Search

BackgroundRecombinant uricase such as pegloticase are indicated for chronic gouty arthritis who have failed to achieve serum urate level ObjectivesTo evaluate the efficacy and safety of low-dose rasburicase in refractory chronic gouty arthritis.MethodsWe retrospectively collected data of 17 patients with refractory chronic gouty arthritis who were treated with rasburicase from January 2021 to September 2021 at Sun Yat-sen Memorial Hospital, Sun Yat-sen University. The refractory chronic gouty arthritis was defined as serum urate level was still more than 300μmol/L and dual-energy CT showed the volume of urate more than 10 cm3, even though the allopurinol, febuxostat, and/or benzbromarone of the maximum tolerable amount were received for more than 3 months. Rasburicase was added every four weeks (week 0, week 4, and week 8) with a dosage of 1.5 mg/d for three consecutive days, on the basis of daily oral urate-lowering drugs of the maximum tolerable amount. The serum urate level was monitored. The primary outcome was the change in urate volume at week 12 compared to week 0 by dual-energy CT.Results① Seventeen patients were recruited with 16 males (94%) and mean age 47±15 years old. The median gout course was 11 (6.5, 15) years with gout flares number 20 (11, 36) times in the previous year. At week 0 before the rasburicase add-on treatment, the mean serum urate was 652±94μmol/L and the median urate volume was 44 (21, 215) cm3 (Table 1). ② Urate level after the rasburicase add-on treatment was significantly decreased than that before the treatment either at week 0, week 4, or week 8 (Figure 1A, all p< 0.001). The median reduction of serum urate were 565 (446, 621) at week 4, 214 (57, 373) at week 8, and 118 (21, 185) at week 12 (all p3 (pr=0.890, pr=-0.689, p=0.002). ④ Rasburicase was generally well tolerated. No gout attack occurred on the basis of intravenous methylprednisone 20mg before each rasburicase add-on treatment and oral colchicine 0.5mg/d to 1mg/d. No hypersensitive reaction occurred during the treatment. Phlebitis occurred in a patient (6%), while dizziness and nausea occurred in two patients (13%). One patient (6%) who was suffering chronic kidney disease of stage 3 developed acute kidney injury after rasburicase injection at week 0 and week 8, but the serum creatinine spontaneously returned to the baseline level during follow-up.Figure 1.The serum urate and urate volume before and after rasburicase add-on treatment. A: Paired comparison of serum urate level before and after each time of rasburicase administration; B. Reduction value and percentage of urate volume at week 12 for each patient. C&D: Dual-energy CT (DECT) showed a dramatical reduction in urate volume from week 0 (C, urate volume: 72.15 cm3) to week 12 (D, urate volume: 7.66 cm3). ***: p< 0.001; #: Received rasburicase at week 0 only; ##&###: Received rasburicase 7.5mg at week 0.ConclusionThis pilot study shows rasburicase is well tolerated in patients with refractory chronic gouty arthritis and may be a reasonable option to effectively lower the urate burden of these patients, although this is an off-label use. Further prospective randomized controlled studies to verify the efficacy and safety are needed.FundingThis study was funded by Yat-sen Clinical Research Project.Disclosure of InterestsNone declared

Erdheim-Chester病（Erdheim-Chester disease，ECD）是一种罕见的非朗格汉斯细胞组织细胞增生症，其临床表现异质性高，从无症状骨病变到危及生命的多脏器功能衰竭均可出现。本文报道1例以全身骨痛、心包积液、肺内结节为主要表现并经骨骼病理确诊的ECD，经干扰素α治疗后患者全身骨痛缓解且C反应蛋白水平下降。.

Background:Cholesterol crystal embolism (CCE) syndrome is a multisystemic disorder caused by small arteries cholesterol crystal emboli subsequent to small pieces of atheromatous plaques from the aorta or other major arteries break off. CCE is often overlooked because it mimics symptoms of systemic vasculitis due to its clinical characteristics such as ulceration and gangrene of toes, livedo reticularis, renal insufficiency. Acute inflammatory reactants such as ESR, CRP may elevate in CCE patients since the cholesterol crystals trigger a foreign-body inflammatory reaction around the arterioles.Objectives:This study aimed to explore the clinical characteristics of CCE patients, to make rheumatologists learn more about this disease.Methods:Peer-reviewed articles in the electronic databases Medline, PubMed, Science Citation Index, China Biomedical Literature Database (CBM), China Journal Full Text Database (CNKI), and WANFANG Data were searched using the terms “cholesterol crystal embolism syndrome”, “cholesterol embolism”, “atherosclerotic embolism”, “atherosclerotic nephropathy”, or “CCE”. Only articles or case reports containing detailed medical records of CCE patients were included. We also included CCE patients in our department.Results:A 66-year-old male CCE patient presented with multiple ulceration and gangrene of toes and heels (Figure 1), subacute renal insufficiency, and elevated CRP and ESR. This patient had been considered as “suspected systemic vasculitis” and was referred to our rheumatology department. Another 39 Chinese CCE patients from the above databases were qualified for analysis. Among these 40 patients, 87.5% (35/40) were male and the mean age was 68±6 years. The most common involved was kidney and 90% (36/40) of patients presenting with renal insufficiency including the progressive increase of serum creatinine, hematuria, proteinuria, or sudden (or sharp) aggravation of hypertension. Next common involved was skin that occurred in 87.5% (35/40) of patients, especially in the toes and heels. For skin manifestations, blue toe syndrome occurred in 82.5% (33/40) of patients, ulceration or gangrene in 25% (10/40), and livedo reticularis in 15% (6/40). Additionally, 12.5% (5/40) showed ocular involvement such as visual impairment and visual field defect. In 2 patients, embolized cholesterol crystal in retinal arteries that is called Hollenhorst plaques was detected by fundoscopy. There were 62.5% (25/40) of patients having elevated CRP or ESR. The positive rate for skin or subcutaneous biopsies was 58% (11/19) and for kidney biopsies was 100% (6/6). The precipitating factors preceding the occurrence of classical symptoms such as blue toe syndrome, livedo reticularis and/or subacute renal insufficiency is important for CCE diagnosis especially for patients who had contraindications or were intolerant to biopsy. The precipitating factors include endovascular intervention (80%), vascular surgery (5%), and anticoagulant or thrombolytic therapy (2.5%). Only 12.5% (5/40) of patients were spontaneous and didn’t have any predisposing factors. General interventions of CCE included statins (82.5%), antiplatelets (32.5%), and dialysis (32.5%). Twelve patients (30%) received glucocorticoids and 75% (9/12) of them renal function improved and ulceration healed (Figure 1). Among 36 patients who presented with renal insufficiency, the renal function returned to normal after treatment in 2 patients (5.6%), but 27 patients (75%) still showed abnormal renal function even though somewhat improved, and 7 patients (19.4%) needed renal replacement therapy or dialysis for maintenance.Conclusion:This study reported CCE patients had high prevalence of renal insufficiency, blue toe syndrome, and ulceration or gangrene of toes, as well as elevated CRP or ESR, thus rheumatologists should be alert to this disease as one of the differential diagnosis of systemic vasculitis, especially for elderly patients with evidence of atherosclerosis who undergo a recent cardiovascular procedure.Disclosure of Interests:None declared

Background:Passive transfer of ANA and anti-SSA has been reported in patients with common variable immunodeficiency disorder who received intravenous immunoglobulin (IVIG). IVIG is also recommended to treat some special or life-threatening rheumatic diseases.Objectives:This study was aimed to explore whether any extractable nuclear antibodies (ENAs) were transferred to these rheumatic patients who received IVIG therapy.Methods:IVIG products of three batches were tested for ANA by using indirect immunofluorescent assay, and for ENAs by using line immunoassay (LIA) and chemiluminescence immunoassay (CLIA). These IVIG products were administrated to rheumatic patients at a dose of 20g/d×3 days (day1 to day3). Serum samples of these patients before IVIG (day0) and after IVIG (day4, day8, day10, day12, and more than one month) were tested by using LIA and CLIA. Anti-SSA was also detected using ELISA.Results:In these IVIG products, ANA was positive at a titer of 1:640 (cytoplasmic speckled) and 1:80 (speckled). Among 14 types of ENAs that could be tested using LIA, anti-SSA, anti-Ro52, anti-mitochondrial M2, and anti-centromere B antibodies were clearly detectable in IVIG products (Table 1). Likewise, another assay CLIA also detected the same positive autoantibodies in these products. LIA showed the highest concentration in anti-mitochondrial M2, while CLIA showed the highest concentration in anti-mitochondrial M2 and anti-Ro52. One 31-year-old male patient who was diagnosed as SLE (Figure 1) and one 72-year-old male patients who was diagnosed as necrotizing myositis received these IVIG products. Anti-SSA, anti-Ro52, anti-mitochondrial M2, but not anti-centromere B, were positive in the day4 serum samples, although all of these antibodies were negative at baseline (day0). The concentration of these antibodies decreased gradually as days passed and became undetectable around one month after IVIG.Table 1.The concentration of autoantibodies in intravenous immunoglobulin productsanti-SSAanti-Ro-52anti-mitochondrial M2anti-centromere BCut-offLIA(grey value)20±328±369±1019±4≥11CLIA (U/ml)333±107444±86434±66390±89>20ELISA (U/ml)90±13NANANA>20LIA, line immunoassay; CLIA, chemiluminescence immunoassay; ELISA, enzyme linked immunosorbent assayConclusion:This study preliminarily reported transient positivity of anti-SSA, anti-Ro52, and anti-mitochondrial M2 in rheumatic patients maybe because the passive transfer of these antibodies from IVIG products to the patients, although the potential influence of this transfer on the rheumatic diseases remained unknown.Figure 1.The concentration of autoantibodies in a 31-year-old male SLE patient receiving intravenous immunoglobulin at a dose of 20g/d×3 days (day1 to day3). Serum samples of these patients before IVIG (day0) and after IVIG (day4, day8, day10, day12, and day51) were tested by using line immunoassay (LIA) and chemiluminescence immunoassay (CLIA). Anti-SSA was also detected using ELISA. The horizontal red lines were the corresponding cut-off values of each assay.Disclosure of Interests:None declared

Background Gout incidence increases in a linear fashion with age until 70 years. It was reported that there was a trend of earlier gout onset. Few studies about clinical features of early-onset gout in China are reported. Objectives To investigate the characteristics of early-onset gout in south China. Methods Patients with primary gout were recruited between June 2012 and December 2016. Face to face interview was carried out to collect demographic information, clinical characteristics of gout and comorbid diseases. The patients with gout onset before age 30 were defined as early-onset group. The other gout patients were enrolled as control group. Results (1) Five hundred and one gout patients were recruited, including 99 (19.8%) in the early-onset group and 402 (80.2%) in the control group. The onset age of the early-onset group was 24.2±5.8 (range 14–30) and the control group was 51.7±13.9 (range 31–84). There was no significant difference of gout duration between early-onset group and control group (P 10mg/dl (P Conclusions Early-onset gout exhibited higher sUA and was associated with obesity but not with hypertension, diabetic mellitus and renal insufficiency. Longer disease duration and lower BMI were associated with tophi in the early-onset gout patients. Acknowledgements The present study was supported by Guangdong Natural Science Foundation, China (Grant no. 2014A030310086) to Qian-Hua Li. Disclosure of Interest None declared

Background Methotrexate (MTX) serves as an anchor drug in rheumatoid arthritis (RA) and the maximal dose of MTX from EULAR recommendation is 25–30 mg/w. Small cases retrospective cohort studies reported that the mortality rate of RA patients with low dose (5–25 mg/w) MTX-induced myelosuppression was about 17–25%. However, studies of low dose MTX-induced myelosuppression are rare in Chinese RA patients. Objectives To perform a retrospective case series analysis of the characteristics and outcomes of RA patients with low dose MTX-induced myelosuppression in China. Methods RA patients hospitalized at Sun Yat-Sen Memorial Hospital from January 2001 to December 2016 were recruited. Clinical data were collected and adverse effects were recorded simultaneously. Low dose MTX-induce myelosuppression was diagnosed as white blood cell Results (1) There were 1137 RA patients recruited and 17 patients (1.5%) of them were hospitalized for low dose MTX-induce myelosuppression. Among these 17 patients, 53% were females, age was 68±5 years, disease duration was 12±11 years. (2) Four (23.5%) patients had dose errors, taking MTX 5–10mg daily for 24 days (range: 5–80), MTX accumulated dose was 25–200mg before myelosuppression. Mean MTX dose in the other patients (n=13, 76.5%) was 11.0±1.7 mg/w (range: 7.5 –15), course of MTX was 10±11 months (range: 0.5–48). Four (30.8%) patients manifested myelosuppression within the first month after taking MTX, and 4 (30.8%) patients had been well on a stable drug dose (7.5–12.5) for more than one year before myelosuppression, 2 patients manifested myelosuppression after adding MTX dose to 15mg/w for 2 months. (3) Fifteen (88.2%) patients had oral mucositis, eight of them had involvement of both oral mucosa and skin. Fever was noticed in 10 (58.8%) patients. Infections were recorded in 6 (35.3%) patients, manifested as pneumonia (n=4), sepsis (n=1), urinary tract infection (n=1) and skin soft tissue abscesses (n=1). Two patients experienced abdominal pain and melena. (4) Among the patients with neutropenia [n=17, mean neutrophil count: (0.74±0.76)×109/L, range: 0–1.83], 9 (52.9%) developed severe neutropenia with neutrophil counts below 0.5×109/L. Five patients developed severe thrombocytopenia (platelet count (5) Pancytopenia recovered (n=17) after discontinuation of MTX and supplementation of folic acid (10–30mg/d). Only 3 (17.6%) patients were treated with rescue intravenous leucovorin. Thirteen (76.5%) were treated with granulocyte colony stimulating factor (G-CSF) and 7 (41.2%) required blood products. Fifteen (88.2%) required antibiotic therapy. Sixteen (94.1%) patients was recovered and discharged, only one patient die from acute brainstem infarction but not from myelosuppression. Conclusions Older age, hypoalbuminaemia and renal failure might be poor prognosis factors for low dose MTX-induce myelosuppression in RA. Disclosure of Interest None declared

LaMeOx/SBA-15 (Me = Zn, Co and Fe) desulfurizers were synthesized by a sol–gel method and their performance for H2S removal from hot coal gas was investigated. The results of eight successive desulfidation–regeneration cycles revealed that the LaFeO3/SBA-15 desulfurizer shows high performance and stability for H2S removal. The results of BET, XPS, HRTEM and XRD characterization suggested that the SBA-15 structure of used LaMeOx/SBA-15 remained intact. It was found that there is only partial reduction of Fe3+ ions in LaFeO3/SBA-15 by hydrogen in hot coal gas, a factor considered to be favorable for LaFeO3/SBA-15 sulfidation. The metal oxides supported on SBA-15 can effectively suppress mechanical disintegration and improve stability of LaMeOx/SBA-15. Among the three desulfurizers, LaFeO3/SBA-15 performs the best.

The spectral data of different grades flue-cured tobacco sample have been determined by UV spectrometer. Their differences were compared. The spectral prediction models of nicotine content were established through correlation analysis between the content of nicotine and spectral data of flue-cured tobacco with the stepwise multivariate regression method. The statistical results showed that the nicotine content of flue-cured tobacco were very significantly correlated to their UV spectrum. There were also very significantly correlations between the predicted and experimental values. This indicates that it would be feasible to estimate the nicotine content in flue-cured tobacco by UV spectroscopy and UV spectroscopy can be used to determine conveniently and quickly nicotine content of flue-cured tobacco leave samples without pollution.

Background Urolithiasis greatly impact urate lowering therapy in Chinese gout patients. Benzbromarone is contraindicated and Chinese is high risk of allopurinol hypersensitivity syndrome. Febuxostat is too expensive for many patients. Few study about urolithiasis in Chinese gout patients are presented. Objectives To investigate the prevalence and risk factors of urolithiasis in south Chinese gout patients. Methods Patients with primary gout were recruited in the present cross-section study. Urolithiasis was defined as positive stone history and/or ultrasonography. All inpatients with estimated glomerular filtration rate (eGFR) over 30 ml/min/1.73 m 2 underwent 24 hours urinary chemistry assay including uric acid (UA), UA concentration, clearance of UA, Cr, calcium, phosphorus, potassium, sodium and chloride. Logistic regression were performed to examine association of urolithiasis with independent variables including age, gender, duration of gout, sUA, previous urate lowering therapy, serum creatinine, eGFR, body mass index, urine pH and 24 hours urinary chemistry assay. Results (1) Two hundred and nighty-four patients were recruited. Mean age of male (N=255) and female (N=39) were 54.4±16.4 and 67.2±15.3, respectively. Average serum UA was 9.0±2.5mg/dl and 25.9% of patients presented tophi. Allopurinol, benzbromarone, or a combination of these two drugs had been prescribed in 97 patients (33.0%), 18 patients (6.1%) and 36 patients (12.2%), respectively. The rest 143 patients (48.6%) had not received urate lowering therapy before. (2) One hundred and eleven gout patients (37.8%) complicated with urolithiasis and urolithiasis was observed in 69 of them (62.1%) on ultrasonography. Compared with non urolithiasis group, urolithiasis group had significant higher serum creatinine (1.6±0.6 VS 1.3±0.3 mg/dl], lower eGFR (56.3±18.0 VS 64.1±18.4 ml/min/1.73m 2 ) and higher alcohol overuse (38.7% VS 26.2%) (P Conclusions Prevalence of urolithiasis in Chinese gout patients were high and predicted by excess urinary UA concentration and urinary calcium excretion. Acknowledgement The present study was supported by Guangdong Natural Science Foundation, China (Grant no. 2014A030310086) to Qian-Hua Li. Disclosure of Interest None declared

Background Current recommendations for rheumatoid arthritis (RA) management emphasize treat-to-target strategies which reduce joint destruction. However, recent studies showed radiographic progression even in remission RA patients and novel predictors were required. Objectives To evaluate clinical, serological and radiographic indicators in predicting radiographic progression in RA patients achieved therapeutic target. Methods Patients with active RA (SDAI >11.0) were treated according to recommendations and followed up at 1st, 3rd, 6th, and 12th months. Serum matrix metalloproteinase (MMP) 3 was detected by ELISA and clinical data was collected simultaneously at baseline and each visit. X-ray assessment of hand/wrist was repeated and radiographic progression was defined as the increase of total Sharp score more than 0.5 from baseline to one year. Patients who achieved therapeutic target at 6th month were included in the analysis. Results (1) Fifty-six patients were recruited and fulfilled 1-year follow-up. Forty-two (75%) of them achieved therapeutic target at 6th month. Among the 42 patients, 71% were female, age (median and IQR, similarly hereinafter) was 49 (38–56) years, disease duration was 18 (12–72) months, SDAI at baseline was 26.5 (14.5–37.4), and 62% were treated with csDMARDs while 38% were treated with bDMARD. Eleven (26%) of them had radiographic progression at 12th month. (2) Among the clinical indicators, serum MMP-3 and Sharp score at baseline, multivariable stepwise logistic regression showed that high level of baseline Sharp score was a significant predictor of 1-year radiologic progression (OR=1.045, 95%CI: 1.001–1.091, P =0.045). ROC curve analysis showed that the tradeoff value of baseline Sharp score for predicting 1-year radiographic progression was 15 with positive predictive value (PPV) 58% and negative predictive value (NPV) 87% (AUC=0.740, 95%CI: 0.562–0.919, P =0.019, Fig 1B). (3) Serum MMP-3 decreased to normal at 6th month in half non-progressive patients but continually elevated throughout 12 months in progressive patients, while SDAI showed similar decreasing between non-progressive and progressive groups (all P >0.05, Fig. 1A). Univariate logistic regression analysis showed that elevated serum MMP-3 at 6th month was a significant predictor for 1-year radiographic progression in RA patients (OR=1.006, 95%CI: 1.001–1.011, P =0.010). ROC curve analysis showed that the tradeoff value of serum MMP-3 at 6th month for predicting 1-year radiographic progression was 161 ng/ml with PPV 67% and NPV 90% at 6th month (AUC=0.789, 95%CI: F0.612–0.965, P =0.005, Fig. 1B) (4) According to the tradeoff value of Sharp score and serum MMP-3 above, ROC curve analysis showed that the PPV and NPV of combination of baseline Sharp score and serum MMP-3 at 6th month for predicting 1-year radiographic progression was 61% and 100% (AUC=0.887, 95%CI: F0.789–0.985, P Conclusions Our results implied that combination of baseline Sharp score and dynamic serum MMP-3 might be helpful in predicting radiographic progression in RA patients achieved therapeutic target. Acknowledgements This work was supported by National Natural Science Foundation of China (81471597) and Specialized Research Fund for the Doctoral Program of Higher Education (20130171110075). Disclosure of Interest None declared

Background Rheumatoid arthritis (RA) is an autoimmune disease which leads to bone destruction. RA synovium secretes large amounts of matrix metalloproteinase (MMP) 3 which plays essential role in degradation of extracellular components and cartilage. Several studies reported that serum MMP-3 correlated with radiographic progression. However, little was known about the relationship of synovial MMP-3 and radiographic progression. Objectives To explore the correlation of synovial MMP-3 and radiographic progression in RA. Methods Patients with active RA were recruited and followed up at 1st, 3rd, 6thand 12th months. Serum MMP-3 was detected by ELISA and clinical data was collected simultaneously at baseline and each visit. X-ray assessment of hand/wrist was repeated and radiographic progression was defined as the increase of total Sharp score more than 0.5 from baseline to one year. Synovial tissues were obtained at baseline and serial tissue sections were stained with H&E and immunohistochemically for MMP-3, CD3, CD20, CD38, CD68and CD15. Krenn9s synovitis score was assessed semi-quantitatively and the density of positive-staining cells were quantitatively determined. Results (1) Twenty-six patients fulfilled 1 year follow-up, 81% were female, age (median and IQR, similarly hereinafter) was 49 (39–58) years, disease duration was 24 (12–66) months, disease activity SDAI was 36.3 (24.0–48.1), and 54% were treated with csDMARDs while 46% were treated with bDMARD. (2) Eight (31%) patients had radiographic progression at 12th month. Histopathological analysis showed that subscore of lining hyperplasia, percentage of lining MMP3+ cells and sublining CD68+ macrophage count were significantly higher in progressive patients than non-progressive patients (all P P =0.044, OR =1.117, 95% CI: 1.003 to 1.244). ROC curve analysis showed that the tradeoff value of synovial MMP-3 for predicting 1-year radiographic progression was 49% with sensitivity 63% and specificity 83% (AUC=0.785, 95%CI: 0.595–0.975, P =0.023). (3) Patients were divided into high ( n =9) or low synovial MMP-3 groups ( n =17) according to the tradeoff value. Serum MMP-3 at baseline was significantly higher in high synovial MMP-3 group than that in low synovial MMP-3 group [440 (246–609) ng/ml vs 152 (69–316) ng/ml, P =0.016], and the percentage of synovial MMP3+ cells positively correlated with serum MMP-3 at each visit ( r =0.537–0.592, all P (4)SDAI in both groups decreased during follow-up and showed no significant difference at each visit (all P >0.05, Fig. 1B). However, Fisher exact test showed obvious tendency that the percentage of progressive patients in high synovial MMP-3 group (55.6%) was higher than that in low synovial MMP-3 group (17.6%, P =0.078, Fig. 1C). Conclusions Our results implied that synovial MMP-3 may be a predictor of radiographic progression in RA. Acknowledgements This work was supported by National Natural Science Foundation of China (No.81471597), Specialized Research Fund for the Doctoral Program of Higher Education (No.20130171110075) and Guangdong Natural Science Foundation (No.S2013010014396). Disclosure of Interest None declared

Background Peroxisome proliferator-activated receptor-gamma coactivator-1beta (PGC-1β) is a transcriptional coactivator that plays important roles in regulating multiple aspects of energy metabolism and cytokine signaling pathways. We have reported that down-regulating PGC-1β alleviated the proinflammatory effect of rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLS). Recent study reported that osteoclast formation and bone resorption were markedly suppressed in PGC-1β knockout mice. However, the role of PGC-1β on the osteoclastogenesis in RA has not yet been illuminated. Objectives To investigate the effect and underlying mechanism of PGC-1β on RA-FLS induced osteoclastogenesis and bone resorption Methods Synovium was obtained from 3 active RA patients and cultured RA-FLS was identified by flow cytometry using CD55 antibody. RAW264.7, used as precursor of osteoclast, was cocultured with RA-FLS or human RANKL. Gene knockdown was performed by lentivirus short hairpin RNAs (sh-RNAs) which were cloned into pLKO.1 (GV248) lentiviral vectors. The sh-PGC-1β targeting sequence was GGAGGAGGAAGAAGAAGAATT, while sh-GFP was regarded as negative control. Culture supernatants containing sh-RNA were added to RAW264.7 in the presence of polybrene. Stable cell lines were validated by western blot. RAW264.7 transfected with sh-PGC-1β or sh-GFP was cocultured with RA-FLS in 6 well-plates with transwell plates. At day 14, osteoclasts were identified as multinucleated cells that contained >3 nuclei with positive staining of tartrate-resistant acid phosphatase (TRAP), and protein of RAW264.7 and osteoclasts was extracted for western blot determining the phosphorylation of ERK, JNK, p38 and NF-κB. At day 21, resorption lacunae area was identified by toluidine blue staining and measured by image analysis system. Results (1) Flow cytometry results showed the purity of cultured FLS was over 90%. TRAP staining showed osteoclast formation in both cocultrue system of RAW264.7 with RA-FLS or human RANKL. (2) The protein expression of PGC-1β in RAW264.7 transfected with sh-PGC-1β was hardly detected compared with negative control (Fig. 1C). At day 14, down-regulating PGC-1β of RAW264.7 cells could significantly decrease the number of osteoclasts compared with negative control [(1037±356) vs (237±110) per well, P=0.021, Fig. 1A]. At day 21, down-regulating PGC-1β of RAW264.7 cells could significantly inhibit the resorption lacunae area on bone slices compared with negative control [(25.33±6.50) % vs (10.67±5.51) %, P=0.041, Fig.1B]. (3) The protein expression of p-NF-κB from RAW264.7 and osteoclasts was significantly down-regulated in sh-PGC-1β transfected group than sh-GFP transfected group, but not p-ERK, p-JNK or p-p38 (Fig. 1C). Conclusions Our results implied that down-regulated PGC-1β could inhibit RA-FLS induced osteoclastogenesis and bone resorption by suppression of NF-κB activation. Acknowledgements Supported by Grant support was provided: National Natural Science Foundation of China (81471597), Specialized Research Fund for the Doctoral Program of Higher Education (20130171110075) and Guangdong Natural Science Foundation (S2013010014396). Disclosure of Interest None declared

Background The hepatitis B surface antigen (HBsAg) carrying rate of rheumatoid arthritis (RA) was 11.2% in China according to recent studies. HBV infection is a major issue in RA patients undergoing disease-modifying anti-rheumatic drugs (DMARDs) therapy. Iguratimod was a newer effective conventional DMARD, which was small molecular and approved in China in Augest, 2011. However, little was known about the influence of iguratimod to liver injury and HBV reactivation. Objectives To explore the influence of iguratimod on HBV reactivation in HBsAg/HBcAb+ RA patients and the influence on HBsAb titer in HBsAb+ RA patients. Methods Patients with active RA were enrolled from October 2013 to September 2014. All were treated with iguratimod (25mg Bid) alone or in combination with other conventional DMARDs for 24 weeks, such as methotrexate (MTX), leflunomide (LEF), etc. Adding with non-steroidal anti-inflammatory drugs (NSAIDs) or small doses of corticosteroids was permitted if constant pain observed. HBsAg+ RA patients were suggested to be treated with anti-virus therapy preventively. Liver function, HBsAg or HBsAb titer, and HBV-DNA load were evaluated at baseline, 12th and 24th week. HBV reactivation was defined as a 10-fold rise in HBV-DNA compared to baseline or HBsAg/HBeAg switch from undetectable to detectable. Results 1) Thirty-six patients with active RA were enrolled and 74% (29/36) were female, age (median and IQR, similarly hereinafter) was 49 (39–58) years, disease duration was 59 (23–81) months, and DAS28-CRP was 4.44 (3.96–5.75). Twelve patients received iguratimod monotherapy. 2) Patients with active RA were grouped according to serum HBV biomarkers, including chronic or past HBV infection group (HBsAg or HBcAb +, N=20) and free of HBV infection group (HBsAg and HBcAb -, N=16).There was no significance difference of transaminases (AST 18 (14–24) vs 17 (12–25), ALT 14 (12–30) vs 13 (8–22)) and DAS28 (4.82 (4.03–5.85) vs 4.28 (3.81–5.65)) of baseline (all P>0.05). 3) The chronic or past HBV infection group was divided into chronic HBV infection subgroup (HBsAg or HBV-DNA +, n=3) and past HBV exposed subgroup (HBcAb + but HBsAg-,n=17). In the chronic HBV infection subgroup, all refused antiviral prophylaxis, and 2 developed HBV reactivation without aminotransferases elevation in 10th and 24th weeks. In pass HBV exposed subgroup, 2 patients developed transient 3-times elevation of aminotransferases in 24th weeks. 4) In free of HBV infection group, none developed transaminases elevation. The changes of HBsAg and HBsAb has no statistical significance among baseline,12th and 24th weeks according to repeated measures analysis of variance ( F =0.795, P =0.472) and Wilcoxon Matched-Pairs Signed-Ranks Test (all P >0.05). Conclusions Active RA patients should be screened for liver function and HBV biomarker before iguratimod therapy. RA patients with HBV infection, especially with positive baseline HBV-DNA,were recommended to be treated with antiviral prophylaxis and monitor liver function and HBV-DNA load regularly. Acknowledgements This work was supported by National Natural Science Foundation of China (grant no. 81471597), Specialized Research Fund for the Doctoral Program of Higher Education (grant no.20130171110075) and Guangdong Natural Science Foundation (grant no.S2013010014396). Disclosure of Interest None declared

Background Hypoxia-inducible factor (HIF)-1α is a critical transcription regulator in cellular response to hypoxic condition. Hypoxic microenvironment exists in rheumatoid arthritis (RA) joints and we have reported that elevated HIF-1α promoted angiogenesis and inflammation in RA. Recent studies showed HIF-1α might promote osteoclast-mediated bone resorption in vitro. However, little was known about its role in RA joint destruction. Objectives To explore the correlation of synovial HIF-1α with joint destruction and its progression in RA. Methods Patients with active RA were followed up and X-ray assessment of hand/wrist was repeated at baseline and one year. Erosive disease was defined according to 2013 EULAR definition and radiographic progression was defined as the increase of total Sharp score more than 0.5 from baseline to one year. Synovial tissue was obtained from RA patients as well as OA and orthopedic arthropathies (Orth.A) patients. Serial tissue sections were stained with H&E, immunohistochemically for CD3, CD20, CD38, CD68, CD15, CD34 and HIF-1α. Krenn9s synovitis score was semi-quantitatively assessed and the density of positive-staining cells was quantitatively determined. Results (1) Twenty five RA patients fulfilled 1 year follow-up, 84% were female, age (median and IQR, similarly hereinafter) was 50 (40–57) years, disease duration was 24 (10–48) months and disease activity SDAI was 35.0 (25.3–46.3). (2) HIF-1α expressed in lining and sublining area with intense nuclear and endochylema staining in RA synovium and the percentage of HIF-1α+ cells [57% (31%–77%)] was significantly higher than that in OA [ n =13, 25% (9%–41%), P =0.022]or Orth.A [ n =8, 21% (12%–38%), P =0.021, Fig.1]. The percentage of HIF-1α+ cells significantly correlated with subscore of synovial stroma activation, CD34+ microvessel count, CD68+ macrophage count and CD15+ neutrophil count ( r =0.420–0.586, all P (3) Eleven (44%) RA patients had erosive disease at baseline. The percentage of HIF-1α+ cells was significantly higher in erosive patients than non-erosive patients [78% (49%–82%) vs 47% (23%–62%), P =0.014]. ROC curve analysis showed that the tradeoff value of synovial HIF-1α for diagnosing erosive disease was 69% with sensitivity 73% and specificity 100% ( AUC =0.792, 95% CI: 0.574–1.010, P =0.014). Patients were then divided into high (n=8) and low synovial HIF-1α (n=17) groups. Total Sharp score and erosion subscore were higher in patients with high synovial HIF-1α than that in patients with low synovial HIF-1α [33 (14–69) vs 10 (4–24), 18 (11–25) vs 3 (2–12), respectively, all P (4) Eight (32%) RA patients showed radiographic progression at one year. The percentage of HIF-1α+ cells was significantly higher in progressive patients than non-progressive patients [80% (58%–85%) vs 49% (18%–63%), P =0.018]. ROC curve analysis showed that the tradeoff value of synovial HIF-1α for predicting 1-year radiographic progression was 66% with sensitivity 75% and specificity 82% ( AUC =0.798, 95% CI :0.576–1.019, P =0.018). Univariate logistic regression showed that high level of synovial HIF-1α was a significant predictor of 1-year radiographic progression ( P =0.011, OR =14.00, 95% CI: 1.841 to 106.465). Conclusions HIF-1α might play important roles in the pathogenesis of joint destruction in RA. Acknowledgements This work was supported by National Natural Science Foundation of China (81471597). Disclosure of Interest None declared

Background Rheumatoid arthritis (RA) is a chronic inflammatory disease leading to joint destruction and disability. PPARγ coactivator (PGC) 1β is a transcriptional coactivator that regulates energy metabolism, which strongly upregulated by RANKL during osteoclast differentiation. Knockdown of PGC1β in vitro inhibited osteoclast differentiation, and global PGC1β deletion in mice resulted in increased bone mass. Increased expression of PGC1β protein led to the attenuation of macrophage-mediated inflammation. However, the expression and the pathophysiological role of PGC1β in RA are poorly understood. Objectives To determine the expression of PGC1β in peripheral blood monocytes (PBMs) and synovium from RA patients. Methods Synovium was obtained by needle biopsy from 12 patients with active RA, as well as 6 osteoarthritis (OA) and 3 orthopedic arthropathies (Orth.A) as “less inflamed” disease controls. Synovial PGC1β expression was determined by immunohistochemistry staining. PGC1β expression in primary cultured fibroblast-like synoviocyte (FLS) from RA or OA synovium was detected by immunofluorescence staining. PGC1β mRNA expression in PBMs from 16 patients with active RA and 14 age and gender matched healthy controls was detected by real-time PCR. Results (1) PGC1β expression in RA synovium was observed in lining layer and sublining area with intense nuclear staining in lining synoviocytes and sublining inflammatory cells (Fig 1A). Synovial PGC1β was over-expressed in RA patients compared with OA or Orth. A patients (Fig 1). (2) Immunofluorescence staining showed obviously higher expression of PGC1β in RA-FLS than in OA-FLS (Fig 2). (3) PGC1β mRNA expression in PBMs from RA patients was significantly decreased than that in healthy controls (0.60±0.68 vs 1.24±0.81, p=0.005). (4) Spearman’s correlation test showed PGC1β mRNA in RA PBMs correlated negatively with RF (r=–0.538, p=0.031) and serum glucose-6-phosphate isomerase (r=–0.515, p=0.041). Fig 1. Representative immunohistochemical findings of synovial PGC1β expression. A, Intensive synovial PGC1β expression in a RA patient; B and C, Mild synovial PGC1β expression in an OA patient and an Orth. A patient. (Anti-PGC1β immunostaining, original magnification, ×400). Fig 2. Immunofluorescence staining of PGC1β in primary cultures of FLS from OA and RA patients. RA-FLS stained significantly positive with PGC1β than OA-FLS (A: OA-FLS, B: RA-FLS; original magnification×400. a, DAPI (blue) ; b, PGC1β (red); c, neutral light; d, merged a, b with c). Image/graph Conclusions Our results showed altered PGC1β expression in PBMs, synovium and FLS from RA, which implied that PGC1β may be involved in the pathogenesis of RA synovitis and osteoclastogenesis. More patients and further studies are needed to establish the mechanisms of PGC1β in pathogenesis of RA. Acknowledgements Supported by Chinese National Natural Science Research Grant (no. 81001334 and 30972742), Guangdong Natural Science Research Grant (no. 10451008901004542 and 9151008901000130), and the Fundamental Research Funds for the Central Universities (no. 10ykpy19). Disclosure of Interest None Declared

Background Experiments and clinical trial have shown that peroxisome proliferator-activated receptor-γ (PPAR-γ) agonist could inhibit inflammation in rheumatoid arthritis (RA) [1,2] . Recent reports also showed that PPAR-γ agonist could prevent inflammatory periodontal bone loss by inhibiting receptor activator of NF-κB ligand (RANKL)-mediated osteoclastogenesis [3] . However, whether PPAR-γ agonist can inhibit bone erosion by RANKL-mediated osteoclastogenesis in RA is not clearly understood. Objectives To investigate the effects and underlying mechanism of rosiglitazone (RSG), a high-affinity synthetic agonist for PPAR-γ, on rheumatoid synovial fibroblasts (RA-FLS) induced osteoclastogenesis. Methods RA-FLS were cocultured with peripheral blood monocytes from healthy volunteers in the presence of macrophage colony-stimulating factor (M-CSF) and rosiglitazone (0, 15μM) for 14d. Osteoclast formation was assayed by tartrate-resistant acid phosphatase (TRAP) staining, and the RANKL/OPG mRNA was detected by Real-time PCR, the protein expression of RANKL, OPG, p-ERK, p-p38 and p-JNK was measured by Western blot. RA-FLS were cocultured with normal monocytes on bone slices for 14d, and rosiglitazone (0, 15μM) was then added from day 15, resorption lacunae area was identified by toluidine blue staining at day 21 and quantitated by Image Analysis Software. Results 15μM rosiglitazone could significantly decrease the number of osteoclasts [(38±6) vs (85±10) per well,P 0.05). Conclusions Our results showed that PPAR-γ agonist rosiglitazone could inhibit RA-FLS induced osteoclastogenesis and bone resorption activity by down-regulating RANKL expression and suppression of ERK phosphorylation. Funding This work is supported by Chinese National Natural Science Research Grant (no. 30572290 and 81001334), Guangdong Natural Science Research Grant (no. 9151008901000130 and 10451008901004542). References Cuzzocrea S, Mazzon E, Dugo L, et al. Reduction in the evolution of murine type II collagen-induced arthritis by treatment with rosiglitazone, a ligand of the peroxisome proliferator-activated receptor gamma. Arthritis Rheum, 2003, 48 (12): 3544-3556. Dina Shahin, Ehab El Toraby, Hala Abdel-Malek, et al. Effect of Peroxisome Proliferator-Activated Receptor Gamma Agonist (Pioglitazone) and Methotrexate on Disease Activity in Rheumatoid Arthritis (Experimental and Clinical Study). Clinical Medicine Insights: Arthritis and Musculoskeletal Disorders, 2011, 4: 1-10. Hassumi MY, Silva-Filho VJ, Campos-Junior JC, et al. PPAR-gamma agonist rosiglitazone prevents inflammatory periodontal bone loss by inhibiting osteoclastogenesis. Int Immunopharmacol, 2009, 9 (10): 1150-1158. Disclosure of Interest None Declared