Search

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

This paper is concerned with the stability of semi-infinite vector optimization problems (SIVOP) under functional perturbations of both objective functions and constraint sets. First, we establish the Berge-lower semicontinuity and Painleve–Kuratowski convergence of the constraint set mapping. Then, using the obtained results, we obtain sufficient conditions of Painleve–Kuratowski stability for approximate efficient solution mapping and approximate weakly efficient solution mapping to the (SIVOP). Furthermore, an application to the traffic network equilibrium problems is also given.

This paper presents an effective experimental method and system for mechanism study of unsteady water vapor condensation encountered in high speed expansion flow. We proposed an experimental method and designed a simplified expansion system to fulfill the study. Tunable diode laser absorption spectroscopy (TDLAS) and light sheet technique are integrated in the system to monitor the unsteady condensation process in a high speed expansion flow generated by the expansion system. Two near infrared water vapor absorption transitions (1395.0 nm and 1409.27 nm) and one near infrared methane absorption transition (1653.73 nm) are applied in the TDLAS measurement to measure the transient flow parameters during the condensation process. Using the experimental method, time dependent condensation processes are monitored with different expansion time scales. The light sheet results visually reveal the condensation phenomena during the expansion process, while TDLAS results quantitatively follow the condensation process. The experimental results are compared with computational fluid dynamics simulations and a good agreement between them is observed, which indicates that the presented experimental method and system is effective in investigating unsteady water vapor condensation in high speed expansion flow.

Botrytis cinerea, B. fabae, and B. fabiopsis are known to cause chocolate spot on broad bean. This study was conducted to develop polymerase chain reaction (PCR)-based assays to detect and differentiate these three species. Two sets of primers, Bc-f/Bc-r for B. cinerea and Bfab-f/Bfab-r for B. fabiopsis, were designed based on two sequence-characterized amplified region markers derived from two random amplified polymorphic DNA assays. The other primer set, Bfa-f/Bfa-r for B. fabae, was designed based on the necrosis and ethylene-inducing protein 1 gene sequence. The three primer sets were highly specific for the corresponding species of Botrytis in both single and multiplex PCR assays. The PCR detection limit was 40, 40, and 400 pg of DNA per 25-μl reaction mixture for B. fabae, B. fabiopsis, and B. cinerea, respectively. Presence of the broad bean DNA in the PCR reactions at 1:1000 (Botrytis DNA/broad bean DNA [wt/wt]) had negligible effects on detection of the targeted Botrytis spp. The multiplex PCR assay was able to detect three Botrytis spp. in artificially infected and naturally infected broad bean leaves. These results suggest that the multiplex PCR assay developed in this study could be used to monitor the epidemics of chocolate spot of broad bean in the field.

According to the requirements of the individual combat command system for real-time emergency command and battlefield situation, the software design based on the AREngine platform for the individual battlefield collaborative situation generation is studied. Using the domestic smart phone to carry out the augmented reality situation of the traditional sandbox, and make full use of the powerful AR function of the smart phone with the core processing equipment of the individual soldier system equipped by the infantry commander and the combat personnel, providing the infantry with infantry command, combat deduction, The realistic deployment of power deployment and battlefield situation can be used for wartime preparation of troops and strategic deployment during simulation training, which has practical significance.

To investigate the prevalence and genetic diversity of Grapevine berry inner necrosis virus (GINV) in China, 195 grapevine samples from 15 Chinese provinces and regions were tested using reverse-transcription polymerase chain reaction. The samples included symptomatic and asymptomatic cultivars, with 35.9% (70 of 195) of samples testing positive for GINV. Seventeen samples had obvious ring spot symptoms, and 94.1% (16 of 17) tested positive for GINV, suggesting that GINV may be highly associated with the ring spot symptom. The genetic diversity of GINV isolates was analyzed based on the partial nucleotide and amino acid sequences of the coat protein (CP) and movement protein (MP) genes. Phylogenetic analyses of the MP and CP gene sequences divided the GINV isolates into three groups. The majority of the Chinese isolates were in groups 1 and 2, and only one Chinese isolate, along with a previously reported Japanese isolate, was in group 3. This is the first report on the genetic diversity of GINV isolates and their prevalence and distribution in China.

Four varieties of potted apple were subjected to thermotherapy (37 ± 1 °C) coupled with shoot tip grafting. Using reverse transcription-polymerase chain reaction assays prior to treatment, mixed infections with Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV), Apple mosaic virus (ApMV) and Apple scar skin viroid (ASSVd) were detected in 95.8 % of treated plants. It was found that the sprouts of Dahongrong (DHR) and Qiyuetianxian (QYT) variety buds were inhibited by high temperature, although some buds of these two varieties were able to sprout, the growth was slow. The average survival rate of shoot tips cut after thermotherapy was 41.2 % (61/148). The survival rate of DHR (63.2 %) was highest among the four varieties. Sixty-one surviving apple plants were detected over two periods, indicative of an average elimination rate of 65.6 % (40/61) for new leaves (June) and 37.7 % (23/61) for dormant branches (November). The difference of elimination rate for DHR between the two periods was the most obvious. Detections rates of viruses were also different in the two periods; ASGV in dormant branches were 27.8 % higher than those in new leaves, and ASPV (90.6 %) remained the same over the two periods.

UNLABELLED The aim of this study was to develop an indirect enzyme-linked immunosorbent assay (i-ELISA) based on epitope AA503-509 (RANEPKE), which is on nonstructural protein of Muscovy duck parvovirus (MDPV). Sera (100) from negative and vaccinated Muscovy ducks were compared with infected sera (240) to establish the cut-off value of this i-ELISA. There was a significant difference between the positive and negative populations (P

The presence of grapevine virus B (GVB) was detected in 188 grapevine samples from China by double antibody sandwich ELISA (DAS-ELISA) and reverse transcription-PCR (RT-PCR). The accuracy of detection by RT-PCR was confirmed by sequencing amplified PCR fragments. Seventeen samples were GVB-positive by DAS-ELISA and five by RT-PCR. The isolate QMW proved to be positive by RT-PCR only, and four isolates (DGWH, DGW, QM, and JFL) could be detected by both methods. Among the five GVB-positive samples detected by RT-PCR, two isolates were originally collected from Henan province and three from Liaoning province. The expected 722 bp DNA fragment, covering partial ORF3 through partial ORF5, was amplified from the five GVB infected samples. Sequence analysis revealed that the molecular variants΄ composition of GVB in the different isolates was complex. Clones of DGWH, DGW, QM, and JFL isolate shared high nucleotide identities, while the identities among the clones of isolate QMW varied. The variants of GVB isolates obtained in this study showed nucleotide identities from 81.1% to 97.9% among themselves, and 79.1% to 98.5% identity with five previously published GVB isolates in NCBI. The alignment of partial ORF3 and the phylogenetic relationships of ORF4 revealed that the molecular variants of Chinese GVB isolates could be clustered into three groups. Only isolate DGW was in the same group with the reported GVB isolates from other countries; the other four GVB isolates in this study were clustered into two groups.

In 2010 and 2011, a disease exhibiting characteristics of white mold was found on Sedum sarmentosum, a crassulaceous weed under canopies of tea trees, in Zhushan County, Hubei Province, China. Based on the cultural and morphological characteristics, the pathogen was identified as Sclerotinia nivalis Saito. In the phylogenetic tree inferred from the internal transcribed spacer (ITS)-rDNA sequences, the pathogen was clustered with five previously characterized isolates of S. nivalis, forming a unique clade, thus confirming the morpho-cultural identification. Koch’s postulates were fulfilled by pathogenicity tests using the isolate SsSn-24 and Let-19 of S. nivalis on plants of S. sarmentosum. To our knowledge, this is the first report of S. nivalis on S. sarmentosum in the family Crassulaceae.

To gain insight into the molecular basis of field isolates inducing the symptoms of leaf yellowing, discolouration along leaf sides and leaf mosaic, six isolates from peach showing the three different symptoms in the field were studied by single-strand conformation polymorphism analysis and nucleotide sequence analysis. Results revealed that each Peach latent mosaic viroid (PLMVd) isolate is composed of a population of genetically related variants (haplotypes), one being predominant with frequencies from 32% to 57%, and most of others having a low frequency of 4-5%. Each predominant haplotype was sequenced, as well as some non-predominant haplotypes selected randomly for comparative purposes. In each isolate, sequence alignment among the predominant and non-predominant haplotypes demonstrated that the predominant haplotype had the least variation with others among them, and its sequence was identical to the consensus sequence, which inflected that the predominant haplotype displayed a wide representative of sequence for others in a PLMVd isolate. The similarities and genetic distance between the predominant sequences from peach showing the same symptoms were higher and smaller, respectively, than that with different symptoms; they were more than 98.8% and

Recently, a novel virus tentatively named grapevine fabavirus (GFabV) was reported in North America, it currently classified as a putative member of the genus Fabavirus (Al Rwahnih et al. 2016). Currently, its effects on grapevines remain unknown. In this study, leaves of three virus-eliminating ‘Beta’ grapevines (Vitis riparia×V.labrusca) showed chlorotic mottling and deformation after being grafted with ‘Ruby seedless’ grapevine (Vitis vinifera L.) scion. Before grafting, the ‘Beta’ and ‘Ruby seedless’ grapevines had been screened by RT-PCR for Grapevine leafroll-associated virus -1-4 and 7 (GLRaV-1-4 and 7), Grapevine fanleaf virus, Grapevine rupestris stem pitting-associated virus, Grapevine fleck virus, Grapevine virus A (GVA), GVB, GVE, Grapevine pinot gris virus, and Grapevine berry inner necrosis virus. No viruses were detected in the ‘Beta’ grapevines, except for GLRaV-3 in the ‘Ruby seedless’ grapevine. Additionally, small RNAs from the diseased ‘Beta’ leaves were sequenced as described previous...

The N-methyl-D-aspartate (NMDA) receptor antagonist MK-801 has been shown to induce an acute Fos and Fos-related antigen (Fra) expression in the rat retrosplenial granular cortex (RSG), but the exact composition of the Fos protein family and their individual dynamic alterations are unknown. We examined this issue using immunocytochemistry and Western blot analysis with two antibodies that recognize, respectively, Fos and all the identified members of Fos protein family. Immunocytochemistry detected a rapid and transient expression of Fos proteins in some RSG neurons and a delayed and prolonged expression of Fra proteins in most RSG neurons following a single systemic MK-801 injection (1 mg/kg). Multiple MK-801 injections (i.e., ten consecutive injections once every other day; 1 mg/kg) produced a moderate Fra expression but failed to induce detectable Fos expression. Western blot analysis further showed a transient expression of 72-kDa Fos proteins following a single MK-801 injection and a prolonged expression of 46- and 43-kDa Fra proteins after either a single or multiple MK-801 administration. The delayed onset and prolonged expression of these Fra proteins suggest that they may be DeltaFosB. The possible relevance of these results to clinical psychotomimetic effects of the NMDA receptor antagonists phencyclidine and ketamine is discussed.

We report the epitaxial growth of europium-activated yttrium oxide (Y2O3:Eu) (001) thin films on LaAlO3 (001) using laser ablation deposition at a substrate temperature of 775 °C and 10 Hz pulse repetition rate. The orientation relationship between the films and the substrates is [110]Y2O3∥[100]LaAlO3 and [−110]Y2O3∥[010]LaAlO3 which results in a lattice mismatch of only 0.8%. Transmission electron microscopy (TEM) of the films reveals the single crystalline Y2O3:Eu thin film to contain small pores. Scanning transmission electron microscopy (STEM) imaging of the films shows the substrate always terminates with the Al sublattice. Moreover, the STEM reveals that no precipitates of Eu had formed in the films.

Lymphokines including IL-2, IL-4, and IL-6 are involved in the induction of Ig production by activated B cells. We have investigated the role of protein kinases in IL-6-induced IgM secretion by SKW6.4 cells, an IL-6 responsive B cell line. IL-6-stimulated IgM production was inhibited by elevated intracellular cAMP induced either by the addition of dibutyryl cAMP or cholera toxin. The inhibitory effect of elevated intracellular cAMP was blocked by n-(2-(Methylamino)ethyl)-5-isoquinolinesulfonic dihydrochloride (H8), an inhibitor of protein kinase A. H8 did not affect IgM secretion induced by IL-6. In contrast, the addition of 1-(5-isoquinolinesulfonyl)-2-methylpiperizine dihydrochloride (H7), an inhibitor of protein kinase C activity, markedly inhibited IL-6-stimulated IgM production by SKW6.4 cells. H7 and elevated intracellular cAMP inhibited IgM mRNA expression and subsequent IgM synthesis by SKW6.4 cells. SKW6.4 proliferation, as determined by [3H]thymidine incorporation, was not markedly affected by IL-6, dibutyryl cAMP, cholera toxin, H7 or H8. PMA, an activator of protein kinase C, directly stimulated significant IgM secretion by SKW6.4 cells. When added to PMA-stimulated SKW6.4 cells, IL-6 stimulated additional IgM production. This observation suggested that IL-6 could stimulate differentiation without activating protein kinase C. This was confirmed by demonstrating that IL-6 did not stimulate production of diacylglycerol, did not induce the translocation of protein kinase C from the cytosolic compartment to the plasma membrane and could induce SKW6.4 cells to produce IgM after depletion of their cellular protein kinase C by PMA. Taken together these results suggests that IL-6-stimulated IgM production requires utilization of an H7-inhibitable protein kinase that can be inhibited by a protein kinase A-dependent pathway. Despite the fact that PMA can stimulate IgM production in SKW6.4 cells, IL-6 appears to use a protein kinase pathway other than protein kinase C to induce IgM production.

OBJECTIVE:To introduce double-contrast arthrography of TMJ with reformatted sagittal and coronal CT imaging and to evaluate the value of its application in the diagnosis of temporomandibular joint dysfunction. METHODS: 14 patients in whom diagnosis can not be established with conventional arthrography were examined by double contrast arthrography with reformatted sagittal and coronal CT imaging. RESULTS: In double-contrast arthrography with CT imaging, 1 case was normal;1 case had anterior displacement with reduction;2 cases were anterior displacement without reduction, and 8 cases were with disk adhesion. CONCLUSION:The double contrast arthrography with reformatted sagittal and coronal CT imaging was a very important alternative to conventional arthrography, and has special value to demonstrate adhesion of TMJ.

OBJECTIVE:To evaluate the role of CT in the diagnosis of temporomandibular joint dysfunction MATERIAL: 48 temporomandibular joints of 26 patients suspecting osseous changes were examined by CT, with 1mm of layer thickness. All patients had Sch llers position projection as comparison. RESULTS:CT is more sensitive to detect the osseous changes of TMJ than Sch llers position projection, but not well demonstrating sclerosis of TMJ. The Sch llers position projection can only shows the lesion of lateral 1/3 of condyle, but CT including total condyle. CONCLUSION: CT is an important and sensitive tool in detecting osseous changes of temporomandibular joint.

OBJECTIVE:To compare the results of CT-assisted double-contrast arthrography and MRI in the diagnosis of adhesion of TMJ. MATERIAL:18 patients with adhesion of TMJ were examined by CT-assisted double-contrast arthrography and MRI, and their results were analysed including position, degree and with or without osseous changes. RESULTS:18 cases of adhesion were demonstrated on CT-assisted double-contrast arthrography, and that only 6 cases of them were diagnosed on MRI.CONCLUSION: CT-assisted double-contrast arthrography is more sensitive and accurate than MRI in demonstrating the disk adhesion of TMJ.

To evaluate the embolization of arteriovenous malformations of the maxillofacial region with PVA.8 cases (male:3, female:5) of arteriovenous malformations of the maxillofacial region comprised this study group. The embolic material used was PVA (Polyvinyl Alcohol Foam) particles (250-500 microm) injected using 4.0 to 3.0 French-size catheters, catheterized selectively in the feeding pedicles of the AVM under the guidance of DSA machine (PHILIPS V3000).Five patients were embolized an a single session, and three patients needed two sessions. Immediate angiographical results showed total disappearance of the AVMs in all patients. Swelling, pulsation, and bruit were disappeared after embolization. Pericoronal oozing of blood and acute arterial bleeding was controllable. Local pain, swelling,and low-grade fever usually lasted from 3 to 7 days after embolization.The embolization of arteriovenous malformations of the maxillofacial region with PVA is effective and safe, and the longer follow-up is expected.

To evaluate the vascular architecture of AVM of jaws on DSA.12 cases of AVM of jaws comprised this study group, and 5 cases in maxilla and 7 cases in mandible, respectively. Seldinger technique was applied to carry out carotid angiography under the guidance of DSA machine (PHILIPS V3000).The DSA features of AVM of jaws included varix into the posterior area of jaws. The varix of the maxilla was supplied by the posterior superior alveolar artery and transversal facial artery when the soft tissue was involved, and the varix of the mandible was supplied by the inferior alveolar artery, maxillary and facial artery.Angiography is considered necessary for the diagnosis and embolization of AVM of jaws, and the varix is the center of lesion.

To evaluate the diagnostic value of CT for arteriovenous malformations (AVM) of jaws.12 cases of central vascular malformations of jaws comprised this study group, 5 cases in maxilla and 7cases in mandible, respectively. The X-ray projection included panoramic radiography, Water's position and posterioanterior and lateral oblique view of mandible. The CT scans were obtained on Somatom ART and the axial and coronal scanning modalities were applied.Radiographically different signs of the AVM of jaws were demonstrated, X plain film has no pathognomic features. The CT features included lytic expansion of bone, expanded space of marrow, obliteration of trabeculae and intact cortex of jaws. These signs were demonstrated very well in bone window setting. There were three forms of demonstrations of AVM of jaws as following: (1) local unilocular, (2) diffused unilocular, (3) multilocular.CT is helpful for early diagnosis of AVM of jaws, and can provide the guidance for the direct puncture embolization.

To report our experience to embolize the AVM of jaws by direct percutaneous puncture. in conjunction with endovascular therapy.3 cases of AVM of mandible and 3 cases of AVM of maxilla comprised this study group. The patients were embolized with fibered coils, PVA and NBCA. The coils were placed directly into the center of the intraosseous lesion. The procedure was under the guidance of DSA machine (PHILIPS V3000).The acute arterial bleeding in 4 patients was controllable. The other two cases with oozing bleeding and a warm soft mass on the left face with a palpable pulse respectively, their symptoms and signs got improved a lot. The pericoronal oozing of blood in all patients disappeared during a 3 to 24 months follow-up and new bone formation was found in the follow-up radiography.The embolization of the AVM of jaws by direct percutaneous puncture in conjunction with endovascular therapy is effective and safe, however the longer follow-up is expected.

High saturation magnetization and magnetic anisotropy are helpful for getting a high frequency electromagnetic microwave absorption performance. The α- Fe possesses a high saturation magnetization. Fe - B phases exhibit a relatively higher magnetic anisotropy and higher resistivity than α- Fe simultaneously. In this work, we made nanocrystalline powders of Fe 82 B 17 Cu 1, mainly consisting of α- Fe and Fe 2 B phases, by ball milling and post-annealing. Electromagnetic microwave characterization shows that Fe 82 B 17 Cu 1 powders possess a relative high permeability and considerable permittivity. Due to a good electromagnetic impedance matching, a good electromagnetic microwave absorption property (RL < -35 dB) has been achieved at 3.6 GHz. The experimental frequency and the matching thickness are coincident with the quarter wavelength matching condition.

Grapevine leafroll disease (GLD) is one of the most important diseases of grapevines worldwide. Nine serologically distinct viruses in the Closteroviridae family are associated with GLD. Previous studies reported that Grapevine leafroll-associated virus (GLRaV) -1, -2, -3, and -7 were present in grapevines in China with GLRaV-1 and -3 the predominant viruses associated with GLD (1). To confirm if GLRaV-4 and -5 were also present in China, 36 dormant canes from individual vines of 29 cultivars that showed GLD leaf symptoms during the growing season were collected from the germplasm collection plot of the Research Institute of Pomology, Chinese Academy of Agricultural Sciences. Total RNA extracted by a silica capture protocol (2) from phloem-enriched bark of 36 samples was tested separately for GLRaV-4 and -5 by reverse transcription (RT)-PCR using virus-specific primers. Primers LR4F (5′-ACATTCTCCACCTTGTGCTTTT-3′) and LR4R (5′-CATACAAGCGAGTGCAATTAC-3′) (4) were used to amplify a 321-bp fragment corresponding to a partial region of the HSP70 gene from GLRaV-4. One sample from cv. Autumn Royal was infected by GLRaV-4. The amplicon was cloned and a single clone was sequenced (GenBank Accession No. GQ246624) that showed 99% nucleotide identity with a corresponding region of a GLRaV-4 isolate from the United States (Accession No. AF039553). Since antiserum specific to GLRaV-4 was unavailable, a second pair of primers, LR4CP-F (5′-GGTGTCCAGCGCTTCCAA-3′) and LR4CP-R (5′-GCCAGAGAAGCATCGTAA-3′), was designed on the basis of the sequence of GLRaV-4 from Chile (Accession No. EU746620) that amplified a 300-bp fragment specific to the coat protein gene of GLRaV-4. The amplicon was cloned and a single sequence (Accession No. GQ479041) was compared with a corresponding nucleotide sequence of GLRaV-4 from Chile (Accession No. EU746621) showing 99% identity. A sample from cv. Malaga Rose was positive when tested by ELISA with antibodies specific to GLRaV-5 (Neogen Europe, Ltd. Scotland, UK) and this was confirmed by amplification of a 690-bp fragment corresponding to the GLRaV-5 coat protein gene using virus-specific primers LR5F (5′-CCCGTGATACAAGGTAGGACA-3′) and LR5R (5′-CAGACTTCACCTCCTGTTAC-3′) (3). The amplicon was cloned and a single clone was sequenced (Accession No. GQ246625) that showed 95% nucleotide identity with the CP gene sequence of GLRaV-5 from Argentina (Accession No. EU815935). To our knowledge, this is the first report of GLRaV-4 and -5 in grapevines in China. Confirmation of these viruses in China is very important for producing virus-free plants and this information also will be helpful in developing a multiplex RT-PCR assay to simultaneously detect multiple GLRaVs and helpful with studies on the molecular variability of these viruses. References: (1) Y. Dong et al. China Fruits 6:9, 2005. (2) X. Foissac et al. Acta Hortic. 550, 37, 2001. (3) X. Good and J. Monis. Phytopathology 91:274, 2001. (4) F. Osman et al. J. Virol. Methods 141:22, 2007.

Lymphocyte beta-adrenergic receptor function of 20 depressed patients and 18 healthy volunteers were measured using radioligand binding technique. It was found that the affinity and sensitivity of this receptor were significantly higher in endogenous depressed patients than those in normal controls. After the electro-acupuncture-treatment (EAT), lymphocyte beta-receptor function decreased in patients who responded well to EAT, but still not reached normal level.

There has been intense interest in preparing single crystalline yttrium oxide (Y2O3) thin films for applications in ultra-large scale integration (ULSI) gate insulators, ULSI capacitors, and, by addition of suitable dopant species, for electroluminescent devices. Y2O3 has a C-type rare-earth sesquioxide structure, closely related to the fluorite structure with a cell parameter a= 1.060 nm and space group Th (Ia3). LaAIO3 (LAO) is a rhombohedral structure with lattice parameters a = 0.378 nm, θ ≤ 90.5°. The lattice mismatch with the direction of the YO is therefore less than 0.8%, and so we would anticipate epitaxial growth of single crystalline YO thin films on the LAO (001) substrate to be feasible. Eu activated YO thin films were deposited by laser ablation on (001) LAO substrates. TEM bright field images and electron diffraction patterns were recorded in a Philips EM-400 electron microscope operated at lOOkV. Z-contrast imaging was conducted in a VG HB603 STEM at 300kV. In this presentation, we will report the epitaxial growth of YO thin films doped with ∼ wt 4% Eu on a LaAlO3 substrate, and the atomic structure of the interface.