Search

Traditional Chinese medicine, specifically the Jianpi Tiaoqi (JPTQ) decoction, has been explored for its role in treating breast cancer, particularly in inhibiting lung metastasis in affected mice. Our study evaluated the effects of JPTQ on several factors, including tumour growth, apoptosis, angiogenesis, epithelial‐to‐mesenchymal transition (EMT) and immune microenvironment regulation. We used bioluminescence imaging to observe in situ tumour growth and potential lung metastasis. Transcriptomic analysis provided insights into gene expression, whereas flow cytometry was used to examine changes in specific immune cells, such as CD4+ T cells and myeloid‐derived suppressor cells. Several essential proteins and genes, including vascular endothelial growth factor (VEGF), matrix metalloprotein‐9 (MMP‐9) and B‐cell lymphoma 2 (Bcl‐2), were assessed through quantitative real‐time polymerase chain reaction, western blotting and immunohistochemistry. Our findings showed that JPTQ treatment inhibited tumour proliferation in cancer‐bearing mice. Bioluminescence imaging and pathological analysis indicated a reduction in lung metastasis. Transcriptome analysis of lung and tumour tissues indicated that the genes associated with EMT, angiogenesis, proliferation and apoptosis were regulated in the JPTQ‐treated group. Kyoto Encyclopedia of Genes and Genomes analysis suggested enrichment of immune‐related pathways. Flow cytometry indicated that JPTQ treatment reduced the proportion of monocyte–myeloid‐derived suppressor cells in the lung and increased the number of CD4+ T cells in the peripheral blood and the number of T helper 1 (Th1) cells in the spleen (P < 0.05). E‐cadherin and cleaved caspase 3 were upregulated, whereas Snail, Bcl‐2, Ki67 and VEGF were downregulated in the lung and tumour tissues; moreover, the expression of MMP‐9 was downregulated in the lung tissue (P < 0.05). In essence, JPTQ not only inhibits tumour growth in affected mice, but also promotes positive immune responses, reduces angiogenesis, boosts tumour cell apoptosis, reverses EMT and decreases breast cancer lung metastasis. [ABSTRACT FROM AUTHOR]

Background: Glaucoma patients frequently present with depressive symptoms, the development of which is closely associated with amygdalar activity. However, no studies to date have documented glaucoma-related changes in the functional connectivity (FC) of the amygdala. Accordingly, resting-state functional magnetic resonance imaging (rs-fMRI) analyses were herein used to evaluate changes in amygdalar FC in primary angle-closure glaucoma (PACG) patients. Methods: In total, this study enrolled 36 PACG patients and 33 healthy controls (HCs). Complete eye exams were conducted for all PACG patients. After the preprocessing of magnetic resonance imaging (MRI) data, the bilateral amygdala was selected as a seed point, followed by the comparison of resting-state FC between the PACG and HC groups. Then, those brain regions exhibiting significant differences between these groups were identified, and relationships between the FC coefficient values for these regions and clinical variables of interest were assessed. Results: These analyses revealed that as compared to HC individuals, PACG patients exhibited reductions in FC between the amygdala and the cerebellum_8, vermis_4_5, anterior central gyrus, supplementary motor area, paracentral lobule, putamen, middle frontal gyrus, and posterior cingulate gyrus, while enhanced FC was detected between the right and left amygdala. No significant correlations between these changes in amygdalar any any disease-related clinical parameters or disease duration were noted. Conclusions: Patients with PACG exhibit extensive resting state abnormalities with respect to the FC between the amygdala and other regions of the brain, suggesting that dysregulated amygdalar FC may play a role in the pathophysiology of PACG. [ABSTRACT FROM AUTHOR]

Subduction processes play a pivotal role in facilitating material exchange between the crust and mantle, contributing to the growth of continents. However, the onset and evolution of subduction remain hotly debated. Here, we developed a high‐dimensional machine learning (ML) model to use multiple compositional data (e.g., Nb/La, Nb, Ti, Nb/U, Pb/Nd, and Nb/Th) to distinguish arc‐type from non‐arc basalts worldwide, then applied this well‐trained ML model to identify and delineate the secular occurrence of Archean arc‐type basalts. Our findings indicate that basaltic arc magmatism can be traced back to only a few early Archean cratons. A noticeable increase in the prevalence of arc‐type basalts during the Mesoarchean and Neoarchean suggests the synchronous formation of Archean subduction across different cratons. This observation hints at transitioning from the predominantly stagnant geodynamic regime to the early, more mobile tectonic regime. Plain Language Summary: Deep beneath the Earth's surface, subduction moves material from the crust to the mantle, generating magma and igneous activity. This process is crucial for building the continental crust. Despite its importance, how the subduction process evolved over billions of years remains debated. To better understand when and where subduction began, we trained a machine learning model to distinguish between arc (subduction‐related) and non‐arc (not subduction‐related) basalts to recognize the chemical "fingerprints" of subduction in these rocks. By applying the same model to ancient basalts, we could trace basaltic arc‐like magmatism back to several Archean eon cratons, known as cratons, early in Earth's history (during the Archean Eon). The number of arc‐type basalts increased during the Mesoarchean and late Archean, suggesting that subduction expanded to different regions for about 700 million years. The transition suggests a significant shift in how the Earth's crust moved and changed, from a primarily steady state to a more mobile tectonics as observed today. Our study sheds new light on the ancient history of our planet and helps us understand how the Earth's crust has evolved over billions of years. Key Points: Machine learning can accurately distinguish between arc and non‐arc basalts worldwideSubduction‐related basaltic magmatism may have produced on several cratons during the early ArcheanSubduction‐related processes may have started in cratons worldwide during the late Archean [ABSTRACT FROM AUTHOR]

Aims: Cerebrovascular lesions in the primary visual cortex, the lateral geniculate nucleus, and the optic tract have been associated with retinal neurodegeneration via the retrograde degeneration (RD) mechanism. We aimed to use optical coherence tomography (OCT) to assess the effects of the strategic single subcortical infarction (SSI) location on retinal neurodegeneration and its longitudinal impacts. Methods: Patients with SSI were enrolled and stratified by lesion location on cerebral MRI into the thalamic infarction group and extra‐thalamic infarction group. Healthy controls from the native communities were also recruited. Retinal nerve fiber layer (RNFL) and ganglion cell‐inner plexiform layer (GCIPL) were quantified using OCT. Generalized estimating equation (GEE) models were used for cross‐sectional analyses and linear mixed models for longitudinal analyses. P < 0.05 was considered statistically significant. Results: We included a total of 283 eyes from 149 SSI patients. Of these, 115 eyes of 60 patients with follow‐up were included in the longitudinal analyses. Cross‐sectionally, thalamic‐infarction patients had reduced retinal thickness compared with extra‐thalamic infarction patients after adjustment for age, gender, disease duration, and vascular risk factors (p = 0.026 for RNFL, and p = 0.026 for GCIPL). Longitudinally, SSI patients showed greater retinal thinning compared with healthy controls over time (p = 0.040 for RNFL, and p < 0.001 for GCIPL), and thalamic infarction patients exhibited faster rates of GCIPL thinning in comparison with extra‐thalamic infarction patients (p < 0.001). Conclusion: Our study demonstrates a distinct effect of subcortical infarction lesion site on the retina both at the early stage of disease and at the 1‐year follow‐up time. These results present evidence of significant associations between strategic infarction locations and retinal neurodegeneration. It may provide novel insights for further research on RD in stroke patients and ultimately facilitate individualized recovery therapeutic strategy. [ABSTRACT FROM AUTHOR]

Researchers have found that violent online game addiction has become a serious global problem that negatively affects younger people. This study used a cross‐sectional research design to examine the effects of violent online game contact on individuals' academic procrastination. We further explored the mediating role of emotional self‐regulation and the moderating role of peer communication in the link between violent online game contact and academic procrastination. A sample of 1132 students completed self‐reported questionnaires regarding violent online game contact, emotional self‐regulation, peer communication, and academic procrastination. Participants were randomly selected from Guangdong Province, China. Results indicated that violent online game contact was positively correlated with academic procrastination, while emotional self‐regulation indirectly affected the relationship. Peer communication played a moderating role in the indirect effect between emotional self‐regulation and academic procrastination. The general pattern of this mechanism illustrates that as peer communication increased, the effects of emotional self‐regulation on academic procrastination decreased. The findings elucidate how and for whom violent online game exposure is related to academic procrastination. This research demonstrates that violent game contact is an important factor affecting academic procrastination, clarifies the role of peer communication and emotional self‐regulation, and provides practical suggestions for preventing academic procrastination in the field of school psychology. Practitioner points: Online violence game exposure (OVGE) is positively related to academic procrastination.Emotional self‐regulation mediates the relation between OVGE and academic procrastination.Peer communication moderates the second stage of the mediation process. [ABSTRACT FROM AUTHOR]

Background: In cellular activities, essential proteins play a vital role and are instrumental in comprehending fundamental biological necessities and identifying pathogenic genes. Current deep learning approaches for predicting essential proteins underutilize the potential of gene expression data and are inadequate for the exploration of dynamic networks with limited evaluation across diverse species. Results: We introduce ECDEP, an essential protein identification model based on evolutionary community discovery. ECDEP integrates temporal gene expression data with a protein–protein interaction (PPI) network and employs the 3-Sigma rule to eliminate outliers at each time point, constructing a dynamic network. Next, we utilize edge birth and death information to establish an interaction streaming source to feed into the evolutionary community discovery algorithm and then identify overlapping communities during the evolution of the dynamic network. SVM recursive feature elimination (RFE) is applied to extract the most informative communities, which are combined with subcellular localization data for classification predictions. We assess the performance of ECDEP by comparing it against ten centrality methods, four shallow machine learning methods with RFE, and two deep learning methods that incorporate multiple biological data sources on Saccharomyces. Cerevisiae (S. cerevisiae), Homo sapiens (H. sapiens), Mus musculus, and Caenorhabditis elegans. ECDEP achieves an AP value of 0.86 on the H. sapiens dataset and the contribution ratio of community features in classification reaches 0.54 on the S. cerevisiae (Krogan) dataset. Conclusions: Our proposed method adeptly integrates network dynamics and yields outstanding results across various datasets. Furthermore, the incorporation of evolutionary community discovery algorithms amplifies the capacity of gene expression data in classification. [ABSTRACT FROM AUTHOR]

Background Methods Results Conclusions Immunohistochemistry (IHC) is an essential technique in surgical and clinical pathology for detecting diagnostic, prognostic, and predictive biomarkers for personalized cancer therapy. However, the lack of standardization and reference controls results in poor reproducibility, and a reliable tool for IHC quantification is urgently required. The objective of this study was to describe a novel approach in which H3F3B (histone H3, family 3B) can be used as an internal reference standard to quantify protein expression levels using IHC.The authors enrolled 89 patients who had human epidermal growth factor receptor 2 (HER2)‐positive breast cancer (BC). They used a novel IHC‐based assay to measure protein expression using H3F3B as the internal reference standard. H3F3B was uniformly expressed at the protein level in all tumor regions in cancer tissues. HER2 expression levels were measured with the H‐score using HALO software.Kaplan–Meier analysis indicated that, among patients who had HER2‐positive BC in The Cancer Genome Atlas data set and the authors' data set, the subgroup with low HER2 expression had a significantly better prognosis than the subgroup with high HER2 expression. Furthermore, the authors observed that HER2 expression levels were precisely evaluated using the proposed method, which can classify patients who are at higher risk of HER2‐positive BC to receive trastuzumab‐based adjuvant therapy. Dual‐color IHC with H3F3B is an excellent tool for internal and external quality control of HER2 expression assays.The proposed IHC‐based quantification method accurately assesses HER2 expression levels and provides insights for predicting clinical prognosis in patients with HER2‐positive BC who receive trastuzumab‐based adjuvant therapy. [ABSTRACT FROM AUTHOR]

Background and objective: Neuro‐ophthalmologic symptoms and retinal changes have been increasingly observed following thalamic stroke, and there is mounting evidence indicating distinct alterations occurring in the vision‐related functional network. However, the intrinsic correlations between these changes are not yet fully understood. Our objective was to explore the altered patterns of functional network connectivity and retina parameters, and their correlations with visual performance in patients with thalamic stroke. Methods: We utilized resting‐state functional MRI to obtain multi‐modular functional connectivity (FC), and optical coherence tomography‐angiography to measure various retina parameters, such as the retinal nerve fiber layer (RNFL), ganglion cell‐inner plexiform layer (GCIPL), superficial vascular complex (SVC), and deep vascular complex. Visual acuity (VA) was used as a metric for visual performance. Results: We included 46 patients with first‐ever unilateral thalamic stroke (mean age 59.74 ± 10.02 years, 33 males). Significant associations were found between FC of attention‐to‐default mode and SVC, RNFL, and GCIPL, as well as between FC of attention‐to‐visual and RNFL (p <.05). Both RNFL and GCIPL exhibited significant associations with FC of visual‐to‐visual (p <.05). Only GCIPL showed an association with VA (p =.038). Stratified analysis based on a disease duration of 6 months revealed distinct and significant linking patterns in multi‐modular FC and specific retina parameters, with varying correlations with VA in each subgroup. Conclusion: These findings provide valuable insight into the neural basis of the associations between brain network dysfunction and impaired visual performance in patients with thalamic stroke. Our novel findings have the potential to inform future targeted and individualized therapies. However, further comprehensive studies are necessary to validate our results. [ABSTRACT FROM AUTHOR]

This paper proposed a double-sided staggered conical teeth traveling wave rotating ultrasonic motor based on in-plane bending mode, which reduces the difficulty of rotor preload application and improves the output characteristics of in-plane bending mode traveling wave rotating ultrasonic motor. The motor has four sets of drive teeth alternately distributed on both the inner and outer sides of the vibrator, with the drive teeth gap dedicated to accommodate the piezoelectric ceramic piece, and the staggered drive teeth on both sides of the vibrator are used to drive the rotor rotation. The motor operates in two in-plane third-order bending modes with the same frequency and orthogonal to each other, and is excited by four sets of piezoelectric ceramic disks spaced 90 degrees apart from the inner and outer sides. After the prototype was completed, its vibration characteristics and output performance were experimentally tested, and the actual effects of the three excitation schemes were compared. The experimental results show that the motor can provide a maximum output torque of 1.82N-mm and a maximum no-load speed of 96.4 rpm when the excitation voltage is 300 V and the excitation frequency is 20.60 kHz. [ABSTRACT FROM AUTHOR]

Background: Chronic obstructive pulmonary disease (COPD) typically causes airflow blockage and breathing difficulties, which may result in the abnormal morphology and motion of the lungs or diaphragm. Purpose: This study aims to quantitatively evaluate respiratory diaphragm motion using a thoracic sagittal magnetic resonance imaging (MRI) series, including motion asynchronization and limitations. Method: First, the diaphragm profile is extracted using a deep-learning-based field segmentation approach. Next, by measuring the motion waveforms of each position in the extracted diaphragm profile, obvious differences in the independent respiration cycles, such as the period and peak amplitude, are verified. Finally, focusing on multiple breathing cycles, the similarity and amplitude of the motion waveforms are evaluated using the normalized correlation coefficient (NCC) and absolute amplitude. Results and Contributions: Compared with normal subjects, patients with severe COPD tend to have lower NCC and absolute amplitude values, suggesting motion asynchronization and limitation of their diaphragms. Our proposed diaphragmatic motion evaluation method may assist in the diagnosis and therapeutic planning of COPD. [ABSTRACT FROM AUTHOR]

In Petri net unfolding, according to the strategies of breadth first and depth first, the biggest problem lies in the potential explosion of the state space. Unfolding generates either accessible trees or branch processes. Making marking reduction or branch cutting accessible proves to be an effective approach to mitigating the state space expansion. In this paper, we propose three reduction rules based on similarity equivalence, conduct state space reduction, present three theorems supported by a case study, and propose a new unfolding algorithm for the unfolding process. In both the new case and the experiments, the completeness, optimality, completeness, and memory and time consumption are reduced by about 60%. [ABSTRACT FROM AUTHOR]

Comprehensive Summary: Enantioselective or enantioconvergent iron‐catalyzed ring‐closing C(sp3)‐H aminations of N‐aroyloxyurea through intermediate iron nitrene species provide chiral 2‐imidazolidinones in up to 99% yield and with up to 95% ee (40 examples). This is a rare example in which sustainable iron catalysis is combined with C(sp3)‐H amination and asymmetric catalysis. Chiral 2‐imidazolidinones are prevalent structural motifs in bioactive molecules and can also be hydrolyzed to valuable chiral vicinal diamines in a single step. [ABSTRACT FROM AUTHOR]

Soil microorganisms play a crucial role in ecosystem processes and functions, but how their co‐occurrence networks respond to restoration of degraded ecosystems remains poorly understood.Here, we examined the effects of revegetation on the structure and function of the soil microbiome, including soil microbial network complexity and stability, in a novel riparian ecosystem with winter submergence opposite to the natural hydrological regime.We found that extreme flooding intensity (30 m submergence up to 286 days per year) reduced microbial α‐diversity and network stability (robustness) but increased network complexity including network connectivity, connectance and average clustering coefficient over a 3‐year period, and those effects were mitigated by active revegetation in comparison with natural regeneration. Revegetation increased microbial network stability directly by decreasing network complexity, while extreme flooding regulated network stability indirectly by changing the soil total carbon content. Nevertheless, those dynamics of microbial network were coupling with soil microbial functions such as greenhouse gas (e.g. CH4, CO2 and N2O) fluxes and nutrient cycling.Synthesis and applications: This study provides evidence to support the critical role of revegetation in preserving soil microbial network stability and functions under changing hydrological regime. [ABSTRACT FROM AUTHOR]

N‐Boc‐protected α‐amino acids are synthesized in two steps from linear or branched carboxylic acid feedstocks. In the first step, the carboxylic acid is coupled with tert‐butyl aminocarbonate (BocNHOH) to generate azanyl ester (acyloxycarbamate) RCO2NHBoc. In the second step, this azanyl ester undergoes a stereocontrolled iron‐catalyzed 1,3‐nitrogen migration to generate the N‐Boc‐protected non‐racemic α‐amino acid. This straightforward protocol is applicable to the catalytic asymmetric synthesis of α‐monosubstituted α‐amino acids with aryl, alkenyl, and alkyl side chains. Furthermore, α,α‐disubstituted α‐amino acids are accessible in an enantioconvergent fashion from racemic carboxylic acids. The new method is also advantageous for the synthesis of α‐deuterated α‐amino acids. N‐Boc‐protected α‐amino acids synthesized using this two‐step protocol are ready‐to‐use building blocks. [ABSTRACT FROM AUTHOR]

In order to simplify the motor structure, to reduce the difficulty of rotor pre-pressure application and to obtain better output performance, a new internal cone type rotating traveling wave ultrasonic motor is proposed. The parametric model of the internal cone type ultrasonic motor was established by the ANSYS finite element software. The ultrasonic motor consists of an internal cone type vibrator and a tapered rotor. The dynamic analysis of the motor vibrator is carried out, and two in-plane third-order bending modes with the same frequency and orthogonality are selected as the working modes. The other advantages of this motor are that pre-pressure can be imposed by the weight of the rotor. The prototype was trial-manufactured and experimentally tested for its vibration characteristics and output performance. When the excitation frequency is 22260.0 Hz, the pre-pressure is 0.1 N and the peak-to-peak excitation voltage is 300 V, the maximum output torque of the prototype is 1.06 N·mm, and the maximum no-load speed can reach 441.2 rpm. The optimal pre-pressure force under different loads is studied, and the influence of the pre-pressure force on the mechanical properties of the ultrasonic motor is analyzed. It is instructive in the practical application of this ultrasonic motor. [ABSTRACT FROM AUTHOR]

Cytomegalovirus (CMV) and BK polyomavirus (BKPyV) infections after kidney transplant have become increasingly prevalent. Based on previous studies, the mammalian target of rapamycin (mTOR) inhibitors seem like attractive alternatives with antiviral activity. The objective of this systematic review and meta‐analysis was to investigate the incidence of CMV and BKPyV infections in kidney transplantation recipients receiving mTOR inhibitors. This meta‐analysis included three comparisons of immunosuppressant regimens commonly used after kidney transplantation: Comparison 1: mTOR inhibitors versus calcineurin inhibitors (CNI); Comparison 2: mTOR inhibitors versus antimetabolites (AM); and Comparison 3: mTOR inhibitors plus a reduced‐dose of CNI versus AM plus a standard‐dose of CNI. The group containing mTOR inhibitors was the study group and the remaining one was the control group. The incidence of CMV or BKPyV infection defined by positive culture, serology, or polymerase chain reaction testing was the primary outcome. A total of 61 studies involving 13,609 patients were included. As compared with the control group, a significantly decreased risk of CMV and BKPyV infections favoring the mTOR inhibitors‐based group was shown in comparisons 1, 2, and 3 (p < 0.05). Compared with the control group in all three comparisons, mTOR inhibitors made no difference in regard to death and graft loss (p > 0.05). Compared with CNI, the incidence of biopsy‐proven acute rejection (BPAR) and anemia was higher with mTOR inhibitors (p < 0.05). In comparisons 2 and 3, the risk of new‐onset diabetes mellitus (NODM) was higher with mTOR inhibitors (p < 0.05). Early introduction of mTOR inhibitors reduced more CMV infections in comparisons 1 and 2 (p < 0.05). The mTOR inhibitor‐based regimen is an attractive alternative with lower risk of CMV and BKPyV infections in kidney transplant recipients. The combination regimen is more appropriate and acceptable than the mTOR‐inhibitor monotherapy‐based regimen. Early introduction of mTOR inhibitors is recommended, although it is worth noting that attention should be paid to wound healing when mTOR inhibitors are introduced early. [ABSTRACT FROM AUTHOR]

In the era of Big Data, integrating information from multiple sources has proven valuable in various fields. To ensure a high-quality supply of multi-source data, repairing different types of errors in the multi-source data becomes critical. This paper categorizes errors in multi-source data into entity information overlapping, attribute value conflicts, and attribute value inconsistencies. We first summarize existing repairing methods for these errors and then examine and review the study of the detection and repair of compound-type errors in multi-source data. Finally, we indicate further research directions in multi-source data repair. [ABSTRACT FROM AUTHOR]

Background: Bone is the most common site of metastasis of prostate cancer (PCa). PCa invasion leads to a disruption of osteogenic-osteolytic balance and causes abnormal bone formation. The interaction between PCa and bone stromal cells, especially osteoblasts (OB), is considered essential for the disease progression. However, drugs that effectively block the cancer-bone interaction and regulate the osteogenic-osteolytic balance remain undiscovered. Methods: A reporter gene system was constructed to screen compounds that could inhibit PCa-induced OB activation from 631 compounds. Then, the pharmacological effects of a candidate drug, Procoxacin (Pro), on OBs, osteoclasts (OCs) and cancer-bone interaction were studied in cellular models. Intratibial inoculation, micro-CT and histological analysis were used to explore the effect of Pro on osteogenic and osteolytic metastatic lesions. Bioinformatic analysis and experiments including qPCR, western blotting and ELISA assay were used to identify the effector molecules of Pro in the cancer-bone microenvironment. Virtual screening, molecular docking, surface plasmon resonance assay and RNA knockdown were utilized to identify the drug target of Pro. Experiments including co-IP, western blotting and immunofluorescence were performed to reveal the role of Pro binding to its target. Intracardiac inoculation metastasis model and survival analysis were used to investigate the therapeutic effect of Pro on metastatic cancer. Results: Luciferase reporter gene consisted of Runx2 binding sequence, OSE2, and Alp promotor could sensitively reflect the intensity of PCa-OB interaction. Pro best matched the screening criteria among 631 compounds in drug screening. Further study demonstrated that Pro effectively inhibited the PCa-induced osteoblastic changes without killing OBs or PCa cells and directly killed OCs or suppressed osteoclastic functions at very low concentrations. Mechanism study revealed that Pro broke the feedback loop of TGF-β/C-Raf/MAPK pathway by sandwiching into 14–3-3ζ/C-Raf complex and prevented its disassociation. Pro treatment alleviated both osteogenic and osteolytic lesions in PCa-involved bones and reduced the number of metastases of PCa in vivo. Conclusions: In summary, our study provides a drug screening strategy based on the cancer-host microenvironment and demonstrates that Pro effectively inhibits both osteoblastic and osteoclastic lesions in PCa-involved bones, which makes it a promising therapeutic agent for PCa bone metastasis. [ABSTRACT FROM AUTHOR]

Web tables are essential for applications such as data analysis. However, web tables are often incomplete and short of some critical information, which makes it challenging to understand the web table content. Automatically predicting column types for tables without metadata is significant for dealing with various tables from the Internet. This paper proposes a CNN-Text method to deal with this task, which fuses CNN prediction and voting processes. We present data augmentation and synthetic column generation approaches to improve the CNN's performance and use extracted text to get better predictions. The experimental result shows that CNN-Text outperforms the baseline methods, demonstrating that CNN-Text is well qualified for the table column type prediction. [ABSTRACT FROM AUTHOR]

Oxygen fugacity controls the behaviour of multivalent elements and compositions of C-O-H fluids in Earth's mantle, which further affects the cycling of materials between the deep interior and surface of Earth. The redox state of the mantle lithosphere of typical stable cratons has been well documented, but how oxygen fugacity had varied during craton destruction remains unclear. This study estimates the oxygen fugacity of peridotite xenoliths entrained in Mesozoic and Cenozoic basalts on North China Craton (NCC), a typical destroyed craton. The oxygen fugacity vs. Mg# of olivine reveals that the mantle lithosphere beneath the NCC experienced three stages of evolution in terms of oxygen fugacity. First, the refractory and oxidized peridotite xenoliths indicate that the lithospheric mantle experienced a high degree of melt extraction and later long-term and complicated metasomatism before craton destruction. Then, the variations of olivine Mg-number in peridotites and oxygen fugacity reveal significant metasomatism by melts originated from the shallow asthenosphere during the destruction of the NCC since the Mesozoic. The third stage may have occurred when mantle peridotites interacted with silica-undersaturated melts or fluids stemmed from the mantle transition zone where the stagnant Pacific slab underlies. This study further verifies that the asthenospheric convection induced by the roll-back of the subducted paleo-Pacific slab played a crucial role in the destruction of the NCC and helps understand the oxygen fugacity variability during the later life of the craton. [ABSTRACT FROM AUTHOR]

The origin of superconductivity and pairing symmetry of order parameter in the LaAlO 3 /SrTiO 3 interface are still elusive problems up to now. Based on the two-band Ginzburg-Landau theory, we study the electromagnetic properties of this oxide heterostructure with the Neumann boundary conditions. We calculate the temperature dependence of upper critical field in arbitrary direction and critical supercurrent density through the interface. We also compute the upper critical field and superfluid stiffness at different gate voltages. Our theoretical results are in good agreement with the experimental data, which strongly suggests the existence of two-gap s-wave superconductivity in this electron system. [ABSTRACT FROM AUTHOR]

The synthesis of non‐racemic 5‐membered cyclic carbonates from abundant alcohols is reported. Conversion of the alcohol into an azanyl carbonate is followed by a chiral‐at‐ruthenium catalyzed cyclization to provide chiral cyclic carbonates in yields of up to 95 % and with up to 99 % ee. This new synthetic method is proposed to proceed through a nitrene‐mediated intramolecular C(sp3)−H oxygenation which includes an unusual 1,7‐hydrogen atom transfer within a ruthenium nitrene intermediate. The method is applicable to the synthesis of non‐racemic chiral mono‐, di‐ and trisubstituted cyclic alkylene carbonates. [ABSTRACT FROM AUTHOR]

The synthesis of non‐racemic 5‐membered cyclic carbonates from abundant alcohols is reported. Conversion of the alcohol into an azanyl carbonate is followed by a chiral‐at‐ruthenium catalyzed cyclization to provide chiral cyclic carbonates in yields of up to 95 % and with up to 99 % ee. This new synthetic method is proposed to proceed through a nitrene‐mediated intramolecular C(sp3)−H oxygenation which includes an unusual 1,7‐hydrogen atom transfer within a ruthenium nitrene intermediate. The method is applicable to the synthesis of non‐racemic chiral mono‐, di‐ and trisubstituted cyclic alkylene carbonates. [ABSTRACT FROM AUTHOR]

Background: Microcirculation is a vital sign that supplies oxygen and nutrients to maintain normal life activities. Sepsis typically influences the operation of microcirculation, which is recovered by the administration of medicine injection. Objective: Sepsis-induced variation and recovery of microcirculation are quantitatively detected using microcirculation images acquired by a non-contact imaging setup, which might assist the clinical diagnosis and therapy of sepsis. Methods: In this study, a non-contact imaging setup was first used to record images of microcirculation on the back of model rats. Specifically, the model rats were divided into three groups: (i) the sham group as a control group; (ii) the cecum ligation and puncture (CLP) group with sepsis; and (iii) the CLP+thrombomodulin (TM) group with sepsis and the application of TM alfa therapy. Furthermore, considering the sparsity of red blood cells (RBCs), the blood velocity is estimated by robust principal component analysis (RPCA) and U-net, and the blood vessel diameter is estimated by the contrast difference between the blood vessel and tissue. Results and Effectiveness: In the experiments, the continuous degradation of the estimated blood velocity and blood vessel diameter in the CLP group and the recovery after degradation of those in the CLP+TM group were quantitatively observed. The variation tendencies of the estimated blood velocity and blood vessel diameter in each group suggested the effects of sepsis and its corresponding therapy. [ABSTRACT FROM AUTHOR]

Background: Adipose-derived stem cells (ADSCs) have provided promising applications for Crohn's disease (CD). However, the practical efficacy of ADSCs remains controversial, and their mechanism is still unclear. Based on the pathogenesis of dysregulated immune responses and abnormal lymphatic alterations in CD, vascular endothelial growth factor-C (VEGF-C) is thought to be a favourable growth factor to optimize ADSCs. We aimed to investigate the efficacy of VEGF-C-stimulated ADSCs and their dual mechanisms in both inhibiting inflammation "IN" and promoting inflammation "OUT" in the intestine. Methods: Human stem cells isolated from adipose tissues were identified, pretreated with or without 100 ng/ml VEGF-C and analysed for the secretion of cell culture supernatants in vitro. Lymphatic endothelial cells (LECs) were treated with ADSCs-conditioned medium or co-cultured with ADSCs and VEGF-C stimulated ADSCs. Changes in LECs transmigration, and VEGF-C/VEGFR-3 mRNA levels were assessed by transwell chamber assay and qRT–PCR. ADSCs and VEGF-C-stimulated ADSCs were intraperitoneally injected into mice with TNBS-induced chronic colitis. ADSCs homing and lymphatic vessel density (LVD) were evaluated by immunofluorescence staining. Lymphatic drainage was assessed using Evans blue. Cytokines and growth factors expression was detected respectively by ELISA and qRT–PCR. The protein levels of VEGF-C/VEGFR-3-mediated downstream signals and the NF-κB pathway were assayed by western blot. Faecal microbiota was measured by 16S rRNA sequencing. Results: ADSCs stimulated with VEGF-C released higher levels of growth factors (VEGF-C, TGF-β1, and FGF-2) and lower expression of cytokines (IFN-γ and IL-6) in cell supernatants than ADSCs in vitro (all P < 0.05). Secretome released by VEGF-C stimulated ADSCs exhibited a stronger LEC migratory capability and led to elevated VEGF-C/VEGFR-3 expression, but these effects were markedly attenuated by VEGFR-3 inhibitor. VEGF-C-stimulated ADSCs homing to the inflamed colon and mesenteric lymph nodes (MLNs) can exert stronger efficacy in improving colitis symptoms, reducing inflammatory cell infiltration, and significantly enhancing lymphatic drainage. The mRNA levels and protein concentrations of anti-inflammatory cytokines and growth factors were markedly increased with decreased proinflammatory cytokines in the mice treated with VEGF-C-stimulated ADSCs. Systemic administration of VEGF-C-stimulated ADSCs upregulated the colonic VEGF-C/VEGFR-3 pathway and activated downstream AKT and ERK phosphorylation signalling, accompanied by decreased NF-κB p65 expression. A higher abundance of faecal p-Bacteroidetes and lower p-Firmicutes were detected in mice treated with VEGF-C-stimulated ADSCs (all P < 0.05). Conclusion: VEGF-C-stimulated ADSCs improve chronic intestinal inflammation by promoting lymphatic drainage and enhancing paracrine signalling via activation of VEGF-C/VEGFR-3-mediated signalling and inhibition of the NF-κB pathway. Our study may provide a new insight into optimizing ADSCs treatment and investigating potential mechanisms in CD. [ABSTRACT FROM AUTHOR]

In this study, we focus on the relevance of remaining life prediction of randomly degraded equipment in the context of big data monitoring and the core issue of quantifying uncertainty in remaining life prediction. We analyze the limitations and common problems of current research. To address the limitations and common problems, a solution for predicting the remaining life of randomly degraded devices with multisource sensing monitoring in the context of big data is proposed, and the feasibility and effectiveness of the idea are verified using battery data. Finally, multiple machine learning methods, such as support vector machines, random forests, recurrent neural networks, and convolutional neural networks, are combined to predict the remaining life of batteries, and these four machine learning methods perform well in the work of battery remaining life prediction and solve the key scientific problems. [ABSTRACT FROM AUTHOR]

Background: Essential Proteins are demonstrated to exert vital functions on cellular processes and are indispensable for the survival and reproduction of the organism. Traditional centrality methods perform poorly on complex protein–protein interaction (PPI) networks. Machine learning approaches based on high-throughput data lack the exploitation of the temporal and spatial dimensions of biological information. Results: We put forward a deep learning framework to predict essential proteins by integrating features obtained from the PPI network, subcellular localization, and gene expression profiles. In our model, the node2vec method is applied to learn continuous feature representations for proteins in the PPI network, which capture the diversity of connectivity patterns in the network. The concept of depthwise separable convolution is employed on gene expression profiles to extract properties and observe the trends of gene expression over time under different experimental conditions. Subcellular localization information is mapped into a long one-dimensional vector to capture its characteristics. Additionally, we use a sampling method to mitigate the impact of imbalanced learning when training the model. With experiments carried out on the data of Saccharomyces cerevisiae, results show that our model outperforms traditional centrality methods and machine learning methods. Likewise, the comparative experiments have manifested that our process of various biological information is preferable. Conclusions: Our proposed deep learning framework effectively identifies essential proteins by integrating multiple biological data, proving a broader selection of subcellular localization information significantly improves the results of prediction and depthwise separable convolution implemented on gene expression profiles enhances the performance. [ABSTRACT FROM AUTHOR]

Objective: To explore whether deep medullary veins (DMVs) in the unaffected hemisphere were associated with functional outcome in acute cardioembolic stroke patients. Methods: Acute cardioembolic stroke patients at a single center were retrospectively included. DMVs visibility in the unaffected hemisphere was assessed using a well-established four-grade scoring method based on susceptibility-weighted imaging (SWI): grades 0–3 (grade 0 for no visible DMVs; grade 1 for the numbers of conspicuous DMVs < 5; grade 2 for numbers raging from 5 to 10; grade 3 for more than 10). Patients were further divided into mild-to-moderate (grade 0–2) and severe DMVs (grade 3) groups. Functional outcomes were evaluated using the modified Rankin scale (mRS) score at three months. Poor outcome was defined as mRS ≥ 3. Binary logistic regression analysis was used to explore the association between DMVs grade and functional outcome. Results: A total of 170 patients were finally included. Compared with the mild-to-moderate DMVs group (149 patients), the severe DMVs group (21 patients) had higher baseline National Institutes of Health Stroke Scale (NIHSS) scores (p = 0.002), lower levels of admission systolic blood pressure (BP) (p = 0.031), and elevated rates of large infarction (p = 0.003). At three months, the severe DMVs group had higher mRS (p = 0.002). Patients in the poor outcome group (82/170, 48.2%) had older age, higher baseline NIHSS score, lower admission diastolic BP, higher rates of hemorrhagic transformation and large infarction, and an increased proportion of severe DMVs (all p < 0.05). After adjusting for confounders, multivariable regression analysis showed that the severe DMVs grade (adjusted odds ratio [OR] = 5.830, 95% confidence interval [CI] = 1.266–26.856, p = 0.024) was significantly associated with three-month functional outcomes without interaction with other potential risk factors (p for interaction > 0.05). Conclusions: DMVs grade in the unaffected hemisphere was independently associated with three-month functional outcome in acute cardioembolic stroke patients. Patients with severe DMVs were more likely to have a poor functional outcome at three months. [ABSTRACT FROM AUTHOR]

Abnormal movement of the head and neck is a typical symptom of Cervical Dystonia (CD). Accurate scoring on the severity scale is of great significance for treatment planning. The traditional scoring method is to use a protractor or contact sensors to calculate the angle of the movement, but this method is time-consuming, and it will interfere with the movement of the patient. In the recent outbreak of the coronavirus disease, the need for remote diagnosis and treatment of CD has become extremely urgent for clinical practice. To solve these problems, we propose a multi-view vision based CD severity scale scoring method, which detects the keypoint positions of the patient from the frontal and lateral images, and finally scores the severity scale by calculating head and neck motion angles. We compared the Toronto Western Spasmodic Torticollis Rating Scale (TWSTRS) subscale scores calculated by our vision based method with the scores calculated by a neurologist trained in dyskinesia. An analysis of the correlation coefficient was then conducted. Intra-class correlation (ICC)(3,1) was used to measure absolute accuracy. Our multi-view vision based CD severity scale scoring method demonstrated sufficient validity and reliability. This low-cost and contactless method provides a new potential tool for remote diagnosis and treatment of CD. [ABSTRACT FROM AUTHOR]

Recent experiments have observed much higher electron–ion collisional ionization cross sections and rates in dense plasmas than predicted by the current standard atomic collision theory, including the plasma screening effect. We suggest that the use of (distorted) plane waves for incident and scattered electrons is not adequate to describe the dissipation that occurs during the ionization event. Random collisions with free electrons and ions in plasma cause electron matter waves to lose their phase, which results in the partial decoherence of incident and scattered electrons. Such a plasma-induced transient spatial localization of the continuum electron states significantly modifies the wave functions of continuum electrons, resulting in a strong enhancement of the electron–ion collisional ionization of ions in plasma compared to isolated ions. Here, we develop a theoretical formulation to calculate the differential and integral cross sections by incorporating the effects of plasma screening and transient spatial localization. The approach is then used to investigate the electron-impact ionization of ions in solid-density magnesium plasma, yielding results that are consistent with experiments. In dense plasma, the correlation of continuum electron energies is modified, and the integral cross sections and rates increase considerably. For the ionization of Mg 9 + e + 1 s 2 2 s 2 S → 1 s 2 1 S + 2 e , the ionization cross sections increase several-fold, and the rates increase by one order of magnitude. Our findings provide new insight into collisional ionization and three-body recombination and may aid investigations of the transport properties and nonequilibrium evolution of dense plasma. [ABSTRACT FROM AUTHOR]

Background: Berberine (BBR) is an isoquinoline alkaloid found in the Berberis species. It was found to have protected effects in cardiovascular diseases. Here, we investigated the effect the regulatory function of long noncoding RNAs (lncRNAs) during the treatment of stable coronary heart disease (CHD) using BBR. We performed microarray analyses to identify differentially expressed (DE) lncRNAs and mRNAs between whole blood samples from 5 patients with stable CHD taking BBR and 5 no BBR volunteers. DE lncRNAs and mRNAs were validated by quantitative real-time PCR. Results: A total of 1703 DE lncRNAs and 912 DE mRNAs were identified. Kyoto Encyclopedia of Genes and Genomes pathway analysis indicated DE mRNAs might be associated with mammalian target of rapamycin and mitogen-activated protein kinase pathway. These pathways may be involved in the healing process after CHD. To study the relationship between mRNAs encoding transcription factors (DNA damage inducible transcript 3, sal-like protein 4 and estrogen receptor alpha gene) and CHD related de mRNAs, we performed protein and protein interaction analysis on their corresponding proteins. AKT and apoptosis pathway were significant enriched in protein and protein interaction network. BBR may affect downstream apoptosis pathways through DNA damage inducible transcript 3, sal-like protein 4 and estrogen receptor alpha gene. Growth arrest-specific transcript 5 might regulate CHD-related mRNAs through competing endogenous RNA mechanism and may be the downstream target gene regulated by BBR. Verified by the quantitative real-time PCR, we identified 8 DE lncRNAs that may relate to CHD. We performed coding and non-coding co-expression and competing endogenous RNA mechanism analysis of these 8 DE lncRNAs and CHD-related DE mRNA, and predicted their subcellular localization and N6-methyladenosine modification sites. Conclusion: Our research found that BBR may affect mammalian target of rapamycin, mitogen-activated protein kinase, apoptosis pathway and growth arrest-specific transcript 5 in the process of CHD. These pathways may be involved in the healing process after CHD. Our research might provide novel insights for functional research of BBR. [ABSTRACT FROM AUTHOR]

Background: The retina and brain share similar neuronal and microvascular features. We aimed to investigate the retinal thickness and microvasculature in patients with thalamic infarcts compared with control participants. Material and methods: Swept-source optical coherence tomography (SS-OCT) was used to image the macular thickness (retinal nerve fiber layer, RNFL; ganglion cell-inner plexiform layer, GCIP), while OCT angiography was used to image the microvasculature (superficial vascular plexus, SVP; intermediate capillary plexus, ICP; deep capillary plexus, DCP). Inbuilt software was used to measure the macular thickness (µm) and microvascular density (%). Lesion volumes were quantitively assessed based on structural magnetic resonance images. Results: A total of 35 patients with unilateral thalamic infarction and 31 age–sex-matched controls were enrolled. Compared with control participants, thalamic infarction patients showed a significantly thinner thickness of RNFL (p < 0.01) and GCIP (p = 0.02), and a lower density of SVP (p = 0.001) and ICP (p = 0.022). In the group of patients, ipsilateral eyes showed significant reductions in SVP (p = 0.033), RNFL (p = 0.01) and GCIP (p = 0.043). When divided into three groups based on disease duration (<1 month, 1–6 months, and >6 months), no significant differences were found among these groups. After adjusting for confounders, SVP, ICP, DCP, RNFL, and GCIP were significantly correlated with lesion volume in patients. Conclusions: Thalamic infarction patients showed significant macular structure and microvasculature changes. Lesion size was significantly correlated with these alterations. These findings may be useful for further research into the clinical utility of retinal imaging in stroke patients, especially those with damage to the visual pathway. [ABSTRACT FROM AUTHOR]

In this paper, we propose a method that uses low-resolution infrared (IR) array sensors to identify the presence and location of people indoors. In the first step, we introduce a method that uses 32 × 24 pixels IR array sensors and relies on deep learning to detect the presence and location of up to three people with an accuracy reaching 97.84%. The approach detects the presence of a single person with an accuracy equal to 100%. In the second step, we use lower end IR array sensors with even lower resolution (16 × 12 and 8 × 6) to perform the same tasks. We invoke super resolution and denoising techniques to faithfully upscale the low-resolution images into higher resolution ones. We then perform classification tasks and identify the number of people and their locations. Our experiments show that it is possible to detect up to three people and a single person with accuracy equal to 94.90 and 99.85%, respectively, when using frames of size 16 × 12. For frames of size 8 × 6, the accuracy reaches 86.79 and 97.59%, respectively. Compared to a much complex network (i.e., RetinaNet), our method presents an improvement of over 8% in detection. [ABSTRACT FROM AUTHOR]

[Display omitted] • Conversion of loofah sponge into hierarchical porous carbon. • Composite phase change materials for efficient thermal management. • Excellent solar-thermal conversion ability. • Temperature-regulating application for energy-saving building. In the past work, almost all biomass sponge-based hierarchical porous carbons are tried to preserve the original 3D porous structure as much as possible, thus restricting their effectiveness in thermal energy utilization. In current work, loofah sponge-based hierarchical porous carbon covering nanometer to micrometer was fabricated through a crosslinking-carbonization-etching chemically tailored process. The re-constructed hierarchical porous carbons (LHPCs) have totally different characteristics from that depending on original 3D pores. The LHPC-based composite phase change materials (PCMs) exhibited the maximum melting/solidifying latent heat of 155.1/158.7 J g−1 and exceptional thermal reliability. The optimal solar-thermal converting efficiency of the composite PCMs topped 95 %, higher than some expensive carbon-based materials. Compared to previously reported work, the fabricated composite PCMs showed improved thermal energy storage/release capability and solar-heat conversion efficiency. Additionally, the regulation of about 6.3 °C for composite PCMs was achieved in a hut test. This work has further advanced a superior porous carbon-tailored strategy compared to the traditional approach, building upon the original 3D porous structure. [ABSTRACT FROM AUTHOR]

To aggregate useful information among diversified sources, a hotspot research topic called truth discovery has emerged in recent years. Existing truth discovery methods attempt to infer the true attribute values for the entities by identifying and trusting reliable data sources. That is, the values provided by reliable sources are more likely to be the true values. However, all these methods neglect the relations among different entities, which play important roles in truth discovery task. When reliable data sources cannot provide sufficient information of entities, the true attribute values of these entities can still be inferred by propagating trustworthy information from related entities. Motivated by this, in this paper, we introduce the constrained truth discovery problem. We incorporate denial constraints, a universally quantified first-order logic formalism which can express a large number of effective and widely existing relations among entities, into the process of truth discovery. We formulate it as a constrained optimization problem and analyze its hardness. To address the problem, we propose algorithms to partition the entities into disjoint groups, and generate arithmetic constraints for each disjoint group separately. Then, the true attribute values of the entities in each disjoint group are derived by minimizing the objective function under the corresponding arithmetic constraints. Experimental results on both real-world and synthetic datasets demonstrate that the proposed approach achieves good performance even with very few constraints and reliable sources. [ABSTRACT FROM AUTHOR]

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a ATenriched microsatellite sequence at the 3' end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships. [ABSTRACT FROM AUTHOR]

The size of a fracture within a rock mass can be obtained using borehole sampling data or exposed surfaces. This paper aims at building a method to estimate the fracture size, without the presupposed size distribution, based on full three-dimensional geometric parameters (shape, orientation and position). In this study, the rock fracture was considered as an elliptical plane, and each set of fractures had the same aspect ratio. The statistical parameters of fracture size were derived, from sample (sub fracture group) to population (parent fracture group), based on multiple borehole samples. Parent fracture group simulations were realized using MATLAB, and the codes were designed by the authors. Moreover, in-situ time domain electromagnetic methods (TEM) and borehole induced polarization methods (BPM) were used to validate the Monte Carlo simulation. The results revealed that the statistical rules of Monte Carlo simulation of the parent fracture group are similar to those of the in-situ detection. [ABSTRACT FROM AUTHOR]

The genus Eutrichosomella Girault is recorded for the first time from China (Yunnan Province), and Eutrichosomella yunnanensis sp. nov. (♀, ♂) is described and illustrated. A distribution map of this genus is presented. [ABSTRACT FROM AUTHOR]

Extracellular DNA (eDNA) is a major constituent of the extracellular matrix of Pseudomonas aeruginosa biofilms and its release is regulated via pseudomonas quinolone signal (PQS) dependent quorum sensing (QS). By screening a P. aeruginosa transposon library to identify factors required for DNA release, mutants with insertions in the twin-arginine translocation (Tat) pathway were identified as exhibiting reduced eDNA release, and defective biofilm architecture with enhanced susceptibility to tobramycin. P. aeruginosa tat mutants showed substantial reductions in pyocyanin, rhamnolipid and membrane vesicle (MV) production consistent with perturbation of PQS-dependent QS as demonstrated by changes in pqsA expression and 2-alkyl-4-quinolone (AQ) production. Provision of exogenous PQS to the tat mutants did not return pqsA, rhlA or phzA1 expression or pyocyanin production to wild type levels. However, transformation of the tat mutants with the AQ-independent pqs effector pqsE restored phzA1 expression and pyocyanin production. Since mutation or inhibition of Tat prevented PQS-driven auto-induction, we sought to identify the Tat substrate(s) responsible. A pqsA::lux fusion was introduced into each of 34 validated P. aeruginosa Tat substrate deletion mutants. Analysis of each mutant for reduced bioluminescence revealed that the primary signalling defect was associated with the Rieske iron-sulfur subunit of the cytochrome bc1 complex. In common with the parent strain, a Rieske mutant exhibited defective PQS signalling, AQ production, rhlA expression and eDNA release that could be restored by genetic complementation. This defect was also phenocopied by deletion of cytB or cytC1. Thus, either lack of the Rieske sub-unit or mutation of cytochrome bc1 genes results in the perturbation of PQS-dependent autoinduction resulting in eDNA deficient biofilms, reduced antibiotic tolerance and compromised virulence factor production. Author summary: Pseudomonas aeruginosa is a highly adaptable human pathogen responsible for causing chronic biofilm-associated infections. Biofilms are highly refractory to host defences and antibiotics and thus difficult to eradicate. The biofilm extracellular matrix incorporates extracellular DNA (eDNA). This stabilizes biofilm architecture and helps confer tolerance to antibiotics. Since mechanisms that control eDNA release are not well understood, we screened a P. aeruginosa mutant bank for strains with defects in eDNA release and discovered a role for the twin-arginine translocation (Tat) pathway that exports folded proteins across the cytoplasmic membrane. Perturbation of the Tat pathway resulted in defective biofilms susceptible to antibiotic treatment as a consequence of perturbed pseudomonas quinolone (PQS) signalling. This resulted in the failure to produce or release biofilm components including eDNA, phenazines and rhamnolipids as well as microvesicles. Furthermore, we discovered that perturbation of PQS signalling was a consequence of the inability of tat mutants to translocate the Rieske subunit of the cytochrome bc1 complex involved in electron transfer and energy transduction. Given the importance of PQS signalling and the Tat system to virulence and biofilm maturation in P. aeruginosa, our findings underline the potential of the Tat system as a drug target for novel antimicrobial agents. [ABSTRACT FROM AUTHOR]

Identifying the form of the superconducting order parameter in the Co-doped BaFe2As2 thin film is still an unsolved problem. With the Neumann boundary condition, we study the electromagnetic properties of this thin film based on the two-band Ginzburg–Landau theory. We get the analytic expressions for the upper critical field in arbitrary direction and the temperature dependence of critical supercurrent density through the film. Our theoretical results can fit the experimental data of upper critical field and critical supercurrent density well, which thus strongly suggests the Co-doped BaFe2As2 thin film as a two-gap s -wave superconductor. Besides, a trijunction experiment is proposed to probe the s ++ or s ± pairing symmetry in this material. [ABSTRACT FROM AUTHOR]

Objective: The main challenge in contactless heartbeat detection comes from breathing and/or body motion, which typically deteriorate heart rate (HR) measurements, due to incorrect selection of spectral peaks associated with HR. To acquire the reliable peak selection on spectrum within a relatively broad range, this article first proposes a spectral Viterbi algorithm. Second, a nonlinear source separation approach is further proposed to eliminate the noises generated by respiration and movements, suppressing the undesired spectral energy. Proposal: Inspired by the fact that the period of peak-to-peak intervals of heartbeat (RRIs) rarely vary within a short duration, a novel spectral Viterbi algorithm is proposed to estimate HR change, by the path metric (PM) of candidate paths of HR change. Moreover, based on a deep recurrent neural network (RNN), deep clustering (DC) is applied to separate out the targeted heartbeat source from Doppler signal, by dividing its spectrogram. Results: On the premise of wide-range HR measurement, the usage of spectral Viterbi algorithm substantially improved the precision compared with typical methods of HR estimation, both in the statuses of human subjects’ sitting still and typewriting. In addition, the combination of DC obtains the smallest average errors. Significance: The proposed spectral Viterbi algorithm with DC is provided with three main strengths: 1) good adaptability to wide-range HR change; 2) robustness to nonlinearly mixed signal and noises; and 3) requirement of only a single-channel sensor. [ABSTRACT FROM AUTHOR]

Two new species of Paraphytis Compere, P. bannaensis sp. nov. and P. pseudovittatus sp. nov., are described from the Xishuangbanna Rainforest (Southwest China). A key to species from China based on females is provided. [ABSTRACT FROM AUTHOR]

The aim of this study was to elucidate the roles played by circular RNAs (circRNAs) in the mechanism underlying submandibular gland (SMG) dysfunction in hypertension. We employed RNA-seq to analyze the circRNA and mRNA expression profiles of SMGs. Seventy-five differentially expressed (DE) circRNAs and 691 DE mRNAs were determined to be significantly altered in spontaneously hypertensive rats. Altered mRNAs were primarily related to the immune system and immune response. Eight circRNAs were selected for further analysis. Cell adhesion molecules were determined to be the most strongly enriched pathway through analysis of DE mRNAs, the coding noncoding gene co-expression (CNC) network and the competitive endogenous RNA (ceRNA) network. The salivary secretion pathway was observed to be notably enriched through analysis of the ceRNA network. These results suggest that the crosstalk among circRNAs may play a crucial role in the development of SMG dysfunction in hypertension. • Seventy-five circRNAs and 691 mRNAs were significantly altered in SMG of SHRs. • Many mRNA associated with the immune response were significantly downregulated. • CAMs and TRPV6 were regulated by circRNA and related to reduce salivary secretion. [ABSTRACT FROM AUTHOR]

Background: Pancreatic cancer (PC) is a highly aggressive and refractory disease, with disappointing 5-year survival rates. Regarding the wide application of neoadjuvant treatment in patients with PC, how the post-neoadjuvant Carbohydrate antigen 19-9 (CA19-9) response could translate into a survival benefit is not clearly understood. We aimed to evaluate the correlation of the CA19-9 response with overall survival (OS) in patients with PC receiving neoadjuvant therapy. Methods: An extensive electronic search in PubMed, Embase, and the Cochrane Library was performed to identify relevant articles, from which data relevant to independent correlations of the CA19-9 response with overall survival (OS) were extracted for analysis. A random-effects model was used to calculate the pooled hazard ratios (HRs) with their corresponding 95% confidence intervals (CIs). Results: Altogether, 17 eligible studies were identified in the systematic review. Pooled analysis showed that CA19-9 response > 50% (HR, 0.43; 95% CI 0.29–0.56; P < 0.001) and normalization of CA19-9 (HR, 0.52; 95% CI 0.42–0.63; P < 0.001) after neoadjuvant treatment are significantly associated with promising overall survival. The results also showed that optimal CA19-9 response after neoadjuvant treatment was significantly related to a favorable prognosis (HR = 0.49, 95% CI 0.42–0.55, P < 0.001; I2 = 45.1%, P = 0.04). Subgroup analysis revealed there were no prognostic difference between CA19-9 > 50% and normalization of CA19-9 after neoadjuvant treatment (P = 0.338), but the duration of neoadjuvant chemotherapy over 4 months was significantly associated with expanded postoperative survival (P = 0.013). Conclusions: Serum CA19‑9 is valuable in determining the effect of neoadjuvant treatment in patients with PC. Post-neoadjuvant CA19-9 response > 50% or CA19-9 normalization was related to a more promising overall survival, suggesting that optimal CA19-9 response may be a suitable prognostic index to guide treatment decisions. [ABSTRACT FROM AUTHOR]

Purpose: Primary cancer patients may have some symptoms and develop spinal metastases in their disease progression. This study was to report the distribution and predictive value of specific initial presenting symptoms in patients with spine metastatic disease. Methods: The clinical information about patients with primary cancers was retrospectively collected and analyzed at their initial diagnosis from January 2008 to December 2017. The distribution and specific value of initial presenting symptoms were analyzed in predicting spinal metastases. Results: A total of 14,603 cancer patients were finally included, of whom 1665 (11.4%) cases were confirmed with spinal metastases. 41.55% (6067/14,603) patients had initial presenting symptoms, while 92.19% (1535/1665) patients with spinal metastases presented at least one initial presenting symptoms. Among 6269 patients with symptoms, 1535 (24.49%) were diagnosed with spinal metastases. Factors including primary tumor type, local pain, night-aggravating pain, limb numbness, limb weakness, unstable gait, claudication, loss of sphincter control, and weight loss are associated with the distribution of spinal metastases. The pooled sensitivity, specificity, positive predictive value, and negative predictive value were 90.9% (89.4–92.2%), 64.9% (64.0–65.7%), 24.99% (23.91–26.11%), and 98.23% (97.92–98.50%), respectively. Positive likelihood ratio of "night-aggravating pain" was 33.25 (12.65–87.36) and 17.26 (12.25–24.32) in patients < 45 and 45–64 years old, respectively. Conclusions: The distribution of spinal metastases is associated with primary tumor type and initial presenting symptoms. The predictive value of initial presenting symptoms differs in age groups, but resembles in cancer types. The presence of night-aggravating pain had relative high value in predicting metastases in cancer patients under 65 years old. [ABSTRACT FROM AUTHOR]

Background: BRAF V600E mutation represents a group of colorectal carcinoma with poor prognosis. Although treatment strategies have been recommended after clinical investigations, the progression-free survival is short and unsatisfying. Case Presentation: Here, we present the case of a 28-year-old male diagnosed with ascending colon adenocarcinoma with multiple liver metastases. Treatment with FOLFIRI plus cetuximab and vemurafenib achieved partial response, following which the patient received conversion surgery with clear resection margin. After disease recurrence, he received combination treatment of nivolumab and regorafenib. Until August 2020, the patient achieved a partial response with more than 12 months progression-free survival. Circulating tumor DNA (ctDNA) was monitored during the patient's treatment. His ctDNA fractions exhibited significant elevation two months before disease progression. As a comparison, the tumor markers were not elevated until the patient was confirmed PD through CT imaging. Conclusion: This case exemplifies how liquid biopsy and ctDNA sequencing can aid in real-time molecular characterization of tumors. [ABSTRACT FROM AUTHOR]