Search

Graft-versus-host disease (GVHD) significantly contributes to patient morbidity and mortality after allogeneic hematopoietic cell transplantation (allo-HSCT). Sphingosine-1-phosphate (S1P) signaling is involved in the biogenetic processes of different immune cells. In the current study, we demonstrated that recipient sphingosine kinase 1 (Sphk1), but not Sphk2, was required for optimal S1PR1-dependent donor T-cell allogeneic responses by secreting S1P. Using genetic and pharmacologic approaches, we demonstrated that inhibition of Sphk1 or S1PR1 substantially attenuated acute GVHD (aGVHD) while retaining the graft-versus-leukemia (GVL) effect. At the cellular level, the Sphk1/S1P/S1PR1 pathway differentially modulated the alloreactivity of CD4

Obesity is the world's most high-profile public health problem. Kudingcha has been used in traditional medicine because of its antioxidant, anti-inflammatory and weight loss properties. Quercetin and kaempferol are the main components rich in Kudingcha that are effective against obesity. Therefore, we used the method of network pharmacology to study the effects of quercetin and kaempferol to HepG2 cells on obesity. We obtained 20 hub genes through PPI results and the Cytoscape plug-in cytoHubba. The top 10 genes were found eventrully by GO and KEGG enrichment analysis. The results showed that the insulin resistance, PI3K-Akt signaling pathways and adipocytokine signaling pathway might be the central pathways associated with the treatment of obesity by kudingcha. Next, we used Real-Time PCR to detect the expression levels of ISNR, SLc2a4 and APOE genes to study its mechanism. The results showed that compared with the blank group, the expression of ISNR and SLc2a4 increased and the expression of APOE decreased. Our experiments confirmed that Kudingcha contains compounds that can improve insulin resistance and obesity. This can provide a reference for further research and application of Kudingcha in the treatment of obesity.

Stimulator of interferon genes (STING)-mediated innate immune activation plays a key role in tumor- and self-DNA-elicited antitumor immunity and autoimmunity. However, STING can also suppress tumor immunity and autoimmunity. STING signaling in host nonhematopoietic cells was reported to either protect against or promote graft-versus-host disease (GVHD), a major complication of allogeneic hematopoietic cell transplantation (allo-HCT). Host hematopoietic antigen-presenting cells (APCs) play key roles in donor T-cell priming during GVHD initiation. However, how STING regulates host hematopoietic APCs after allo-HCT remains unknown. We utilized murine models of allo-HCT to assess the role of STING in hematopoietic APCs. STING-deficient recipients developed more severe GVHD after major histocompatibility complex-mismatched allo-HCT. Using bone marrow chimeras, we found that STING deficiency in host hematopoietic cells was primarily responsible for exacerbating the disease. Furthermore, STING on host CD11c(+) cells played a dominant role in suppressing allogeneic T-cell responses. Mechanistically, STING deficiency resulted in increased survival, activation, and function of APCs, including macrophages and dendritic cells. Consistently, constitutive activation of STING attenuated the survival, activation, and function of APCs isolated from STING V154M knock-in mice. STING-deficient APCs augmented donor T-cell expansion, chemokine receptor expression, and migration into intestinal tissues, resulting in accelerated/exacerbated GVHD. Using pharmacologic approaches, we demonstrated that systemic administration of a STING agonist (bis-(3′-5′)-cyclic dimeric guanosine monophosphate) to recipient mice before transplantation significantly reduced GVHD mortality. In conclusion, we revealed a novel role of STING in APC activity that dictates T-cell allogeneic responses and validated STING as a potential therapeutic target for controlling GVHD after allo-HCT.

Na Wang, 1– 3 Hongzhi Xu, 1, 2 Qing Li, 1, 2 Xiaosheng Fang, 1, 2 Jie Liu, 1, 2 Xiaohui Sui, 1, 2 Lingyan Zhang, 1, 2 Yujie Jiang, 1, 2 Xin Wang 1– 5 1Department of Hematology, Shandong Provincial Hospital Affiliated to Shandong First Medical University, Jinan, Shandong 250021, People’s Republic of China; 2Department of Hematology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, Jinan, Shandong 250021, People’s Republic of China; 3School of Medicine, Shandong University, Jinan, Shandong 250012, People’s Republic of China; 4Shandong Provincial Engineering Research Center of Lymphoma, Jinan, Shandong 250021, People’s Republic of China; 5National Clinical Research Center for Hematologic Diseases, Jinan, Shandong 250021, People’s Republic of ChinaCorrespondence: Xin WangDepartment of Hematology, Shandong Provincial Hospital, Cheeloo College of Medicine, Shandong University, No. 324 Jingwu Road, Jinan, Shandong 250021, People’s Republic of ChinaTel +8613156012606Fax +86-531-87068707Email xinw@sdu.edu.cnPurpose: The aim of our study was to evaluate the clinical characteristics of myelodysplastic syndrome (MDS) patients with concomitant mild-to-moderate myelofibrosis (MF), and to assess its independent prognostic role in MDS patients diagnosed by World Health Organization 2016 classification (WHO2016C) with long-term follow-up.Patients and Methods: A total of 157 patients with primary MDS associated with or without MF were examined retrospectively with long-term follow-up. MF graded as MF-1/MF-2 was defined as “mild/moderate”. Cytogenetics testing and fluorescence in situ hybridization (FISH) were also conducted in all MDS patients.Results: Thirty-four (21.7%) of 157 MDS patients had MF. Also, 24 (15.3%) MDS patients based on WHO2016 criteria were defined as MF-1 and 10 (6.4%) as MF-2. MDS patients with MF-1/2 had a higher prevalence of death (p=0.002), leukemic progression (p=0.013), O blood type (p=0.039) as well as less hypercellular proliferation (p< 0.001) and less supportive treatment (p=0.003) compared with those without mild/moderate MF. Cytogenetics testing did not show a significant difference between MDS patients with and without MF. Multivariate analyses showed that MF (mild/moderate), a monosomal karyotype (MK) and % bone-marrow blasts were independently associated with shorter overall survival (OS) and progression-free survival (PFS). Age was an independent indicator of the adverse OS of MDS patients. Compared with those without MF, MDS patients with mild/moderate MF were significantly associated with worse OS and PFS in MK-negative subgroups and relatively low-risk Revised International Prognostic Scoring System for Myelodysplastic Syndromes (IPSS-R) stratification in long-term follow-up.Conclusion: Mild/moderate myelofibrosis and monosomal karyotype are independent indicators of a poor clinical outcome in MDS patients. In long-term follow-up, MDS with mild/moderate MF can be a prognostic marker for MDS patients with a specific MK stratification and IPSS-R stratification.Keywords: myelodysplastic syndromes, myelofibrosis, prognosis, cytogenetics

The gastrointestinal (GI) tract is a frequent target organ in acute graft-versus-host disease (aGVHD), which can determine the morbidity and nonrelapse mortality after allogeneic hematopoietic cell transplantation (allo-HCT). Donor T cells recognize allogeneic Ags presented by host APCs, proliferate, and differentiate into Th1 and Th17 cells that drive GVHD pathogenesis. IL-12 has been shown to play an important role in amplifying the allogeneic response in preclinical and clinical studies. This study demonstrates that IL-12Rβ2 expression on recipient nonhematopoietic cells is required for optimal development of aGVHD in murine models of allo-HCT. aGVHD attenuation by genetic depletion of IL-12R signaling is associated with reduced MHC class II expression by intestinal epithelial cells and maintenance of intestinal integrity. We verified IL-12Rβ2 expression on activated T cells and in the GI tract. This study, to our knowledge, reveals a novel function of IL-12Rβ2 in GVHD pathogenesis and suggests that selectively targeting IL-12Rβ2 on host nonhematopoietic cells may preserve the GI tract after allo-HCT.

Allogeneic hematopoietic cell transplantation (allo-HCT) is an effective immunotherapy for various hematologic malignancies, predominantly through potent graft-versus-leukemia (GVL) effect. However, the mortality after allo-HCT is because of relapse of primary malignancy and followed by graft-vs-host-disease (GVHD) as a major cause of transplant-related mortality. Hence, strategies to limit GVHD while preserving the GVL effect are highly desirable. Ceramide, which serves a central role in sphingolipid metabolism, is generated by ceramide synthases (CerS1-6). In this study, we found that genetic or pharmacologic targeting of CerS6 prevented and reversed chronic GVHD (cGVHD). Furthermore, specific inhibition of CerS6 with ST1072 significantly ameliorated acute GVHD (aGVHD) while preserving the GVL effect, which differed from FTY720 that attenuated aGVHD but impaired GVL activity. At the cellular level, blockade of CerS6 restrained donor T cells from migrating into GVHD target organs and preferentially reduced activation of donor CD4 T cells. At the molecular level, CerS6 was required for optimal TCR signaling, CD3/PKCθ co-localization, and subsequent N-RAS activation and ERK signaling, especially on CD4

Introduction Anti-thymocyte globulin (ATG) is used prior to allogeneic hematopoietic stem cell transplantation (allo-HSCT) for graft-versus-host disease (GVHD) prophylaxis. Two different ATG doses (7.5 or 10 mg/kg) were evaluated in comparison with a group without ATG therapy. Methods We retrospectively analyzed 132 patients who were transplanted with HSCT without ATG (non-ATG), or who received 7.5 mg/kg ATG (ATG-7.5) or 10 mg/kg ATG (ATG-10) prior to transplantation. The immune cells (CD3+CD4+ T cells, CD3+CD8+ T cells, CD19+ B cells and CD16+CD56+ NK cells) were examined in peripheral blood every three months post-HSCT for 12 months. Results Compared with non-ATG group, combined ATG-7.5/ATG-10 groups had significantly lower CD3+CD4+ T cells and higher CD3+CD8+ T cells at 3, 6, 9, 12 months post-HSCT; thus, displaying a lower CD4/CD8 ratio in the ATG groups compared to non-ATG group. The ratio of CD19+ B cells was statistically lower (at 3rd month, p = .014; at 6th month, p = .025) in combined ATG-7.5/ATG-10 groups at 3 and 6 months post-HSCT, but not at 9 and 12 months after HSCT. The ratios of CD3+CD4+ T cells, CD3+CD8+ T cells, CD19+ B cells and CD16+CD56+ NK cells were similar between the ATG-7.5 and ATG-10 groups at all examined time points. The overall survival (OS), progression-free survival (PFS), relapse and acute GVHD (aGVHD) were comparable among recipients without ATG therapy and with ATG-7.5 or/and ATG-10 therapies. Multivariate analysis revealed that immune cells ratios were not independent factors affecting prognosis. Conclusion The ATG therapy at higher and lower doses led to a delayed reconstitution of T cells and the inversion of CD4/CD8 ratio for at least one year after HSCT.

Objectives Antithymocyte globulin is extensively used for prophylaxis of graft-versus-host disease in patients undergoing haploidentical hematopoietic stem cell transplantation. However, different doses of antithymocyte globulin are administered in clinical practice. This study aimed to identify the optimal dose of antithymocyte globulin (thymoglobulin) in haploidentical hematopoietic stem cell transplantation. Materials and methods We retrospectively analyzed the effects of 10 mg/kg (2.5 mg/kg on days -5 to -2) versus 7.5 mg/kg thymoglobulin (2.5 mg/kg on days -4 to -2) on patients receiving haploidentical hematopoietic stem cell transplantation with myeloablative conditioning. Results We observed significant differences between the 2 treatment groups with regard to cumulative incidence of grade II to IV acute graft-versus-host disease (15.3% vs 14.6%; P = .93) and 3-year chronic graft-versus-host disease (12.1% vs 14.3%; P = .77). The probabilities of 3-year overall survival (68.9% vs 73.5%; P = .98) and graft-versus-host disease-free/relapse-free survival (66.7% vs 53.1%; P = .14) were comparable between the 2 groups. However, there was a trend for lower cumulative incidence of hemorrhagic cystitis in the 7.5 mg/kg treatment group compared with the 10 mg/kg treatment group (40.7% vs 24.4%; P = .07). Conclusions For patients who received a reduced dose of antithymocyte globulin (7.5 vs 10 mg/kg), there was no impaired effect on prophylaxis of graft-versus-host disease, with a trend of reduced incidence of hemorrhagic cystitis. Further studies of the 7.5 mg/kg dose of antithymocyte globulin are warranted for patients receiving haploidentical hematopoietic stem cell transplantation.

The role of antioxidant intervention in polycystic ovary syndrome (PCOS) patients has been increasingly investigated in recent years. In order to further clarify whether antioxidant therapy is beneficial for PCOS patients and the emphasis of its effects, this study provides a systematic review and meta-analysis of randomized controlled trials examining the effect of antioxidant intervention on PCOS.Enrolled study designs related to antioxidant interventions and PCOS, published from 1999 to 2020, were searched from EMBASE, PubMed, and Web of Science databases to sort out proven studies on antioxidant interventions and PCOS. Data were reported as weighted mean difference (WMD) or standard mean difference with associated confidence intervals of 95%. The analysis was conducted using Stata version 16.0.Twenty-three studies were included in total. Antioxidant intervention had a positive impact on homeostasis model assessment of insulin resistance (WMD = -0.37, P = .011) and Triglycerides (WMD = -25.51, P.001). And antioxidant intervention did not improve testosterone levels significantly (WMD = -0.20, P = .2611). Subgroup analysis showed that except for the D-chiro-inosito subgroup, no difference in body mass index was observed between the intervention group and the control group.This meta-analysis demonstrates the efficacy of antioxidant intervention in patients with PCOS, demonstrating that antioxidant intervention has a significant effect on insulin resistance and lipid metabolism improvement. However, antioxidant intervention therapy has no discernible impact on testosterone levels or body mass index. Omega-3 may be a more effective antioxidant intervention for PCOS. In addition, this meta-analysis provides important reference opinions and treatment recommendations for PCOS.

In recent years, the role of metformin in girls with precocious puberty (PP) has been increasingly frequently studied. The objective of this present study is to assess the effect of metformin on low birth weight girls with precocious puberty (LBW-PP girls).We search the confirmed studies about circulating metformin and PP from the databases of EMBASE, PubMed, and Web of Science. Data were reported as weighted mean difference (WMD) and associated 95% confidence intervals (CIs). Analysis was performed by Review Manager 5.3 and Stata version 12.0.A total of 205 cases (metformin group n = 102, untreated group n = 103) were included in this study. The meta-analysis of randomized controlled trials (RCTs) suggested that metformin had statistically significant effects on testosterone (P = .001), androstenedione (P = .022), bone mineral density (BMD; P = .151), triglycerides (P ≤ .001), body mass index Z score (BMI Z score; P ≤ .001), dehydroepiandrosterone-sulfate (DHEAS; P = .053), sex hormone-binding globulin (SHBG; P = .049), high-density lipoprotein (HDL) cholesterol (P ≤ .001), low-density lipoprotein (LDL) cholesterol (P = .021), fat mass (P ≤ .001), lean mass (P = .025), and fasting insulin (P = .002).This meta-analysis provided evidence of the efficacy of metformin in girls with LBW-PP girls, which proved that metformin could improve metabolism and reduce weight. Metformin had a positive effect on preventing LBW-PP girls from developing into obesity and polycystic ovarian syndrome. In addition, this meta-analysis provided important reference opinions and directions for the treatment of LBW-PP girls.

IL-12 (p35/p40) and IL-23 (p19/p40) signal through IL-12R (IL-12Rβ2/β1) and IL-23R (IL-23Rα/IL-12Rβ1), respectively, which can promote pathogenic T lymphocyte activation, differentiation, and function in graft-versus-host disease (GVHD). With the use of murine models of allogeneic hematopoietic cell transplantation (HCT), we found that IL-12Rβ1 on donor T cells was dispensable to induce acute GVHD development in certain circumstances, while IL-23Rα was commonly required. This observation challenges the current paradigm regarding IL-12Rβ1 as a prerequisite to transmit IL-23 signaling. We hypothesized that p19/EBI3 (IL-39) may have an important role during acute GVHD. With the use of gene transfection and immunoprecipitation approaches, we verified that p19 and EBI3 can form biological heterodimers. We found that IL-39 levels in recipient serum positively correlated with development of acute GVHD in experimental models and in clinical settings, thereby implicating IL-39 in the pathogenesis of acute GVHD. Furthermore, we observed that human T cells can signal in response to IL-39. In chronic GVHD, IL-23Rα and IL-12Rβ1 were similarly required for donor T cell pathogenicity, and IL-39 levels were not significantly different from controls without GVHD. Collectively, we identify a novel cytokine, IL-39, as a pathogenic factor in acute GVHD, which represents a novel potential therapeutic target to control GVHD and other inflammatory disorders.

Diffuse large B-cell lymphoma (DLBCL) has been correlated with virus infection and immunity status. We retrospectively analyzed the association between HBV antibody and DLBCL development in HBsAg- ...

Background: Diffuse large B-cell lymphoma (DLBCL) has been correlated with virus infection and immunity status. Hepatitis B virus (HBV) infection is a significant public health problem around the world, especially in China. Previous research regarding the association of non-Hodgkin lymphoma (NHL) and HBV mostly focused on HBV antigen and HBV DNA. This study aimed to evaluate the relationship between HBV antibody and clinical prognosis in DLBCL. Methods: We retrospectively investigated the clinical characteristics of 190 newly diagnosed and untreated DLBCL patients and did a follow-up study. Results: Compared with HBeAb- patients, HBeAb+ patients displayed unique clinical features, such as more advanced disease stage (p=0.031) and higher International Prognostic Index (IPI) score (p=0.015). HBV antibody-negative patients had better therapeutic efficiency than positive patients (pConclusions: Taken together, our investigations identified for the first time the close association between HBV antibody and clinical prognosis and Rituximab responses in DLBCL patients. These findings indicate the novel association between HBV infection and DLBCL prognosis, provide potential biomarker to predict the effect of Rituximab, and offer novel insights into the role of immune response to HBV infection in DLBCL progression.

This paper aims at interpreting the three filicide stories in Ovid's Metamorphoses in the light of defamiliarization and data analysis. Through data analysis of the transformations, this paper shows the times, types, subjects, objects and connotation of transformations in different stories, revealing the realistic meaning of these stories. It also reflects on the relationship between husband and wife, father and son, and mother and son.

Sexual dysfunction (SD) is one of the late complications in survivors after hematopoietic stem cell transplantation (HSCT), and the gonadal hormones might be involved in the pathogenesis of this pathological process. This study aimed to investigate the incidence of SD by questionnaire, to explore the relationship between SD and the comprehensive gonadal hormones in patients post HSCT. We identified 72 survivors of hematological diseases who underwent HSCT. The sociodemographic characteristics and medical histories of participants were ascertained by a modified version of a questionnaire named “PPSAS-HSCT” in our study. Blood samples were regularly assayed for the global gonadal hormones. Forty-four percent of the females and 51% of the males reported a loss of interest in sexual activities. Ninety-two percent (23/25) of females exhibited decreased serum anti-Mullerian hormone (AMH) levels, and 74% (35/47) of males had elevated follicle-stimulating hormone (FSH) levels. The males with a higher level of oestradiol/testosterone (E2/T) had more symptoms of SD after HSCT. Patients with GVHD who received glucocorticoid (GC) therapy exhibited a lower level of testosterone and more serious SD, especially in the female population. SD and abnormal gonadal hormone homeostasis were present in more than half of the survivors after HSCT. Graft-versus-host disease (GVHD) and glucocorticoid treatment were confirmed to have a significant impact on the levels of testosterone among females. A multimodal intervention for the survivors after HSCT and a better consciousness of the medical staff are necessary for improving the quality of life of the recipients.

Allogeneic hematopoietic cell transplantation (allo-HCT) is a curative option for the treatment of hematological malignancies, which is primarily mediated by donor immune cells. Acute graft-versus-host disease (aGVHD) mainly induced by transplanted donor T cells is a major and life-threating complication leading to severe "cytokines storm" and multiple organ damage, which contributes to high morbidity and mortality and thus limits the success of allo-HCT. Sphingosine-1-phosphate (S1P), a bioactive lysophospholipid, is synthesized from sphingosine by sphingosine kinase 1 (Sphk1) or Sphk2 and degraded by S1P lyase. S1P signal plays an important role in regulating biological functions and homeostasis of T lymphocytes, and thus has been considered as a therapeutic candidate against autoimmune disease. In current study, we demonstrated that Sphk1 but not Sphk2 is required for antigen-presenting cells (APC) to activate allogeneic T cells. Using murine allo-HCT models, we found that secretory S1P produced by Sphk1 in the recipients was required for the development of full-blown GVHD (Fig. 1 A-B). Consistently, S1PR1, a primary receptor for S1P, plays a critical role in the pathogenicity of donor T cells to induce GVHD (Fig. 1C). Using pharmacologic inhibitors, we demonstrated that specific inhibition of Sphk1 (PF543) or S1PR1 (W146) substantially attenuated GVHD while preserving graft-vs.-leukemia (GVL) effect (Fig. 1D). Mechanistically, S1P/S1PR1 signal facilitated T-cell activation and differentiation towards Th1/Th17 but away from Tregs (Fig. 1E) and also promoted T-cell migratory potential into GVHD target organs (Fig. 1F). S1P/S1PR1 signaling increased mitochondrial fission of pathogenic CD4 + T cells through PRKAA1 dependent Drp1 and phosphorylated S6 (pS6) activation (Fig. 1 G-H). Whereas CD8 + T cells were much less sensitive to S1P-S1PR1-PRKAA1-pS6/Drp1 axis, which likely contributed to the GVL maintenance when S1P/S1PR1 signaling is absent or inhibited (Fig. 1 D, G). Furthermore, clinical data demonstrated that patients with acute GVHD exhibited a comparable level of sphingosine but a significantly higher level of S1P, as compared to the patients without GVHD, suggesting a positive role of S1P in GVHD development in clinic (Fig. 1I). Finally, we validated the efficacy of inhibiting Sphk1/S1PR1 in GVHD prevention induced by human T cells in a xenograft model (Fig. 1J). Taken together, our results provide a rationale and novel mechanism of targeting Sphk1/S1PR1 in the prevention of GVHD and leukemia relapse after allo-HCT. This novel strategy may be translated in the clinic to benefit patients with hematologic malignancies. Figure 1 Figure 1. Disclosures No relevant conflicts of interest to declare.

Introduction: Mantle cell lymphoma (MCL) is a sub-type of B-cell non-Hodgkin Lymphomas (NHL) that characterized by a heterogenous clinical course and poor prognosis. The transcription factor paired-box 5 (PAX5) is associated with B cell normal differentiation and development. Herein, we aim to explore both the prognostic factors and the role of PAX5 expression in MCL patients from single-center, which can provide theoretical guidance for clinical practice. Methods: The data of 80 MCL patients admitted to Shandong Provincial Hospital from October 2006 to April 2020 were collected to be analyzed. Kaplan-Meier method and univariate and multivariate cox analysis was used to analyze the correlation between overall survival and prognostic factors. Chi-square test, Pearson and Fisher correlation analysis were performed for statistical analysis of clinical features and experimental indicators. *p value Results: Clinical characteristics of all MCL patients were analyzed. PAX5 expression was identified by IHC in this study: the positive expression rate of PAX5 in all MCL patients was 60% (Figure 1A). The mRNA expression level of PAX5 was obviously elevated in MCL specimens than in normal group compared with other groups (p= 0.034) (Figure 1B). Besides, CD5, CD19, CD22, CD38, CD79α, CD79β and SOX11 were shown co-expressed with PAX5 by string database analysis (Figure 1C). PAX5-related genes were found mainly enriched in lymphocyte activation, B cell proliferation and NOTCH1 signaling pathway (Figure 1D). As is shown in Figure 1E-I, MIPI score (≥6), median to high risk group, high β2-MG level (≥2.65 mg/L), ECOG score (≥2), and splenomegaly were associated with adverse survival (p= 0.006, 0.030, 0.001, 0.019 and 0.001 respectively). The positive expression of PAX5 indicated a shorter overall survival in MCL patients (p= 0.024, Figure 1G). Positive PAX5 expression was associated with international prognostic index (MIPI) score (p= 0.038), high risk stratification (p= 0.006), WBC count (p= 0.024), and increased β2-microglobulin level (p= 0.008). MCL patients with PAX5-positive expression, high level of β2-MG level (≥2.65 mg/L), splenomegaly correlated with a poorer OS (p=0.002, and 0.004 respectively, Figure 1K, L). In patients with PAX5-negative expression, splenomegaly also indicated poor prognosis (p= 0.030, Figure 1M). Furthermore, among patients with high MIPI scores, PAX5-positive MCL patients had a shorter overall survival than PAX5-negative patients (p= 0.016, Figure N, O). Multivariate analysis showed that positive PAX was an independent prognostic factor for poor survival of MCL (p= 0.035). Conclusions: The positive expression of PAX5 in immunohistochemistry may be a factor contributing to the poor prognosis of MCL patients, which is correlated with clinical characteristics and laboratory indicators to a certain extent. Our results the role of PAX5 positivity in MCL and provide clinical guidance for clinical prognostic risk assessment and treatment strategy selection. Keywords: Mantle cell lymphoma; Paired-box 5; Prognosis; Immunohistochemistry Figure 1 Figure 1. Disclosures No relevant conflicts of interest to declare.

Background: Genomic sequencing technologies have identified isocitrate dehydrogenase (IDH) mutations in haematological malignancies. The prognostic implications of somatic IDH mutation (mIDH) in myelodysplastic syndromes (MDS) remain controversial. Methods: Mutations in IDH1 and IDH2 were detected using genomic sequencing technologies in 97 patients with MDS. Results: Seven (7.2%) mutations were identified: 3 in IDH1 (all R132C) and 4 in IDH2 (3 R140Q and 1 R140L). The frequency of mutation was 16.6% (2/12) in refractory anaemia with excess blasts (RAEB)-1 and 14.7% (5/34) in RAEB-2. IDH1/2 mutations were closely associated with higher bone marrow blast counts (median 10.0 vs. 2.3%; p = 0.019) and lower absolute neutrophil counts (median 0.44 × 109/L vs. 1.21 × 109/L; p = 0.027). All IDH mutations were mutually exclusive and heterozygous. IDH mutations were not significantly correlated with any specific karyotype. Patients with IDH1 mutations exhibited shorter overall and progression-free survival (OS and PFS; p = 0.039 and p = 0.042, respectively), whereas IDH2 mutations did not affect OS or PFS (p = 0.560 and p = 0.218, respectively). Multivariate analysis indicated that IDH1 mutation (p = 0.018; hazard ratio [HR] 4.735; 95% confidence interval [CI] 1.299-17.264), karyotype risk (p = 0.036; HR 1.619; 95% CI 1.033-2.539) and the revised International Prognostic Scoring System risk category (p < 0.0001; HR 2.122; 95% CI 1.401-3.213) were independent inferior prognostic factors. Conclusions:IDH1 mutation is associated with a poor prognosis.

Background: Late-onset hemorrhagic cystitis (LO-HC) is one of the common complications and major causes of morbidity in patients undergoing allogeneic hematopoietic stem cell transplantation (allo-HSCT). The classic treatment for HC includes hydration, alkalization, bladder irrigation, immunosuppressant reduction, and platelet transfusion. When the HC was considered to be associated with aGVHD, more immunosuppressive agents such as glucocorticoids will be added in. However, too intensive immunosuppressive measures leave the patients susceptible to infection and, in turn, increases the accidence of non-relapse mortality (NRM). It is important to explore novel, less-toxic, more effective, and cost-effective strategies for LO-HC. Hyperbaric oxygen therapy (HBOT) can stimulate fibroblast proliferation, angiogenesis, and wound healing. We deduce that HBOT might benefit patients with LO-HC after allo-HSCT. Methods: In this study, we retrospectively analyzed 238 patient underwent allo-HSCT in our center. From 2018, patients with LO-HC have been given HBOT in addition to conventional treatment in our center. The data in HBOT and the control group were collected and compared. Patients' characteristics were compared using the x2 test in case of discrete variables or the Mann-Whitney test in case of continuous variables. Logistic regression examined factors might be used as effective predictors for HBOT. Sensitivity and specificity were estimated based on four parameters cut-off point for additional glucocorticoid necessity. Results: A total of 238 patients who underwent allo-HSCT from 2014 to 2020 were enrolled in this study. Among them, 55 (23.11%) developed LO-HC (36 received regular treatment, and 19 received HBOT in addition to the regular therapy). The clinical & transplantation parameters of the patients with LO-HC were listed in table 1. There is no significant difference in the age, gender, primary disease distribution, conditioning regimen, donor, HLA compatibility, stem cell sources, the occurrence of aGVHD between two groups. There is also no significant difference in the initial day of LO-HC post-HSCT and duration, peak red cells count in the urine, and whether additional glucocorticoid for HC control had been added between the two groups. It is worth noting that compared with the HBOT group, we found higher HC grade distribution, higher CMV-DNA copies, and decreased levels of SOD2 within the 1st week of the initial therapy for LO-HC in the control group. The comparison of the demographic and medical characteristics of subjects with LO-HC were listed in table 2. According to the results of logistic regression analysis, patients who developed LO-HC with higher HC grade (p = 0.001) and decreased SOD2 level (p = 0.002) might benefit more from HBOT, indicating that they might be used as effective predictors for HBOT (Figure 1A). Only higher HC grade (p = 0.011) could predict whether or not additional glucocorticoid would be necessary for LO-HC control (Figure 1B). The predictive power of additional glucocorticoid during the LO-HC treatment process for 4 different titers (HC grade and duration, CMV, and SOD2 level) was evaluated by ROC analysis. According to the area under the curve (AUC), the best diagnostic capabilities of four parameters were shown in Figure 2A, 2B, 2C, and 2D. None of our patients experienced severe adverse events of HBOT, such as gas emboli, pulmonary edema, and seizures. Only one patient with AML discontinued after 1 session due to the reversible ear barotrauma which was suspected with HOBT. Conclusions: In summary, HBOT was effective and well-tolerated in patients with LO-HC post-allo-HSCT. Patients who received HBOT exhibited with short disease duration and mild LO-HC grade. Higher HC grade and decreased SOD2 levels might be used as effective predictors for HBOT. Higher HC grade might be used as a predictor to determine whether or not additional glucocorticoid would be necessary for HC control. In the future, HBOT might be not only used as an adjunctive care application for LO-HC, but also might be as the first-line treatment therapy for this population, regardless of the causes of LO-HC. Based on our preliminary result, we plan to enroll more eligible patients to establish the definitive efficacy and safety of HBOT in patients with LO-HC after allo-HSCT (NCT04502628). Disclosures No relevant conflicts of interest to declare.

INTRODUCTION The aim of the study was to analyze monosomal karyotype (MK) occurrence and the relationship between MKs and complex karyotypes (CKs) and to determine the prognostic significance of MKs in MDS patients based on conventional cytogenetic (CC) and fluorescence in situ hybridization (FISH) analyses. METHODS CC and FISH analyses were conducted for 216 primary MDS patients. Follow-ups and statistical analysis were conducted. RESULTS A total of 25 (11.6%) patients with MKs were identified by FISH and CC analyses, and 23 (92%) of these MKs were also CKs. Only 19 patients (8.8%) with MKs were identified by CC analysis. Patients with MKs had higher bone marrow (BM) blast counts (P = 0.006), incidence of very high risk according to International Prognostic Scoring System-Revised (IPSS-R) (P

SUMMARY OBJECTIVE: Aplastic anemia (AA) is an immune-mediated disease that destroys hematopoietic cells through activated T lymphocytes. B lymphocyte-mediated humoral immunity also plays an important role in the pathogenesis of AA. Regulatory B cell (Breg) subpopulation, which is defined as “B10”, secretes interleukin 10 (IL-10). The objective of our experiment was to investigate whether the scale-down proportion of B10 cells in AA patients may play a key role in the pathogenesis. METHODS: A total of 38 AA patients (14 SAA patients and 24 NSAA patients) and 20 healthy control subjects were included. All subjects did not suffer from autoimmune diseases or any other diseases affecting the immune system, such as infectious diseases. Bone marrow mononuclear cells (PBMCs) were isolated and analyzed by Flow cytometry (FCM) and Immunofluorescence double-labeling assay. The relationship between the relative proportions of B10 and ProB10 and their associations to AA, as well as disease severity, were assessed by common clinical indicators and then examined. RESULTS: Our analyses revealed AA patients had significantly lower proportions of peripheral B10 and B10pro compared to healthy controls. SAA patients had a substantially lower percentage of B10 cells and B10pro cells compared to NSAA patients. In addition, B10 cells and B10pro cells were negatively correlated with absolute neutrophil counts, hemoglobin levels and platelet, and absolute reticulocyte counts in AA patients. CONCLUSIONS: The present study attempted to elucidate the potential role of the scale-down proportion of B10 cells in the pathogenesis of AA. RESUMO OBJETIVO: A anemia aplástica (AA) é uma doença imunomediada que destrói células hematopoiéticas por meio dos linfócitos T ativados. A imunidade humoral mediada por linfócitos B também desempenha um papel importante na patogênese da AA. A subpopulação de células B reguladoras (Breg), que é definida como “B10”, secreta interleucina 10 (IL-10). No experimento, investigou-se se a proporção reduzida de células B10 nos pacientes de AA pode desempenhar um papel-chave na patogênese. MÉTODOS: Um total de 38 pacientes de AA (14 pacientes de anemia aplástica grave e 24 pacientes de anemia aplástica não grave) e 20 indivíduos de controle saudáveis foram incluídos. Todos os indivíduos não sofriam de doenças autoimunes ou de quaisquer outras doenças que afetam o sistema imunológico, tais como doenças contagiosas. As células mononucleares da medula óssea (PBMCs) eram isoladas e analisadas por citometria de fluxo (FCM) e ensaio de dupla marcação por imunofluorescência. A relação entre as proporções relativas de células B10 e as células ProB10 e as suas associações à AA, assim como a gravidade da doença avaliada por indicadores clínicos comuns, foram examinadas. RESULTADOS: Nossas análises revelaram que os pacientes de AA têm proporções significativamente menores de células B10 e células ProB10 periféricas em comparação com indivíduos de controle saudáveis. Os pacientes de anemia aplástica grave tiveram uma percentagem substancialmente menor de células B10 e células B10pro em comparação com pacientes de anemia aplástica não grave. Além disso, as células B10 e B10pro foram negativamente correlacionadas com contagens absolutas de neutrófilos, níveis de hemoglobina e plaquetas e contagem de reticulócitos absolutos nos pacientes de AA. CONCLUSÕES: Além disso, o estudo presente tentou elucidar o papel imunorregulatório potencial das células B10 na patogênese da AA e fornecer uma nova estratégia para a aplicação de imunoterapia baseada na célula B para tratar a AA no futuro.

To determine if Metadherin (MTDH) expression levels are positively correlated with the clinical stage of diffuse large B-cell lymphoma (DLBCL) based on MTDH being highly expressed in other type of tumors including melanoma, malignant glioma, breast cancer, and hepatocellular carcinoma. In this study, we investigated the pathologic significance of MTDH and its potential in predicting DLBCL outcomes.Tissue samples from 50 patients with DLBCL and 22 patients with lymph node reactive hyperplasia were collected and evaluated using immunohistochemical staining, microscopy, and western blotting. The Kaplan-Meier method and Cox regression model were used for survival analysis of patients.Our results show that the overexpression of the MTDH protein in tissues was observed in 66% of patients with DLBCL, whereas it was not overexpressed in the patients with reactive hyperplastic lymph nodes. While there was no correlation between MTDH overexpression with age, sex, presence of B symptoms, and lactate dehydrogenase (LDH) levels in patients with DLBCL, this parameter was positively correlated with clinical stages. Moreover, MTDH-negative patients had significantly better prognoses compared with the MTDH-positive patients.Our preliminary study indicates that MTDH may play an important role in the development of DLBCL, and that MTDH overexpression is potentially associated with the clinical progression of DLBCL. In addition, high expression levels of MTDH in tissues was correlated with a poorer prognosis for patients with DLBCL. As such, MTDH may be a potential therapeutic target for specific therapy. However, research on a larger group of patients is needed to verify these preliminary results.

We evaluated the safety and efficacy of 2 conditioning regimens (busulfan/fludarabine vs modified busulfan/cyclophosphamide) in patients with acute myeloid leukemia undergoing haploidentical hematopoietic stem cell transplant.Twenty patients with primary acute myeloid leukemia had been randomized into busulfan/fludarabine and modified busulfan/cyclophosphamide groups. We retrospectively compared hematopoietic engraftment, regimen-related toxicity, graft-versus-host disease, transplant-related mortality, leukemia-free survival, and overall survival between the groups.All patients achieved engraftment with 100% donor chimerism. The median times for the neutrophil and platelet engraftment in the busulfan/fludarabine and modified busulfan/cyclophosphamide groups were 14.1 versus 14.3 days and 12.7 versus 12.2 days, respectively. Significantly lower incidences of pretreatment toxicity, blood transfusion, and virus activation were observed in the busulfan/fludarabine group. Acute grade 1 graft-versus-host-disease developed in all patients, which was successfully controlled with methylprednisolone. There were no significant differences in engraftment, graft-versus-host disease, leukemia-free survival, and overall survival between groups. Both of these conditioning regimens achieved stable engraftment. Regimen-related toxicity in the busulfan/fludarabine group was well tolerated compared with that in the modified busulfan/cyclophosphamide group, without an increase in relapse rate.Our results demonstrated that myeloablative busulfan/fludarabine might be a highly effective and low-toxicity alternative for patients with acute myeloid leukemia.

MicroRNAs (miRNAs) are small RNAs that regulate target gene expression. Using microarray-based miRNA expression profiling, we compared the miRNA expression in granulocytes from four patients with acute myeloid leukemia and four healthy controls. Thirty-four miRNAs were found to be differentially expressed, including 20 miRNAs that were up-regulated and 14 miRNAs that were down-regulated. The expression of selected miRNAs (miR-26a-5p and miR-23b-3p) was independently validated in 20 patients and 12 healthy controls. Notably, we demonstrated that peroxiredoxin III (PrxIII) is a common direct target of both miR-26a-5p and miR-23b-3p. Furthermore, these results indicate that the two decreased miRNAs could scavenge cellular reactive oxygen species (ROS) by targeting the PrxIII gene. These findings are discussed with regard to the known function of PrxIII as a ROS scavenger and the high endogenous ROS levels required for hematopoietic stem cell differentiation. These findings may potentially offer insights into the pathological relationships between miR-26a-5p, miR-23b-3p and leukemogenesis.

Introduction: B-cell non-Hodgkin lymphoma is the most frequent type of non-Hodgkin's lymphoma. RCHOP regimen is established as the standard therapy for aggressive and indolent B-cell NHL, which has a 10%-20% rate of febrile neutropenia (FN). Recently, pegylated recombinant human granulocyte colony stimulating factor (PEG-rhG-CSF) is frequently used in clinical practice. This randomized controlled clinical study was conducted to investigate the efficacy and safety of prophylactic PEG-rhG-CSF in patients with B-cell non-Hodgkin lymphoma on RCHOP chemotherapy. Methods:We included 162 patients with pathological diagnosis of B-cell non-Hodgkin lymphoma including diffuse large B-cell lymphoma, follicular lymphoma and mantle cell lymphoma (MCL),from October 2016 to May 2019 at Shandong Provincial Hospital Affiliated to Shandong University. All patients gave written informed consent in accordance with the Declaration of Helsinki. The patients were randomized into PEG-rhG-CSF and rhG-CSF groups. Each patient received three cycles of chemotherapy with identical RCHOP regimens. In the study group, the patients received PEG-rhG-CSF 6mg(weight≥45Kg)or 3mg(weight≤45Kg)once 24 hours after the end of chemotherapy drugs of every chemotherapy cycle. In the control group, they weren't preventively administered rhG-CSF. If their neutrophil count (ANC)≤1.0×109/L, they were administered rhG-CSF:5ug/kg/day until their neutrophil count (ANC)≥2.0×109/L. The primary endpoint was the incidence of III/IV grade neutropenia and febrile neutropenia(FN) after each chemotherapy cycle. Meanwhile the rate of antibiotics application and safety were observed. Analyses were performed with SPSS Statistics 20.0 (IBM-SPSS, Chicago, Illinois). The numerical data was presented as mean ± SD. Statistical analysis was performed using one-way analysis of variance and chi-square test. A p-value Results: Clinical characteristics for PEG-rhG-CSF and rhG-CSF groups were shown in Table1. There were no significant differences in age, gender,height, body weight, body mass index, Ann Arbor and IPI staging. The incidence of IV grade neutropenia during cycle 1 in 81 evaluable study cycles and 81 evaluable control cycles were 7.41% and 35.80%( P0.05). The differences in I/II/III grade neutropenia between study and control groups weren't statistically significant (Table2,Fig.1). After secondary prophylactic use of PEG-rhG-CSF In the study group, the incidences of III/IV grade neutropenia decreased from 77.78% to 14.81% (P0.05 ), which were mostly mild or moderate. Patients receiving PEG-rhG-CSF who developed III/IV grade neutropenia were significantly older than those without neutropenia (53.41±14.96 vs. 63.64±4.65;years; p=0.01) (Fig.3).The incidence of III/IV grade neutropenia in patients older than 60 years was significantly higher than that in patients younger than 60 years(24.44% vs. 6.38%; P =0.038). Conclusions: Prophylactic use of PEG-rhG-CSF could effectively reduce the incidences of grade III/IV neutropenia and FN, which ensures that patients with lymphoma receive standard-dose chemotherapy to improve prognosis. III/IV grade neutropenia after prophylactic use of PEG-rhG-CSF were more likely to occur in patients older than 60 years. After the use of PEG-rhG-CSF, the elderly patients should be pay more attention to them. Disclosures No relevant conflicts of interest to declare.

Objective: Retrospectively analysing the outcome of additional medium-dose etoposide (VP-16 30mg/kg) in allogeneic hematopoietic stem cell transplantation (allo-HSCT) for acute lymphoblastic leukemia (ALL). Methods: From 2010.10.1 to 2018.6.30, 53 ALL patients received allo-HSCT in Shandong provincial hospital. 20 conditioning with medium-dose VP-16 (15 in CR , 5 in refractory and/or relapse disease) (VP-16 group), 33 conditioning without medium-dose VP-16 (32 in CR and 1 in refractory and/or relapse disease) (control group) . The basic conditions of the primary disease, treatment-related toxicity, leukemia-free survival (LFS), overall survival (OS), graft-versus-host disease (GVHD) and relapse-free survival (GRFS), non-relapse mortality (NRM), relapse incidence (RI), GVHD and so on were compared between the two groups. Results: The VP-16 group included more R/R(refractory and/or relapse disease) patients and was associated with improved 3-year-LFS (70.7% vs. 56.5%, p= 0.565) and 3-year-OS (68% vs. 59.4%, p=0.825), although there was no statistical difference. Moreover, the additional of VP-16 lead to reduced incidence of aGVHD (II,III,IV) (10% vs. 30.7%, p=0.146) and cGVHD (9.1% vs 24%, p=0.25), resulting in improved GRFS (63.6% vs. 48.7%, P=0.343). RI was similar between the two group (29.3% vs 27.2%, p=0.76). Meanwhile, the addition of VP-16 enhanced the intensity of conditioning regimen, its NRM was relatively lower than control group (0% vs. 20.2%, P=0.371). Conclusion: The intensified conditioning regimen with medium-dose VP-16 did not increase NRM and GVHD, with tendency to increase OS and LFS, may become an effective pre-treatment scheme in allo-HSCT for ALL. Disclosures No relevant conflicts of interest to declare.

It is often difficult to distinguish myelodysplastic syndrome (MDS) from aplastic anemia (AA) because of the considerable clinical, cytologic histologic similarities between these two disorders; however, distinguishing between AA and MDS is of great importance because there is a higher risk of progression to acute leukemia in patients with MDS compared with AA. Up to now, CD34(+) cells in MDS and AA patients have been studied extensively; however, little information is available on myeloid granulocytes. The aim of this study was to determine whether immunophenotype of myeloid granulocytes in AA patients was different from that of MDS. Flow cytometry was used to assess the immunophenotype of myeloid granulocytes in 22 patients with MDS, 12 with AA, and 10 normal subjects. Our data showed that the percentages of CD13(+) granulocytes, CD33(+) granulocytes, CD34(+) granulocytes, and HLA-DR(+) granulocytes were significantly higher in patients with MDS than in AA patients and normal subjects (P0.05). The percentages of CD15(+) granulocytes and CD10(+) granulocytes were significantly lower in patients with MDS than in AA patients and normal subjects (P0.05). There were no significant differences in the expression of these markers between patients with AA and normal subjects (P0.05). As refractory anemia progressing to refractory anemia with excess blasts, the percentages of CD13(+) granulocytes, CD33(+) granulocytes, CD34(+) granulocytes and HLA-DR(+) granulocytes were significantly increased, whereas, the percentage of CD15(+) granulocytes was significantly decreased (P0.05). These data suggest that immunophenotype of myeloid granulocytes may be a useful parameter for the differential diagnosis of MDS and AA.

Up to date, survivin, a well-known inhibitor of apoptosis, has attracted considerable attention as a potential biomarker and therapeutic target in diffuse large B-cell lymphoma (DLBCL). Nevertheless, there still remains no consensus on heterogeneous results. Herein, a meta-analysis was performed to clarify a convincing significance of survivin status on prognosis and clinicopathology of DLBCL patients.Eligible studies were identified by searching Medline, Embase, Scopus, CNKI, and Wanfang databases (last updated on November 30, 2014). Pooled hazard ratios (HRs) and odds ratios (ORs) with 95% confidence intervals (CIs) were calculated. Heterogeneity and sensitivity were also analyzed. Moreover, Begg, Egger test, and funnel plots were applied to evaluate the publication bias.We finally included 17 eligible studies with the total number of 1352 patients in the meta-analysis. The pooled results showed that positive survivin expression in DLBCL was associated with inferior overall survival (OS) (HR: 1.880, 95% CI: 1.550-2.270) in patients. Moreover, a significant association was revealed between survivin expression and advanced clinical stage (III + IV) (OR: 0.611, 95% CI: 0.452-0.827), higher International Prognosis Index (IPI) score (Score 3-5) (OR: 0.559; 95% CI: 0.410-0.761), elevated serum lactic dehydrogenase (LDH) (OR: 0.607, 95% CI: 0.444-0.831), presence of bone marrow involvement (OR: 2.127, 95% CI: 1.154-3.921) together with reduced complete remission (CR) rate (OR: 0.478, 95% CI: 0.345-0.662).The results suggest that survivin could be a useful prognostic biomarker, and a promising target for DLBCL therapeutic intervention. Considering limited HR data adjusted for standard prognostic variables could be retrieved, future high-quality studies will be needed in evaluating the independent prognostic value of survivin expression in DLBCL.

Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.