared to CK). The genes expressed in tryptophan metabolism, amino acid biosynthesis, phytohormone biosynthesis and signaling, and reactive oxygen species homeostasis confirmed the metabolite results. In addition, genes related to the cell wall, carbohydrate metabolism, and plant-pathogen interaction (especially hypersensitive response) showed changes in expression in response to SRD infection. These results provide a basis for understanding the response mechanisms in MWR to FA attack that can be used for breeding SRD-tolerant MWR.

The understanding of the topological properties of light is at the base of the future optical devices development. In this work the authors aim to suggesting a different paradigm for topological transport and manipulation of nonparaxial light, paving the way toward the new developments in the field of topological photonics

Particle acceleration driven by intense lasers has long been a frontier of research in the field of laser engineering physics due to its extremely high acceleration gradient. Recently, dielectric laser accelerators (DLAs) have become a new research hotspot due to their ability to achieve gigavolt-per-meter acceleration gradients on compact chip-level all-optical structures. In comparison to the currently widely used solid-state laser with a 1-μm wavelength, long-wave infrared (LWIR) lasers with a length of about 10 μm offer several unique advantages, including the ability to obtain a large electric charge of particle beams and lower energy divergence. These advantages have been validated in plasma-based laser accelerators as well as DLAs. Although the system is still in its early stages of development, the use of LWIR lasers for driving DLAs has special significance, including but not limited to easier processing of optical chips and larger acceleration channels. This review will provide a detailed introduction to this field from 2 aspects: DLAs and ultrashort and ultraintense LWIR lasers based on CO2 laser amplifiers.

IntroductionAlthough the importance of teacher feedback has been confirmed by a great number of studies, the association of head teacher praise and criticism with adolescents’ non-cognitive skills still needs more deeper and more extensive research. Therefore, how to improve the non-cognitive skills of adolescents, especially those with disadvantaged family and economic backgrounds, has become a key concern in the field of educational practice.MethodsBased on CEPS data, this paper used panel regression and PSM-DID methods to analyze the impact of head teacher feedback on an adolescent’s non-cognitive skills measured by the big-five personality scale.ResultsIt found that praise from head teachers favorably influenced adolescents’ extraversion, agreeableness, openness, and conscientiousness, yet significantly mitigates their neuroticism. Meanwhile, the effect of criticism from head teachers is bi-facial: It made a positive effect on adolescents’ extraversion and openness but impaired their conscientiousness and neuroticism. As rural adolescents notably lag in their non-cognitive skills and are much less likely to be praised by head teachers compared to their urban peers, we estimate that when rural adolescents are frequently praised by their head teachers at the same level as urban students, their gap in extraversion, agreeableness, neuroticism, openness, and conscientiousness would be narrowed by 12.51%, 16.58%, 11.35%, 14.25%, and 24.29%. This finding has significant implications for head teacher teaching and adolescent well-being.ConclusionsThe study examined the effects of head teacher praise and criticism on adolescent non-cognitive skills. The results showed that adolescents who were often praised by head teachers developed better non-cognitive skills. While the effect of head teacher criticism was two-sided: it enhances extraversion and openness as well as heightens neuroticism and corrupts conscientiousness. We further analyzed the urban-rural gap in non-cognitive skills and found that rural adolescents significantly lagged, and they have a lower possibility to be often praised by the head teacher, but a higher probability to be criticized. Through the PSM-DID quasi-experimental design, it was suggested that more head teacher praise can improve the non-cognitive skills among adolescents. When rural adolescents are estimated to receive the same amount of praise as urban adolescents, the disparities reduction in their non-cognitive skills can become possible. Our findings are of great significance to promote adolescent non-cognitive skills development and improve educational equity in urban and rural areas.

Abstract We elucidate a bias-free light-induced orbital and spin current through nonlinear response theory, which generalizes the well-known bulk photovoltaic effect in centrosymmetric broken materials from charge to the spin and orbital degrees of freedom. We use two-dimensional nonmagnetic ferroelectric materials (such as GeS and its analogs) to illustrate this bulk orbital/spin photovoltaic effect, through first-principles calculations. These materials possess a vertical mirror symmetry and time-reversal symmetry but lack of inversion symmetry. We reveal that in addition to the conventional photocurrent that propagates parallel to the mirror plane (under linearly polarized light), the symmetric forbidden photocurrent perpendicular to the mirror actually contains electrons flow, which carries angular momentum information and move oppositely. This generates a pure orbital moment current with zero electric charge current. Such hidden photo-induced pure orbital current could lead to a pure spin current via spin–orbit coupling interactions. Therefore, a four-terminal device can be designed to detect and measure photo-induced charge, orbital, and spin currents simultaneously. All these currents couple with electric polarization P, hence their amplitude and direction can be manipulated through ferroelectric phase transition. Our work provides a route to generalizing nanoscale devices from their photo-induced electronics to orbitronics and spintronics.

Introduction: Intrinsic vitamin D affects the proliferation, apoptosis, invasion, metastasis, and tumorigenesis of lung cancer by regulating tumor signaling pathways. Histidine-rich calcium-binding protein (HRC) maintains Ca2+ homeostasis, which plays crucial roles in the occurrence and development of cancer. Objectives: Our study aims to investigate the ability of vitamin D in the regulation of HRC and the role of HRC playing in lung cancer. Methods: We investigated the effects of vitamin D on lung cancer and the underlying mechanisms, by measuring HRC and vitamin D receptor (VDR) expression in lung cancer, paracancer, and normal tissues from patients using immunohistochemistry, western blotting, and real time RT-PCR. We transfected H460 lung cancer cells (supplemented or not with vitamin D) with PX458-HRC and pcDNA3.1-HRC plasmids and injected mice with lung cancer cells harboring pcDNA3.1-vector or pcDNA3.1-HRC plasmids. Results: Vitamin D inhibited HRC expression and H460 cell migration and proliferation, and promoted apoptosis compared with controls. The expression of HRC and VDR was significantly upregulated and downregulated, respectively, in lung cancer versus paracancer or normal tissues. Cell proliferation and migration were reduced, apoptotic cells were more and tumors were smaller in mice treated with vitamin D/cholecalciferol cholesterol emulsion (CCE) than in vitamin D/CCE+HRC+/+ mice. Conclusion: Vitamin D inhibited lung cancer tumor growth, migration, and proliferation by downregulating HRC.

Cholangiocarcinoma (CCA) is an aggressive malignancy originating from the epithelium of the bile duct. The prognosis of patients is poor regardless of radical resection and chemoradiotherapy. The current classification and prognostic model of CCA are unable to satisfy the requirements for predicting the clinical outcome and exploring therapeutic targets. Estrogen signaling is involved in diverse cancer types, and it has long been established that CCA could be regulated by estrogen. In our study, estrogen response was identified to be significantly and stably correlated with poor prognosis in CCA. Employing several algorithms, CCA was classified into ES cluster A and B. ES cluster B was mainly composed of patients with fluke infection and overlapped with CCA cluster 1/2, and ES cluster A was mainly composed of patients without fluke infection and overlapped with CCA cluster 3/4. COMT and HSD17B1 were identified to be responsible for the differential estrogen response between ES clusters A and B, and the estrogen response may be correlated with the differentiation and cancer stemness of CCA at the single-cell level. Complement activation and the expression of C3 and C5, which are mainly expressed by CCA cells, were significantly downregulated in ES cluster B. An estrogen response risk score (ESRS) model was constructed to predict the prognosis of CCA, followed by a nomogram integrating ESRS and clinical features. Finally, altered pathways, applicable drugs and sensitivity to chemical drugs were analyzed specific to the estrogen response. In summary, our results provide insights into the role of the estrogen response in CCA progression as well as applicable drugs and potential therapeutic targets in estrogen metabolism, the complement system and ESRS-related pathways.

Background/ObjectivesOwing to accelerated population aging, health in older adults is becoming increasingly important. Frailty can reflect the health status and disease risks of older adults; however, appropriate biomarkers for early screening of frailty have not been identified. Here, we applied metabolomics to identify frailty biomarkers and potential pathogenic mechanisms of frailty.MethodsSerum metabolic profiles from 25 frail and 49 non-frail (control) older adults were systematically investigated by liquid chromatography-mass spectrometry-based metabolomics.ResultsWe identified 349 metabolites of 46 classes, with four increased and seven decreased metabolites in frail older adults. Pearson correlation analysis identified 11 and 21 metabolites that were positively and negatively correlated with grip strength, and 7 and 76 metabolites that were positively and negatively correlated with gait speed, respectively. Pathway analysis identified 10 metabolite sets and 13 pathways significantly associated with one or more frailty phenotype criteria.ConclusionThese results revealed the metabolite characteristics of serum in frail older adults. Intermediates of carbohydrate metabolism (e.g., isocitrate, malate, fumarate, cis-aconitate, glucuronate, and pyruvate), saturated fatty acids (e.g., palmitic acid), unsaturated fatty acids (e.g., arachidonate and linoleic acid), and certain essential amino acids (e.g., tryptophan) may be candidate biomarkers for the early diagnosis of frailty. Mitochondrial function disorders, saturated fatty acid-mediated lipotoxicity, aberrant unsaturated fatty acid metabolism, and increased tryptophan degradation could be potential mechanisms of frailty.

Background: Physical function gradually decreases with age in older adults, affecting their independence and quality of life and leaving them prone to adverse outcomes. Despite the importance of assessing function for older adults, most studies have focused on disability and paid less attention to functional impairment. Thus, given the lack of valid and practical methods for evaluating functional impairment for older adults, we developed the function impairment screening tool (FIST) using the Delphi method.Objective: This study aimed to evaluate the reliability and validity of the FIST in Chinese older adults.Methods: A total of 489 participants aged 60 years or older, and who had completed the FIST were included. A subgroup of 50 participants completed the FIST a second time, 1 week after the first round, and the test–retest reliability was evaluated using the intraclass correlation coefficient (ICC). Reliability was tested using Cronbach's alpha. Validity was examined using exploratory factor analysis. Criterion-related validity was assessed using correlations between the FIST and the Barthel Index activities of daily living (ADL), Lawton, and Brody instrumental activities of daily living (LB-IADL).Results: The Cronbach's alpha coefficient for the FIST was 0.930 (P < 0.001). The test–retest reliability was good, with an ICC of 0.928 (95% confidence interval [0.874, 0.960]). Exploratory factor analyses revealed one factor accounting for 60.14% of the scale's variance and the load values of every item were >0.4 (0.489–0.872). The correlation coefficient was 0.572 (P < 0.001) between the FIST score and ADL, and was 0.793 (P < 0.001) between the FIST score and IADL. The FIST score was positively correlated with walking speed (r = 0.475, P < 0.001) and grip strength (r = 0.307, P < 0.001), and negatively correlated with age (r = −0.588, P < 0.001) and Fried frailty phenotype (r = −0.594, P < 0.001).Conclusion: The FIST is a reliable and valid instrument for assessing physical function impairment in older adults.

We demonstrate superconducting nanowire single photon detector (SNSPD) for the wavelength at around 2 μm. The linewidth of the NbN nanowire is squeezed to 56 nm to increase the intrinsic response efficiencies at longer wavelengths such as 2 μm. Serially connecting avalanche architecture is applied to increase the signal-to-noise ratio (SNR) of the response signal. Further, the optical cavity is optimized to improve the absorption of the device. A silica single-mode fiber is adopted to introduce photons to the SNSPD at a temperature of 2.25 K using a Gifford-McMahon cryocooler. The SNSPD exhibits detection efficiencies of 58%, 67%, and 63% at wavelengths of 1550, 1700, and 2000 nm, respectively, with dark count rate of ~12 kcps, which is reduced to 2 cps when the attached fiber pigtail is all placed inside the 40-K cryostat. The detection efficiency at 2000 nm is 2.5 times greater than that of the best previously developed detector with an efficiency of 25%. Our SNSPD is promising for practical applications in molecular science and earth meteorology.

Energy substrate imbalance is a major cause of cardiac dysfunction. Vitamin D/vitamin D receptor (VD/VDR) deficiency is involved in the pathogenesis of various cardiac diseases; however, the exact underlying mechanism remains unclear. The aim of this study was to investigate whether vitamin D modulates mitochondrial fatty acid oxidase via sirtuin 3 signaling to protect the myocardium. 1-Alpha-hydroxylase-defficient mice exhibited a high metabolic rate and lower myocardial contractility than wild-type mice. Sirtuin 3 upregulation was detected in high-fat diet-fed mice receiving vitamin D3 compared with that in high-fat diet-fed mice. Both sirtuin 3 blockade and knockout inhibited the VD/VDR-induced downregulation of fatty acid oxidase in myocardial mitochondria. VD/VDR suppressed fatty acid metabolism by upregulating sirtuin 3 and lowering mitochondrial fat uptake, thereby improving myocardial function and balancing energy substrates, rather than by altering fat endocytosis and exocytosis.

Abstract Low-cost porous ceramic microspheres from waste gangue were prepared by simple spray drying and subsequent calcination. Effects of calcination temperature on phase and microstructure evolution, specific surface area, pore structure, and dye adsorption mechanism of the microspheres were investigated systematically. Results showed that the microspheres were spherical, with some mesopores both on the surface and inside the spheres. The phase kept kaolinite after calcined at 800 and 900°C and transformed into mullite at 1000°C. The microspheres calcined at 800°C showed larger adsorption capacity and removal efficiency than those calcined at higher temperatures. Methylene blue (MB) and basic fuchsin (BF) removal efficiency reached 100% and 99.9% with the microsphere dosage of 20 g/L, respectively, which was comparable to that of other low-cost waste adsorbents used to remove dyes in the literature. Adsorption kinetics data followed the pseudo-second-order kinetic model, and the isotherm data fit the Langmuir isotherm model. The adsorption process was attributed to multiple adsorption mechanisms including physical adsorption, hydrogen bonding, and electrostatic interactions between dyes and gangue microspheres. The low-cost porous microspheres with excellent cyclic regeneration properties are promising absorbent for dyes in wastewater filtration and adsorption treatment.

Zingiber mioga (Thunb.) Rosc. is an important plant species in tropical Asia widely used for decoration, and in traditional food and medicine. In this study, we reported for the first time the complete chloroplast genome sequence of Z. mioga. The assembled chloroplast genome was 159,868 bp long with a typical quadripartite structure consisting of two reverse repeated regions of 26,652 bp in length, separated by a large single-copy (89,431 bp) and a small single-copy (17,133 bp) region. We annotated 113 genes including 78 protein-coding, 31 tRNA and 4 rRNA genes. Phylogenetic analysis with 27 other species showed that Z. mioga clustered with Z. officinale and Z. spectabile, all belonging to the Zingiberaceae family of the Zingiberales order. The results of this study will facilitate the breeding process and conservation of the species.

In this article, we present a unified reciprocal quantum electrodynamics (QED) formulation of free-electron and quantum–light interaction. For electron–light interactions, we bridge the underlying theories of photon-induced near-field electron microscopy, laser-induced particle accelerators, and radiation sources, such as quantum free electron laser, transition radiation and Smith-Purcell effect. We demonstrate an electron–photon spectral reciprocity relation between the electron energy loss/gain and the radiation spectra. This ‘acceleration/radiation correspondence’ (ARC) conserves the electron energy, and photon number exchanged, that is, Δ E / ℏω + Δ ν _q = 0, and in the representation of a quantum electron wavepacket, displays explicit dependence on the history-dependent phase and shape of the wavepacket configuration. It originates from an interaction-induced quantum interference term that is usually ignored in Fermi’s golden rule analyses, but is kept in our combined quantum free electron–photon state formulation. We apply this formulation to both stimulated interaction and spontaneous emission of classical and quantum light by the quantum-featured electrons. The ‘spontaneous’ emissions of coherent states (‘classical’ light) are remarked and squeezed states of quantum light is shown to be enhanced with squeezing. This reciprocal QED formulation has promise for extensions to other fundamental research issues in quantum light and quantum matter interactions.

Controllable electric transport of topological particles in solid state systems hold the key towards novel electronic applications. Here, Wang et al. demonstrate gate-tunable negative longitudinal magnetoresistance in WTe2, featuring controllable transport of Type-II Weyl fermions.

In this work, we report a ubiquitous presence of topological Floquet time crystal (TFTC) in one-dimensional periodically driven systems. The rigidity and realization of spontaneous discrete time-translation symmetry (DTS) breaking in our TFTC model require necessarily coexistence of anomalous topological invariants (0 modes and π modes), instead of the presence of disorders or many-body localization. We found that in a particular frequency range of the underlying drive, the anomalous Floquet phase coexistence between 0 and π modes can produce the period doubling (2T, two cycles of the drive) that breaks the DTS spontaneously, leading to the subharmonic response (ω/2, half the drive frequency). The rigid period-2T oscillation is topologically protected against perturbations due to both nontrivially opening of 0 and π gaps in the quasienergy spectrum, thus, as a result, can be viewed as a specific “Rabi oscillation” between two Floquet eigenstates with certain quasienergy splitting π/T. Our modeling of the time-crystalline “ground state” can be easily realized in experimental platforms such as topological photonics and ultracold fields. Also, our work can bring significant interest to explore topological phase transition in Floquet systems and to bridge the gap between Floquet topological insulators and photonics, and period-doubled time crystals.

Pancreatic cancer is well known to be the most deadly malignancy with the worst survival rate of all cancers. High temperature requirement factor A1 (HtrA1) plays an important role in cancer cell proliferation, migration, apoptosis, and differentiation. This study aimed to explore the function of HtrA1 in pancreatic cancer cell growth and its underlying mechanism. We found that the expression of HtrA1 was lower in pancreatic cancer tissue compared to the adjacent normal tissue. Consistently, HtrA1 levels were also decreased in two human pancreatic cancer cell lines, PANC-1 and BXPC-3. Moreover, enforced expression of HtrA1 inhibited cell viability and colony formation of PANC-1 and BXPC-3 cells. Overexpression of HtrA1 promoted apoptosis and suppressed migratory ability of tumor cells. On the contrary, siRNA-mediated knockdown of HtrA1 promoted the growth potential of pancreatic cancer cells. In addition, we found that up-regulation of HtrA1 reduced the expression of Notch-1 in pancreatic cancer cells. On the contrary, knockdown of HtrA1 increased the expression levels of Notch-1. Furthermore, overexpression of Notch-1 abolished the anti-proliferative effect of HtrA1 on pancreatic cancer cells. Taken together, our findings demonstrated that HtrA1 could inhibit pancreatic cancer cell growth via regulating Notch-1 expression, which implied that HtrA1 might be developed as a novel molecular target for pancreatic cancer therapy.

As an extension of the cable broadband network，WLAN is also an important part of the wireless broadband network.In recent years，local governments have put forward the construction of “wireless city”as the fifth city public infrastructure，China Telecom Co.Ltd.also put forward the WLAN construction as the forth basic network.These factors promoted the large-scale construction and development of WLAN.The construction goal and the network architecture of WLAN based on metropolitan area network were analyzed.The networking technologies and the security policy deployment of WLAN were proposed.

Background: Cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC) are among the most prevalent gynecologic malignancies globally. The prognosis is abysmal once cervical cancer progresses to lymphatic metastasis. Anoikis, a specialized form of apoptosis induced by loss of cell adhesion to the extracellular matrix, plays a critical role. The prediction model based on anoikis-related genes (ARGs) expression and clinical data could greatly aid clinical decision-making. However, the relationship between ARGs and CESC remains unclear. Methods: ARGs curated from the GeneCards and Harmonizome portals were instrumental in delineating CESC subtypes and in developing a prognostic framework for patients afflicted with this condition. We further delved into the intricacies of the immune microenvironment and pathway enrichment across the identified subtypes. Finally, our efforts culminated in the creation of an innovative nomogram that integrates ARGs. The utility of this prognostic tool was underscored by Decision Curve Analysis (DCA), which illuminate its prospective benefits in guiding clinical interventions. Results: In our study, We discerned a set of 17 survival-pertinent, anoikis-related differentially expressed genes (DEGs) in CESC, from which nine were meticulously selected for the construction of prognostic models. The derived prognostic risk score was subsequently validated as an autonomous prognostic determinant. Through comprehensive functional analyses, we observed distinct immune profiles and drug response patterns among divergent prognostic stratifications. Further, we integrated the risk scores with the clinicopathological characteristics of CESC to develop a robust nomogram. DCA corroborated the utility of our model, demonstrating its potential to enhance patient outcomes through tailored clinical treatment strategies. Conclusion: The predictive signature, encompassing nine pivotal genes, alongside the meticulously constructed nomogram developed in this research, furnishes clinicians with a sophisticated tool for tailoring treatment strategies to individual patients diagnosed with CESC. [ABSTRACT FROM AUTHOR]

Soil amendments can trigger bottom-up effects in crop-herbivorous pest interactions, thus impacting pest management and biochars may enhance plant growth and resistance to plant pests. We studied bottom-up effects of regenerative biochar bamboo charcoal on tomato (Solanum lycopersicum) and a major pest Bemisia tabaci, both under laboratory and field conditions. Plant height, stem diameter, and leaf dry-to-fresh weight ratio, as well as the content of free amino acids, starch, and soluble sugars, increased in the bamboo charcoal treatment compared with the control. Moreover, some plant-resistant substances or enzyme activities (e.g., flavonoids, phenylalanine ammonia lyase, and superoxide dismutase) were different among treatments. Applying bamboo charcoal reduced the survival rate and oviposition of B. tabaci. Y-tube olfactometer bioassay and volatilome analysis showed that the bamboo charcoal treatment reduced the attractiveness of tomato plants to B. tabaci by inducing the increasing release of the repellent volatile organic compound methyl salicylate. Field experiment showed that applying bamboo charcoal (5 L/m²) in the soil promoted the growth of tomato plants and suppressed the B. tabaci population. In conclusion, we demonstrate that applying bamboo charcoal could enhance the tomato plant growth and development and lower pest population by increasing the synthesis and accumulation of plant resistance substances. Therefore, it has the potential for large-scale field application to improve crop yield and significantly reduce B. tabaci occurrence. [ABSTRACT FROM AUTHOR]