Author: "Wilhelmi A" - Searchworks@Jio Institute Digital Library Search Results

Your search keyword '"Wilhelmi A"' showing total 9,407 results

Start Over Author "Wilhelmi A"

9,407 results on '"Wilhelmi A"'

1. 'It's Your Turn': A Novel Channel Contention Mechanism for Improving Wi-Fi's Reliability

Author: Wilhelmi, Francesc, Galati-Giordano, Lorenzo, and Fontanesi, Gianluca
Subjects: Computer Science - Networking and Internet Architecture
Abstract: The next generation of Wi-Fi, i.e., the IEEE 802.11bn (aka Wi-Fi 8), is not only expected to increase its performance and provide extended capabilities but also aims to offer a reliable service. Given that one of the main sources of unreliability in IEEE 802.11 stems from the current distributed channel access, which is based on Listen-Before-Talk (LBT), the development of novel contention schemes gains importance for Wi-Fi 8 and beyond. In this paper, we propose a new channel contention mechanism, "It's Your Turn" (IYT), that extends the existing Distributed Coordination Function (DCF) and aims at improving the reliability of distributed LBT by providing ordered device transmissions thanks to neighboring activity awareness. Using simulation results, we show that our mechanism strives to provide reliable performance by controlling the channel access delay. We prove the versatility of IYT against different topologies, coexistence with legacy devices, and increasing network densities.
Published: 2024

2. Understanding the Onto-Semiotic Approach in Mathematics Education through the Lens of the Cultural Historical Activity Theory

Author: Juan D. Godino, Carmen Batanero, María Burgos, and Miguel. R. Wilhelmi
Abstract: Research in mathematics education can be understood as a system of activities addressing the basic and applied problems related to teaching and learning of mathematics. Such a system includes the activities of foundation, planning, implementation, evaluation of mathematics instruction, and teacher professional development, which are supported by different theories. This diversity of theories raises interest in their comparison, coordination, and possible integration. The paper aims to present a case of application of the Cultural Historical Activity Theory (CHAT), in its 3rd and 4th generation versions, to analyze the emergence of the Onto-semiotic Approach to mathematical knowledge and instruction as a theoretical framework that addresses the study of the five partial activities mentioned above. This use of the CHAT can be useful in studies on theory articulation by focusing not only on the subjects, the object, and the instruments but also on the community context, the ecological-normative environment in which these activities take place, and the dilemmas or contradictions between theories.
Published: 2024
Full Text: View/download PDF

3. Spatial Reuse in IEEE 802.11bn Coordinated Multi-AP WLANs: A Throughput Analysis

Author: Nunez, David, Wilhelmi, Francesc, Galati-Giordano, Lorenzo, Geraci, Giovanni, and Bellalta, Boris
Subjects: Computer Science - Networking and Internet Architecture
Abstract: IEEE 802.11 networks continuously adapt to meet the stringent requirements of emerging applications like cloud gaming, eXtended Reality (XR), and video streaming services, which require high throughput, low latency, and high reliability. To address these challenges, Coordinated Spatial Reuse (C-SR) can potentially contribute to optimizing spectrum resource utilization. This mechanism is expected to enable a higher number of simultaneous transmissions, thereby boosting spectral efficiency in dense environments and increasing the overall network performance. In this paper, we focus on the performance analysis of C-SR in Wi-Fi 8 networks. In particular, we consider an implementation of C-SR where channel access and inter-Access Point (AP) communication are performed over-the-air using the Distributed Coordination Function (DCF). For such a purpose, we leverage the well-known Bianchi's throughput model and extend it to support multi-AP transmissions via C-SR. Numerical results in a WLAN network that consists of four APs show C-SR throughput gains ranging from 54% to 280% depending on the inter-AP distance and the position of the stations in the area.
Published: 2024

4. Very-high-energy $\gamma$-ray emission from young massive star clusters in the Large Magellanic Cloud

Author: Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Böttcher, M., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Brose, R., Brown, A., Brun, F., Bruno, B., Burger-Scheidlin, C., Casanova, S., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Cristofari, P., Devin, J., Djannati-Ataï, A., Djuvsland, J., Dmytriiev, A., Egberts, K., Einecke, S., Feijen, K., Filipovic, M., Fontaine, G., Funk, S., Gabici, S., Gallant, Y. A., Glicenstein, J. F., Glombitza, J., Grolleron, G., Haerer, L., Heß, B., Hinton, J. A., Hofmann, W., Holch, T. L., Horns, D., Huang, Zhiqiu, Jamrozy, M., Jankowsky, F., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khatoon, R., Khélifi, B., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Kundu, A., Lang, R. G., Stum, S. Le, Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Leuschner, F., Mackey, J., Marandon, V., Martí-Devesa, G., Marx, R., Mehta, A., Mitchell, A., Moderski, R., Moghadam, M. O., Mohrmann, L., Montanari, A., Moulin, E., de Naurois, M., Niemiec, J., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Pensec, U., Peron, G., Pühlhofer, G., Quirrenbach, A., Ravikularaman, S., Regeard, M., Reimer, A., Reimer, O., Ren, H., Renaud, M., Reville, B., Rieger, F., Rowell, G., Rudak, B., Ruiz-Velasco, E., Sabri, K., Sahakian, V., Salzmann, H., Santangelo, A., Sasaki, M., Schäfer, J., Schüssler, F., Schutte, H. M., Sol, H., Spencer, S., Stawarz, Ł., Steinmassl, S., Steppa, C., Streil, K., Sushch, I., Taylor, A. M., Terrier, R., Tsirou, M., Tsuji, N., van Eldik, C., Vecchi, M., Venter, C., Vink, J., Wagner, S. J., White, R., Wierzcholska, A., Zacharias, M., Zdziarski, A. A., Zech, A., and Żywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: The Tarantula Nebula in the Large Magellanic Cloud is known for its high star formation activity. At its center lies the young massive star cluster R136, providing a significant amount of the energy that makes the nebula shine so brightly at many wavelengths. Recently, young massive star clusters have been suggested to also efficiently produce high-energy cosmic rays, potentially beyond PeV energies. Here, we report the detection of very-high-energy $\gamma$-ray emission from the direction of R136 with the High Energy Stereoscopic System, achieved through a multicomponent, likelihood-based modeling of the data. This supports the hypothesis that R136 is indeed a very powerful cosmic-ray accelerator. Moreover, from the same analysis, we provide an updated measurement of the $\gamma$-ray emission from 30 Dor C, the only superbubble detected at TeV energies presently. The $\gamma$-ray luminosity above $0.5\,\mathrm{TeV}$ of both sources is $(2-3)\times 10^{35}\,\mathrm{erg}\,\mathrm{s}^{-1}$. This exceeds by more than a factor of 2 the luminosity of HESS J1646$-$458, which is associated with the most massive young star cluster in the Milky Way, Westerlund 1. Furthermore, the $\gamma$-ray emission from each source is extended with a significance of $>3\sigma$ and a Gaussian width of about $30\,\mathrm{pc}$. For 30 Dor C, a connection between the $\gamma$-ray emission and the nonthermal X-ray emission appears likely. Different interpretations of the $\gamma$-ray signal from R136 are discussed., Comment: 10+11 pages, 4+6 figures. Corresponding authors: L. Mohrmann, N. Komin
Published: 2024
Full Text: View/download PDF

5. From Text to Insight: Large Language Models for Materials Science Data Extraction

Author: Schilling-Wilhelmi, Mara, Ríos-García, Martiño, Shabih, Sherjeel, Gil, María Victoria, Miret, Santiago, Koch, Christoph T., Márquez, José A., and Jablonka, Kevin Maik
Subjects: Condensed Matter - Materials Science, Computer Science - Machine Learning
Abstract: The vast majority of materials science knowledge exists in unstructured natural language, yet structured data is crucial for innovative and systematic materials design. Traditionally, the field has relied on manual curation and partial automation for data extraction for specific use cases. The advent of large language models (LLMs) represents a significant shift, potentially enabling efficient extraction of structured, actionable data from unstructured text by non-experts. While applying LLMs to materials science data extraction presents unique challenges, domain knowledge offers opportunities to guide and validate LLM outputs. This review provides a comprehensive overview of LLM-based structured data extraction in materials science, synthesizing current knowledge and outlining future directions. We address the lack of standardized guidelines and present frameworks for leveraging the synergy between LLMs and materials science expertise. This work serves as a foundational resource for researchers aiming to harness LLMs for data-driven materials research. The insights presented here could significantly enhance how researchers across disciplines access and utilize scientific information, potentially accelerating the development of novel materials for critical societal needs.
Published: 2024

6. Performance Evaluation of MLO for XR Streaming: Can Wi-Fi 7 Meet the Expectations?

Author: Carrascosa-Zamacois, Marc, Galati-Giordano, Lorenzo, Wilhelmi, Francesc, Fontanesi, Gianluca, Jonsson, Anders, Geraci, Giovanni, and Bellalta, Boris
Subjects: Computer Science - Networking and Internet Architecture, Computer Science - Information Theory
Abstract: Extended Reality (XR) has stringent throughput and delay requirements that are hard to meet with current wireless technologies. Missing these requirements can lead to worsened picture quality, perceived lag between user input and corresponding output, and even dizziness for the end user. In this paper, we study the capability of upcoming Wi-Fi 7, and its novel support for Multi-Link Operation (MLO), to cope with these tight requirements. Our study is based on simulation results extracted from an MLO-compliant simulator that realistically reproduces VR traffic. Results show that MLO can sustain VR applications. By jointly using multiple links with independent channel access procedures, MLO can reduce the overall delay, which is especially useful in the uplink, as it has more stringent requirements than the downlink, and is instrumental in delivering the expected performance. We show that using MLO can allow more users per network than an equivalent number of links using SLO. We also show that while maintaining the same overall bandwidth, a higher number of MLO links with narrow channels leads to lower delays than a lower number of links with wider channels.
Published: 2024

7. H.E.S.S. observations of the 2021 periastron passage of PSR B1259-63/LS 2883

Author: Collaboration, H. E. S. S., Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Böttcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bouyahiaoui, M., Brose, R., Brown, A., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Caroff, S., Casanova, S., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Mbarubucyeye, J. Damascene, Devin, J., Djuvsland, J., Dmytriiev, A., Egberts, K., Einecke, S., Ernenwein, J. -P., Fontaine, G., Funk, S., Gabici, S., Gallant, Y. A., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Haerer, L., Heß, B., Hofmann, W., Holch, T. L., Holler, M., Huang, Zhiqiu, Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khangulyan, D., Khatoon, R., Khélifi, B., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Kundu, A., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Leuschner, F., Mackey, J., Malyshev, D., Martí-Devesa, G., Marx, R., Mehta, A., Meintjes, P. J., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Murach, T., de Naurois, M., Niemiec, J., Ohm, S., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Parsons, R. D., Pensec, U., Peron, G., Prokhorov, D. A., Pühlhofer, G., Punch, M., Quirrenbach, A., Regeard, M., Reimer, A., Reimer, O., Reis, I., Ren, H., Rieger, F., Rudak, B., Ruiz-Velasco, E., Sahakian, V., Salzmann, H., Santangelo, A., Sasaki, M., Schäfer, J., Schüssler, F., Schutte, H. M., Shapopi, J. N. S., Spencer, S., Stawarz, Ł., Steenkamp, R., Steinmassl, S., Steppa, C., Streil, K., Sushch, I., Takahashi, T., Tanaka, T., Taylor, A. M., Terrier, R., Thorpe-Morgan, C., Tluczykont, M., Unbehaun, T., van Eldik, C., van Soelen, B., Vecchi, M., Venter, C., Vink, J., Wach, T., Wagner, S. J., Werner, F., Wierzcholska, A., Zacharias, M., Zdziarski, A. A., Zech, A., and Żywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: PSR B1259-63 is a gamma-ray binary system that hosts a pulsar in an eccentric orbit, with a 3.4 year period, around an O9.5Ve star. At orbital phases close to periastron passages, the system radiates bright and variable non-thermal emission. We report on an extensive VHE observation campaign conducted with the High Energy Stereoscopic System, comprised of ~100 hours of data taken from $t_p-24$ days to $t_p+127$ days around the system's 2021 periastron passage. We also present the timing and spectral analyses of the source. The VHE light curve in 2021 is consistent with the stacked light curve of all previous observations. Within the light curve, we report a VHE maximum at times coincident with the third X-ray peak first detected in the 2021 X-ray light curve. In the light curve -- although sparsely sampled in this time period -- we see no VHE enhancement during the second disc crossing. In addition, we see no correspondence to the 2021 GeV flare in the VHE light curve. The VHE spectrum obtained from the analysis of the 2021 dataset is best described by a power law of spectral index $\Gamma = 2.65 \pm 0.04_{\text{stat}}$ $\pm 0.04_{\text{sys}}$, a value consistent with the previous H.E.S.S. observations of the source. We report spectral variability with a difference of $\Delta \Gamma = 0.56 ~\pm~ 0.18_{\text{stat}}$ $~\pm~0.10_{\text{sys}}$ at 95% c.l., between sub-periods of the 2021 dataset. We also find a linear correlation between contemporaneous flux values of X-ray and TeV datasets, detected mainly after $t_p+25$ days, suggesting a change in the available energy for non-thermal radiation processes. We detect no significant correlation between GeV and TeV flux points, within the uncertainties of the measurements, from $\sim t_p-23$ days to $\sim t_p+126$ days. This suggests that the GeV and TeV emission originate from different electron populations., Comment: accepted to A&A
Published: 2024

8. Final Search for Short-Baseline Neutrino Oscillations with the PROSPECT-I Detector at HFIR

Author: Andriamirado, M., Balantekin, B., Bass, C. D., Rodrigues, O. Benevides, Bernard, E. P., Bowden, N. S., Bryan, C. D., Carr, R., Classen, T., Conant, A. J., Deichert, G., Dolinski, M. J., Erickson, A., Galindo-Uribarri, A., Gokhale, S., Grant, C., Hans, S., Hansell, A. B., Heeger, K. M., Heffron, B., Jaffe, D. E., Jayakumar, S., Koblanski, J. R., Kunkle, P., Lane, C. E., Littlejohn, B. R., Sanchez, A. Lozano, Lu, X., Machado, F., Maricic, J., Mendenhall, M. P., Meyer, A. M., Milincic, R., Mueller, P. E., Mumm, H., Neilson, R., Qian, X., Roca, C., Rosero, R., Surukuchi, P., Sutanto, F., Venegas-Vargas, D., Weatherly, P. B., Wilhelmi, J., Yeh, M., Zhang, C., and Zhang, X.
Subjects: High Energy Physics - Experiment, Nuclear Experiment
Abstract: The PROSPECT experiment is designed to perform precise searches for antineutrino disappearance at short distances (7 - 9~m) from compact nuclear reactor cores. This Letter reports results from a new neutrino oscillation analysis performed using the complete data sample from the PROSPECT-I detector operated at the High Flux Isotope Reactor in 2018. The analysis uses a multi-period selection of inverse beta decay neutrino interactions with reduced backgrounds and enhanced statistical power to set limits on electron-flavor disappearance caused by mixing with sterile neutrinos with 0.2 - 20 eV$^2$ mass splittings. Inverse beta decay positron energy spectra from six different reactor-detector distance ranges are found to be statistically consistent with one another, as would be expected in the absence of sterile neutrino oscillations. The data excludes at 95% confidence level the existence of sterile neutrinos in regions above 3~eV$^2$ previously unexplored by terrestrial experiments, including all space below 10~eV$^2$ suggested by the recently strengthened Gallium Anomaly. The best-fit point of the Neutrino-4 reactor experiment's claimed observation of short-baseline oscillation is ruled out at more than five standard deviations., Comment: 6 pages, 4 figures
Published: 2024

9. Reactor Antineutrino Directionality Measurement with the PROSPECT-I Detector

Author: Andriamirado, M., Balantekin, B., Bass, C. D., Rodrigues, O. Benevides, Bernard, E. P., Bowden, N. S., Bryan, C. D., Carr, R., Classen, T., Conant, A. J., Deichert, G., Dolinski, M. J., Erickson, A., Galindo-Uribarri, A., Gokhale, S., Grant, C., Hans, S., Hansell, A. B., Heeger, K. M., Heffron, B., Jaffe, D. E., Jayakumar, S., Jones, D. C., Koblanski, J. R., Kunkle, P., Lane, C. E., Littlejohn, B. R., Sanchez, A. Lozano, Lu, X., Maricic, J., Mendenhall, M. P., Meyer, A. M., Milincic, R., Mueller, P. E., Mumm, H., Napolitano, J., Nave, C., Neilson, R., Oueslati, M., Roca, C., Rosero, R., Surukuchi, P., Sutanto, F., Venegas-Vargas, D., Weatherly, P. B., Wilhelmi, J., Yeh, M., Zhang, C., and Zhang, X.
Subjects: Nuclear Experiment, High Energy Physics - Experiment, Physics - Instrumentation and Detectors
Abstract: The PROSPECT-I detector has several features that enable measurement of the direction of a compact neutrino source. In this paper, a detailed report on the directional measurements made on electron antineutrinos emitted from the High Flux Isotope Reactor is presented. With an estimated true neutrino (reactor to detector) direction of $\phi = 40.8\unicode{xB0} \pm 0.7\unicode{xB0}$ and $\theta = 98.6\unicode{xB0} \pm 0.4\unicode{xB0}$, the PROSPECT-I detector is able to reconstruct an average neutrino direction of $\phi = 39.4\unicode{xB0} \pm 2.9\unicode{xB0}$ and $\theta = 97.6\unicode{xB0} \pm 1.6\unicode{xB0}$. This measurement is made with approximately 48000 Inverse Beta Decay signal events and is the most precise directional reconstruction of reactor antineutrinos to date.
Published: 2024

10. Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Author: Yang, Yongil, Chaffin, Timothy, Shao, Yuanhua, Balasubramanian, Vimal, Markillie, Meng, Mitchell, Hugh, Rubio-Wilhelmi, Maria, Ahkami, Amir, Blumwald, Eduardo, and Neal Stewart, C
Subjects: Populus, green tissue specific promoter, synthetic biology, synthetic promoter, water‐deficit stress, Populus, Promoter Regions, Genetic, Plants, Genetically Modified, Gene Expression Regulation, Plant, Dehydration, Stress, Physiological, Organ Specificity, Plant Leaves
Abstract: Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Published: 2024

11. Towards an AI/ML-defined Radio for Wi-Fi: Overview, Challenges, and Roadmap

Author: Bellalta, Boris, Kosek-Szott, Katarzyna, Szott, Szymon, and Wilhelmi, Francesc
Subjects: Computer Science - Networking and Internet Architecture
Abstract: Will AI/ML-defined radios become a reality in the near future? In this paper, we introduce the concept of an AI/ML-defined radio - a radio architecture specifically designed to support AI/ML-based optimization and decision-making in communication functions - and depict its promised benefits and potential challenges. Additionally, we discuss a potential roadmap for the development and adoption of AI/ML-defined radios, and highlight the enablers for addressing their associated challenges. While we offer a general overview of the AI/ML-defined radio concept, our focus throughout the paper remains on Wi-Fi, a wireless technology that may significantly benefit from the integration of AI/ML-defined radios, owing to its inherent decentralized management and operation within unlicensed frequency bands.
Published: 2024

12. Machine Learning & Wi-Fi: Unveiling the Path Towards AI/ML-Native IEEE 802.11 Networks

Author: Wilhelmi, Francesc, Szott, Szymon, Kosek-Szott, Katarzyna, and Bellalta, Boris
Subjects: Computer Science - Networking and Internet Architecture, Computer Science - Artificial Intelligence
Abstract: Artificial intelligence (AI) and machine learning (ML) are nowadays mature technologies considered essential for driving the evolution of future communications systems. Simultaneously, Wi-Fi technology has constantly evolved over the past three decades and incorporated new features generation after generation, thus gaining in complexity. As such, researchers have observed that AI/ML functionalities may be required to address the upcoming Wi-Fi challenges that will be otherwise difficult to solve with traditional approaches. This paper discusses the role of AI/ML in current and future Wi-Fi networks and depicts the ways forward. A roadmap towards AI/ML-native Wi-Fi, key challenges, standardization efforts, and major enablers are also discussed. An exemplary use case is provided to showcase the potential of AI/ML in Wi-Fi at different adoption stages.
Published: 2024

13. Continuous Multi-Link Operation: A Contention-Free Mechanism for the Unlicensed Spectrum

Author: Fontanesi, Gianluca, Wilhelmi, Francesc, and Galati-Giordano, Lorenzo
Subjects: Electrical Engineering and Systems Science - Signal Processing
Abstract: This paper proposes a novel mechanism to enforce contention-free channel access in the unlicensed spectrum, as opposed to the traditional contention-based approach. To achieve this objective, we build on the Wi-Fi~7 multi-link operation (MLO) and define the means whereby independent channel access attempts are performed in all the addressable links to ensure one available channel/link is ready for transmission at all times, such that a sequence of continuous acquired channels can be maintained. We call this method continuous multi-link operation (ConMLO). In this work, we aim to verify the applicability of ConMLO, its ability to retain spectrum resources for a given duration of time, and its fairness with respect existing approaches, namely legacy single-link operation (SLO) and MLO. To this end, we use realistic data traffic measurements acquired in a crowded football stadium as an exemplary case of challenging spectrum occupation. Our results show that the proposed ConMLO can effectively guarantee continuous channel acquisition under different occupancy scenarios without compromising fairness of channel access compared to existing legacy modes., Comment: 5 pages, 6 figures, conference paper
Published: 2024

14. The hunt of PeVatrons as the origin of the most energetic photons observed in our Galaxy

Author: Wilhelmi, Emma de Oña, López-Coto, Rubén, Aharonian, Felix, Amato, Elena, Cao, Zhen, Gabici, Stefano, and Hinton, Jim
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: Ultrarelativistic particles called cosmic rays permeate the Milky Way, propagating through the Galactic turbulent magnetic fields. The mechanisms under which these particles increase their energy can be reasonably described by current theories of acceleration and propagation of cosmic rays. There are, however, still many open questions as to how to reach petaelectronvolt (PeV) energies, the maximum energy believed to be attained in our Galaxy, and in which astrophysical sources (dubbed {\it PeVatrons}) this ultra-high energy acceleration happens. In this article, we describe the theoretical conditions for plasma acceleration to these energies, and the Galactic sources in which these conditions are possible. These theoretical predictions are then confronted with the latest experimental results, summarising the state-of-the-art of our current knowledge of PeVatrons. We finally describe the prospects to keep advancing the understanding of these elusive objects, still unidentified more than one hundred years after the discovery of cosmic rays., Comment: Published in Nature Astronomy, Volume 8, pages 425-431 (2024)
Published: 2024

15. Distributed Learning for Wi-Fi AP Load Prediction

Author: Salami, Dariush, Wilhelmi, Francesc, Galati-Giordano, Lorenzo, and Kasslin, Mika
Subjects: Computer Science - Networking and Internet Architecture, Computer Science - Artificial Intelligence, Computer Science - Machine Learning
Abstract: The increasing cloudification and softwarization of networks foster the interplay among multiple independently managed deployments. An appealing reason for such an interplay lies in distributed Machine Learning (ML), which allows the creation of robust ML models by leveraging collective intelligence and computational power. In this paper, we study the application of the two cornerstones of distributed learning, namely Federated Learning (FL) and Knowledge Distillation (KD), on the Wi-Fi Access Point (AP) load prediction use case. The analysis conducted in this paper is done on a dataset that contains real measurements from a large Wi-Fi campus network, which we use to train the ML model under study based on different strategies. Performance evaluation includes relevant aspects for the suitability of distributed learning operation in real use cases, including the predictive performance, the associated communication overheads, or the energy consumption. In particular, we prove that distributed learning can improve the predictive accuracy centralized ML solutions by up to 93% while reducing the communication overheads and the energy cost by 80%.
Published: 2024

16. Are large language models superhuman chemists?

Author: Mirza, Adrian, Alampara, Nawaf, Kunchapu, Sreekanth, Ríos-García, Martiño, Emoekabu, Benedict, Krishnan, Aswanth, Gupta, Tanya, Schilling-Wilhelmi, Mara, Okereke, Macjonathan, Aneesh, Anagha, Elahi, Amir Mohammad, Asgari, Mehrdad, Eberhardt, Juliane, Elbeheiry, Hani M., Gil, María Victoria, Greiner, Maximilian, Holick, Caroline T., Glaubitz, Christina, Hoffmann, Tim, Ibrahim, Abdelrahman, Klepsch, Lea C., Köster, Yannik, Kreth, Fabian Alexander, Meyer, Jakob, Miret, Santiago, Peschel, Jan Matthias, Ringleb, Michael, Roesner, Nicole, Schreiber, Johanna, Schubert, Ulrich S., Stafast, Leanne M., Wonanke, Dinga, Pieler, Michael, Schwaller, Philippe, and Jablonka, Kevin Maik
Subjects: Computer Science - Machine Learning, Condensed Matter - Materials Science, Computer Science - Artificial Intelligence, Physics - Chemical Physics
Abstract: Large language models (LLMs) have gained widespread interest due to their ability to process human language and perform tasks on which they have not been explicitly trained. However, we possess only a limited systematic understanding of the chemical capabilities of LLMs, which would be required to improve models and mitigate potential harm. Here, we introduce "ChemBench," an automated framework for evaluating the chemical knowledge and reasoning abilities of state-of-the-art LLMs against the expertise of chemists. We curated more than 2,700 question-answer pairs, evaluated leading open- and closed-source LLMs, and found that the best models outperformed the best human chemists in our study on average. However, the models struggle with some basic tasks and provide overconfident predictions. These findings reveal LLMs' impressive chemical capabilities while emphasizing the need for further research to improve their safety and usefulness. They also suggest adapting chemistry education and show the value of benchmarking frameworks for evaluating LLMs in specific domains.
Published: 2024

17. Unveiling extended gamma-ray emission around HESS J1813-178

Author: Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Baktash, A., Martins, V. Barbosa, Barnard, J., Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Bi, B., Böttcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bouyahiaoui, M., Breuhaus, M., Brose, R., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Caroff, S., Casanova, S., Cecil, R., Celic, J., Cerruti, M., Chambery, P., Chand, T., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Mbarubucyeye, J. Damascene, Djannati-Ataï, A., Dmytriiev, A., Doroshenko, V., Einecke, S., Ernenwein, J. -P., Feijen, K., Filipovic, M., Fontaine, G., Füßling, M., Funk, S., Gabici, S., Gallant, Y. A., Ghafourizadeh, S., Giavitt, G., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Grondin, M. -H., Hinton, J. A., Hofmann, W., Holch, T. L., Holler, M., Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Katarzyński, K., Khatoon, R., Khélifi, B., Klepser, S., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Kundu, A., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Leuschner, F., Mackey, J., Malyshev, D., Marandon, V., Marinos, P., Martí-Devesa, G., Marx, R., Mehta, A., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Murach, T., de Naurois, M., Niemiec, J., Noel, A. Priyana, O'Brien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Parsons, R. D., Prokhorov, D. A., Pühlhofer, G., Punch, M., Quirrenbach, A., Regeard, M., Reichherzer, P., Reimer, A., Reimer, O., Ren, H., Renaud, M., Reville, B., Rieger, F., Roellinghoff, G., Rudak, B., Sahakian, V., Salzmann, H., Sasaki, M., Schüssler, F., Schutte, H. M., Shapopi, J. N. S., Specovius, A., Spencer, S., Steenkamp, R., Steinmassl, S., Steppa, C., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Terrier, R., Tluczykont, M., Tsuji, N., Unbehaun, T., van Eldik, C., Vecchi, M., Veh, J., Venter, C., Vink, J., Wach, T., Wagner, S. J., Wierzcholska, A., Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zouari, S., and Żywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: HESS J1813$-$178 is a very-high-energy $\gamma$-ray source spatially coincident with the young and energetic pulsar PSR J1813$-$1749 and thought to be associated with its pulsar wind nebula (PWN). Recently, evidence for extended high-energy emission in the vicinity of the pulsar has been revealed in the Fermi Large Area Telescope (LAT) data. This motivates revisiting the HESS J1813$-$178 region, taking advantage of improved analysis methods and an extended data set. Using data taken by the High Energy Stereoscopic System (H.E.S.S.) experiment and the Fermi-LAT, we aim to describe the $\gamma$-ray emission in the region with a consistent model, to provide insights into its origin. We performed a likelihood-based analysis on 32 hours of H.E.S.S. data and 12 years of Fermi-LAT data and fit a spectro-morphological model to the combined datasets. These results allowed us to develop a physical model for the origin of the observed $\gamma$-ray emission in the region. In addition to the compact very-high-energy $\gamma$-ray emission centered on the pulsar, we find a significant yet previously undetected component along the Galactic plane. With Fermi-LAT data, we confirm extended high-energy emission consistent with the position and elongation of the extended emission observed with H.E.S.S. These results establish a consistent description of the emission in the region from GeV energies to several tens of TeV. This study suggests that HESS J1813$-$178 is associated with a $\gamma$-ray PWN powered by PSR J1813$-$1749. A possible origin of the extended emission component is inverse Compton emission from electrons and positrons that have escaped the confines of the pulsar and form a halo around the PWN., Comment: 13+5 pages, 13+11 figures. Accepted for publication in A&A. Corresponding authors: T.Wach, A.Mitchell, V.Joshi, P.Chamb\'ery
Published: 2024
Full Text: View/download PDF

18. Spectrum and extension of the inverse-Compton emission of the Crab Nebula from a combined Fermi-LAT and H.E.S.S. analysis

Author: Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Baktash, A., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Bi, B., Böttcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bradascio, F., Breuhaus, M., Brose, R., Brown, A., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Bylund, T., Caroff, S., Casanova, S., Cecil, R., Celic, J., Cerruti, M., Chambery, P., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Cristofari, P., Devin, J., Djannati-Ataï, A., Djuvsland, J., Dmytriiev, A., Einecke, S., Ernenwein, J. -P., Fegan, S., Feijen, K., Filipović, M., Fontaine, G., Füßling, M., Funk, S., Gabici, S., Gallant, Y. A., Giavitto, G., Glawion, D., Glicenstein, J. F., Glombitza, J., Goswami, P., Grolleron, G., Grondin, M. -H., Haerer, L., Hinton, J. A., Hofmann, W., Holch, T. L., Holler, M., Horns, D., Jamrozy, M., Jankowsky, F., Joshi, V., Kasai, E., Katarzyński, K., Khatoon, R., Khélifi, B., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Kundu, A., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Leuschner, F., Luashvili, A., Mackey, J., Malyshev, D., Marandon, V., Marinos, P., Martí-Devesa, G., Marx, R., Mehta, A., Meyer, M., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Murach, T., de Naurois, M., Niemiec, J., O'Brien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Parsons, R. D., Peron, G., Prokhorov, D. A., Pühlhofer, G., Punch, M., Quirrenbach, A., Regeard, M., Reichherzer, P., Reimer, A., Reimer, O., Ren, H., Renaud, M., Reville, B., Rieger, F., Roellinghoff, G., Rudak, B., Sahakian, V., Salzmann, H., Sasaki, M., Schüssler, F., Schutte, H. M., Shapopi, J. N. S., Specovius, A., Spencer, S., Stawarz, Ł., Steenkamp, R., Steinmassl, S., Steppa, C., Streil, K., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Terrier, R., Tluczykont, M., Tsuji, N., Unbehaun, T., van Eldik, C., Vecchi, M., Veh, J., Venter, C., Vink, J., Wach, T., Wagner, S. J., Wierzcholska, A., Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zouari, S., Żywucka, N., and Harding, A.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: The Crab Nebula is a unique laboratory for studying the acceleration of electrons and positrons through their non-thermal radiation. Observations of very-high-energy $\gamma$ rays from the Crab Nebula have provided important constraints for modelling its broadband emission. We present the first fully self-consistent analysis of the Crab Nebula's $\gamma$-ray emission between 1 GeV and $\sim$100 TeV, that is, over five orders of magnitude in energy. Using the open-source software package Gammapy, we combined 11.4 yr of data from the Fermi Large Area Telescope and 80 h of High Energy Stereoscopic System (H.E.S.S.) data at the event level and provide a measurement of the spatial extension of the nebula and its energy spectrum. We find evidence for a shrinking of the nebula with increasing $\gamma$-ray energy. Furthermore, we fitted several phenomenological models to the measured data, finding that none of them can fully describe the spatial extension and the spectral energy distribution at the same time. Especially the extension measured at TeV energies appears too large when compared to the X-ray emission. Our measurements probe the structure of the magnetic field between the pulsar wind termination shock and the dust torus, and we conclude that the magnetic field strength decreases with increasing distance from the pulsar. We complement our study with a careful assessment of systematic uncertainties., Comment: 18+6 pages, 15+2 figures. Accepted for publication in A&A. Corresponding authors: M. Meyer, L. Mohrmann, T. Unbehaun. v2: after A&A language editing
Published: 2024
Full Text: View/download PDF

19. Understanding the onto-semiotic approach in mathematics education through the lens of the cultural historical activity theory

Author: Godino, Juan D., Batanero, Carmen, Burgos, María, and Wilhelmi, Miguel. R.
Published: 2024
Full Text: View/download PDF

20. Arkitekt: streaming analysis and real-time workflows for microscopy

Author: Roos, Johannes, Bancelin, Stéphane, Delaire, Tom, Wilhelmi, Alexander, Levet, Florian, Engelhardt, Maren, Viasnoff, Virgile, Galland, Rémi, Nägerl, U. Valentin, and Sibarita, Jean-Baptiste
Published: 2024
Full Text: View/download PDF

21. Spermidine is essential for fasting-mediated autophagy and longevity

Author: Hofer, Sebastian J., Daskalaki, Ioanna, Bergmann, Martina, Friščić, Jasna, Zimmermann, Andreas, Mueller, Melanie I., Abdellatif, Mahmoud, Nicastro, Raffaele, Masser, Sarah, Durand, Sylvère, Nartey, Alexander, Waltenstorfer, Mara, Enzenhofer, Sarah, Faimann, Isabella, Gschiel, Verena, Bajaj, Thomas, Niemeyer, Christine, Gkikas, Ilias, Pein, Lukas, Cerrato, Giulia, Pan, Hui, Liang, YongTian, Tadic, Jelena, Jerkovic, Andrea, Aprahamian, Fanny, Robbins, Christine E., Nirmalathasan, Nitharsshini, Habisch, Hansjörg, Annerer, Elisabeth, Dethloff, Frederik, Stumpe, Michael, Grundler, Franziska, Wilhelmi de Toledo, Françoise, Heinz, Daniel E., Koppold, Daniela A., Rajput Khokhar, Anika, Michalsen, Andreas, Tripolt, Norbert J., Sourij, Harald, Pieber, Thomas R., de Cabo, Rafael, McCormick, Mark A., Magnes, Christoph, Kepp, Oliver, Dengjel, Joern, Sigrist, Stephan J., Gassen, Nils C., Sedej, Simon, Madl, Tobias, De Virgilio, Claudio, Stelzl, Ulrich, Hoffmann, Markus H., Eisenberg, Tobias, Tavernarakis, Nektarios, Kroemer, Guido, and Madeo, Frank
Published: 2024
Full Text: View/download PDF

22. ConPA: A Contention-free Mechanism with Power Adaptation for Beyond Listen-Before-Talk

Author: Wilhelmi, Francesc, Baracca, Paolo, Fontanesi, Gianluca, and Galati-Giordano, Lorenzo
Subjects: Computer Science - Networking and Internet Architecture
Abstract: In view of the need to find novel means to utilize the unlicensed spectrum to meet the rising latency and reliability requirements of new applications, we propose a novel mechanism that allows devices to transmit anytime that a packet has to be delivered. The proposed mechanism, Contention-free with Power Adaptation (ConPA), aims to bypass the contention periods of current Listen-Before-Talk (LBT) approaches, which are the main source of unreliability in unlicensed technologies like Wi-Fi. To assess the feasibility of ConPA, we provide an analytical method based on Markov chains, which allows deriving relevant performance metrics, including throughput, airtime, and quality of transmissions. Using such a model, we study the performance of ConPA in various scenarios, and compare it to baseline channel access approaches like the Distributed Coordination Function (DCF) and the IEEE 802.11ax Overlapping Basic Service Set (OBSS) Packet Detect (PD)-based Spatial Reuse (SR). Our results prove the effectiveness of ConPA in reusing the space to offer substantial throughput gains with respect to the baselines (up to 76% improvement).
Published: 2024

23. Algorithms for Claims Trading

Author: Hoefer, Martin, Ventre, Carmine, and Wilhelmi, Lisa
Subjects: Computer Science - Computer Science and Game Theory, Quantitative Finance - Risk Management
Abstract: The recent banking crisis has again emphasized the importance of understanding and mitigating systemic risk in financial networks. In this paper, we study a market-driven approach to rescue a bank in distress based on the idea of claims trading, a notion defined in Chapter 11 of the U.S. Bankruptcy Code. We formalize the idea in the context of financial networks by Eisenberg and Noe. For two given banks v and w, we consider the operation that w takes over some claims of v and in return gives liquidity to v to ultimately rescue v. We study the structural properties and computational complexity of decision and optimization problems for several variants of claims trading. When trading incoming edges of v, we show that there is no trade in which both banks v and w strictly improve their assets. We therefore consider creditor-positive trades, in which v profits strictly and w remains indifferent. For a given set C of incoming edges of v, we provide an efficient algorithm to compute payments by w that result in maximal assets of v. When the set C must also be chosen, the problem becomes weakly NP-hard. Our main result here is a bicriteria FPTAS to compute an approximate trade. The approximate trade results in nearly the optimal amount of assets of v in any exact trade. Our results extend to the case in which banks use general monotone payment functions and the emerging clearing state can be computed efficiently. In contrast, for trading outgoing edges of v, the goal is to maximize the increase in assets for the creditors of v. Notably, for these results the characteristics of the payment functions of the banks are essential. For payments ranking creditors one by one, we show NP-hardness of approximation within a factor polynomial in the network size, when the set of claims C is part of the input or not. Instead, for proportional payments, our results indicate more favorable conditions.
Published: 2024

24. Curvature in the very-high energy gamma-ray spectrum of M87

Author: Collaboration, H. E. S. S., Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Böttcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Bradascio, F., Brose, R., Brun, F., Bruno, B., Burger-Scheidlin, T. Bulik C., Bylund, T., Casanova, S., Cecil, R., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Collins, T., Cotter, G., Mbarubucyeye, J. Damascene, Djannati-Ataï, A., Djuvsland, J., Dmytriiev, A., Egberts, K., Einecke, S., Fegan, S., Fontaine, G., Funk, S., Gabici, S., Glicenstein, J. F., Glombitza, J., Grolleron, G., Haerer, L., Hofmann, W., Holch, T. L., Holler, M., Horns, D., Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khatoon, R., Khélifi, B., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Kundu, A., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Lypova, I., Luashvili, A., Mackey, J., Malyshev, D., Martí-Devesa, G., Marx, R., Mehta, A., Meyer, M., Mitchell, A., Moderski, R., Moghadam, M. O., Mohrmann, L., Montanari, A., Moulin, E., Murach, T., de Naurois, M., Niemiec, J., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Panny, S., Panter, M., Parsons, R. D., Pensec, U., Pita, S., Pühlhofer, G., Punch, M., Quirrenbach, A., Regeard, M., Reimer, A., Reimer, O., Ren, H., Reville, B., Rieger, F., Rudak, B., Ruiz-Velasco, E., Sahakian, V., Salzmann, H., Santangelo, A., Sasaki, M., Schüssler, F., Schutte, H. M., Shapopi, J. N. S., Sol, H., Spencer, S., Stawarz, Ł., Steenkamp, R., Steinmassl, S., Steppa, C., Streil, K., Takahashi, T., Tanaka, T., Taylor, A. M., Terrier, R., Tsirou, M., van Eldik, C., Venter, C., Vink, J., Wach, T., Wagner, S. J., Wierzcholska, A., Zacharias, M., Zdziarski, A. A., Zech, A., Zilberman, P., and Zywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena, Astrophysics - Instrumentation and Methods for Astrophysics
Abstract: The radio galaxy M87 is a variable very-high energy (VHE) gamma-ray source, exhibiting three major flares reported in 2005, 2008, and 2010. Despite extensive studies, the origin of the VHE gamma-ray emission is yet to be understood. In this study, we investigate the VHE gamma-ray spectrum of M87 during states of high gamma-ray activity, utilizing 20.2$\,$ hours the H.E.S.S. observations. Our findings indicate a preference for a curved spectrum, characterized by a log-parabola model with extra-galactic background light (EBL) model above 0.3$\,$TeV at the 4$\sigma$ level, compared to a power-law spectrum with EBL. We investigate the degeneracy between the absorption feature and the EBL normalization and derive upper limits on EBL models mainly sensitive in the wavelength range 12.4$\,$$\mu$m - 40$\,$$\mu$m., Comment: 10 pages, 7 figures. Accepted for publication in A&A. Corresponding authors: Victor Barbosa Martins, Rahul Cecil, Iryna Lypova, Manuel Meyer, Perri Zilberman. Supplementary material: https://zenodo.org/records/10781524
Published: 2024
Full Text: View/download PDF

25. Multi-Center Fetal Brain Tissue Annotation (FeTA) Challenge 2022 Results

Author: Payette, Kelly, Steger, Céline, Licandro, Roxane, de Dumast, Priscille, Li, Hongwei Bran, Barkovich, Matthew, Li, Liu, Dannecker, Maik, Chen, Chen, Ouyang, Cheng, McConnell, Niccolò, Miron, Alina, Li, Yongmin, Uus, Alena, Grigorescu, Irina, Gilliland, Paula Ramirez, Siddiquee, Md Mahfuzur Rahman, Xu, Daguang, Myronenko, Andriy, Wang, Haoyu, Huang, Ziyan, Ye, Jin, Alenyà, Mireia, Comte, Valentin, Camara, Oscar, Masson, Jean-Baptiste, Nilsson, Astrid, Godard, Charlotte, Mazher, Moona, Qayyum, Abdul, Gao, Yibo, Zhou, Hangqi, Gao, Shangqi, Fu, Jia, Dong, Guiming, Wang, Guotai, Rieu, ZunHyan, Yang, HyeonSik, Lee, Minwoo, Płotka, Szymon, Grzeszczyk, Michal K., Sitek, Arkadiusz, Daza, Luisa Vargas, Usma, Santiago, Arbelaez, Pablo, Lu, Wenying, Zhang, Wenhao, Liang, Jing, Valabregue, Romain, Joshi, Anand A., Nayak, Krishna N., Leahy, Richard M., Wilhelmi, Luca, Dändliker, Aline, Ji, Hui, Gennari, Antonio G., Jakovčić, Anton, Klaić, Melita, Adžić, Ana, Marković, Pavel, Grabarić, Gracia, Kasprian, Gregor, Dovjak, Gregor, Rados, Milan, Vasung, Lana, Cuadra, Meritxell Bach, and Jakab, Andras
Subjects: Electrical Engineering and Systems Science - Image and Video Processing
Abstract: Segmentation is a critical step in analyzing the developing human fetal brain. There have been vast improvements in automatic segmentation methods in the past several years, and the Fetal Brain Tissue Annotation (FeTA) Challenge 2021 helped to establish an excellent standard of fetal brain segmentation. However, FeTA 2021 was a single center study, and the generalizability of algorithms across different imaging centers remains unsolved, limiting real-world clinical applicability. The multi-center FeTA Challenge 2022 focuses on advancing the generalizability of fetal brain segmentation algorithms for magnetic resonance imaging (MRI). In FeTA 2022, the training dataset contained images and corresponding manually annotated multi-class labels from two imaging centers, and the testing data contained images from these two imaging centers as well as two additional unseen centers. The data from different centers varied in many aspects, including scanners used, imaging parameters, and fetal brain super-resolution algorithms applied. 16 teams participated in the challenge, and 17 algorithms were evaluated. Here, a detailed overview and analysis of the challenge results are provided, focusing on the generalizability of the submissions. Both in- and out of domain, the white matter and ventricles were segmented with the highest accuracy, while the most challenging structure remains the cerebral cortex due to anatomical complexity. The FeTA Challenge 2022 was able to successfully evaluate and advance generalizability of multi-class fetal brain tissue segmentation algorithms for MRI and it continues to benchmark new algorithms. The resulting new methods contribute to improving the analysis of brain development in utero., Comment: Results from FeTA Challenge 2022, held at MICCAI; Manuscript submitted to IEEE Transactions on Medical Imaging (2024). Supplementary Info (including submission methods descriptions) available here: https://zenodo.org/records/10628648
Published: 2024
Full Text: View/download PDF

26. Acceleration and transport of relativistic electrons in the jets of the microquasar SS 433

Author: Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Bi, B., Böttcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bouyahiaou, M., Breuhau, M., Brose, R., Brown, A. M., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Caroff, S., Casanova, S., Cecil, R., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Dai, S., Mbarubucyeye, J. Damascene, Djannati-Ataï, A., Dmytriiev, A., Doroshenko, V., Egberts, K., Einecke, S., Ernenwein, J. -P., Filipovic, M., Fontaine, G., Funk, S., Gabici, S., Ghafourizadeh, S., Giavitto, G., Glawion, D., Glicenstein, J. F., Grolleron, G., Haerer, L., Hinton, J. A., Hofmann, W., Holch, T. L., Holler, M., Horns, D., Jamrozy, M., Jankowsky, F., Jardin-Blicq, A., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khatoon, R., Khélifi, B., Klepser, S., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Kundu, A., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lenain, J. -P., Leuschner, F., Lohse, T., Luashvili, A., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marcowith, A., Martí-Devesa, G., Marx, R., Mehta, A., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Murach, T., Nakashima, K., de Naurois, M., Niemiec, J., Noel, A. Priyana, Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Parsons, R. D., Peron, G., Prokhorov, D. A., Pühlhofer, G., Punch, M., Quirrenbach, A., Reichherzer, P., Reimer, A., Reimer, O., Ren, H., Renaud, M., Reville, B., Rieger, F., Rowell, G., Rudak, B., Ricarte, H. Rueda, Ruiz-Velasco, E., Sahakian, V., Salzman, H., Santangelo, A., Sasaki, M., Schäfer, J., Schüssler, F., Schwanke, U., Shapopi, J. N. S., Sol, H., Specovius, A., Spencer, S., Stawarz, Ł., Steenkamp, R., Steinmassl, S., Steppa, C., Streil, K., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Taylor, A. M., Terrier, R., Tsirou, M., Tsuji, N., Unbehaun, T., van Eldik, C., Vecchi, M., Veh, J., Venter, C., Vink, J., Wach, T., Wagner, S. J., Werner, F., White, R., Wierzcholska, A., Wong, Yu Wun, Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zouari, S., and Żywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: SS 433 is a microquasar, a stellar binary system with collimated relativistic jets. We observed SS 433 in gamma rays using the High Energy Stereoscopic System (H.E.S.S.), finding an energy-dependent shift in the apparent position of the gamma-ray emission of the parsec-scale jets. These observations trace the energetic electron population and indicate the gamma rays are produced by inverse-Compton scattering. Modelling of the energy-dependent gamma-ray morphology constrains the location of particle acceleration and requires an abrupt deceleration of the jet flow. We infer the presence of shocks on either side of the binary system at distances of 25 to 30 parsecs and conclude that self-collimation of the precessing jets forms the shocks, which then efficiently accelerate electrons., Comment: Submitted 20th Apr. 2023, published 25th January 2024 (accepted version)
Published: 2024
Full Text: View/download PDF

27. NIR spectral classification of the companion in the gamma-ray binary HESS J1832-093 as an O6 V star

Author: van Soelen, Brian, Bordas, Pol, Negueruela, Ignacio, Wilhelmi, Emma de Oña, Papitto, Alessandro, and Ribó, Marc
Subjects: Astrophysics - High Energy Astrophysical Phenomena, Astrophysics - Solar and Stellar Astrophysics
Abstract: HESS J1832-093 is a member of the rare class of gamma-ray binaries, as recently confirmed by the detection of orbitally modulated X-ray and gamma-ray emission with a period of ~86 d. The spectral type of the massive companion star has been difficult to retrieve as there is no optical counterpart, but the system is coincident with a near-infrared source. Previous results have shown that the infrared counterpart is consistent with an O or B type star, but a clear classification is still lacking. We observed the counterpart twice, in 2019 and 2021, with the X-Shooter spectrograph operating on the VLT. The obtained spectra classify the counterpart as an O6 V type star. We estimate a distance to the source of $6.7 \pm 0.5$ kpc, although this estimate can be severely affected by the high extinction towards the source. This new O6 V classification for the companion star in HESS J1832-093 provides further support to an apparent grouping around a given spectral type for all discovered gamma-ray binaries that contain an O-type star. This may be due to the interplay between the initial mass function and the wind-momentum-luminosity relation., Comment: 6 pages, 2 figures, accepted for publication in MNRAS Letters
Published: 2024

28. A systematic scoping review of the Social Vulnerability Index as applied to natural hazards

Author: Painter, Mary Angelica, Shah, Sameer H., Damestoit, Gwendolyn C., Khalid, Fariha, Prudencio, Wendy, Chisty, Musabber Ali, Tormos-Aponte, Fernando, and Wilhelmi, Olga
Published: 2024
Full Text: View/download PDF

29. Gamma-ray detection of newly discovered Ancora SNR: G288.8-6.3

Author: Burger-Scheidlin, Christopher, Brose, Robert, Mackey, Jonathan, Filipović, Miroslav D., Goswami, Pranjupriya, Guillen, Enrique Mestre, Wilhelmi, Emma de Oña, and Sushch, Iurii
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: The supernova remnant (SNR) G288.8-6.3 was recently discovered as a faint radio shell at large Galactic latitude using observations with ASKAP in the EMU survey. Here, we make the first detailed investigation of the $\gamma$-ray emission from the G288.8-6.3 region, aiming to characterise the high-energy emission in the GeV regime from the newly discovered SNR, dubbed Ancora. 15 years of Fermi-Large Area Telescope (LAT) data were analysed at energies between 400 MeV and 1 TeV and the excess seen in the region was modelled using different spatial and spectral models. We detect spatially extended $\gamma$-ray emission coinciding with the radio SNR, with detection significance up to 8.8 $\sigma$. A radial disk spatial model in combination with a power-law spectral model with an energy flux of $(4.80 \pm 0.91) \times 10^{-6}$ $\text{MeV}$ $\text{cm}^{-2}$ $\text{s}^{-1}$, with the spectrum extending up to around 5 GeV was found to be the preferred model. Morphologically, hotspots seen above 1 GeV are well-correlated with the bright western part of the radio shell. The emission is more likely to be of leptonic origin given the estimated gas density in the region and the estimated distance and age of the SNR, but a hadronic scenario cannot be ruled out. Ancora is the eighth SNR detected at high Galactic latitude with Fermi-LAT. This new population of remnants has the potential to constrain the physics of particle diffusion and escape from SNRs into the Galaxy., Comment: 11 pages, 6 figures, 4 tables. Accepted for publication in Astronomy & Astrophysics
Published: 2023

30. The Implications of Decentralization in Blockchained Federated Learning: Evaluating the Impact of Model Staleness and Inconsistencies

Author: Wilhelmi, Francesc, Afraz, Nima, Guerra, Elia, and Dini, Paolo
Subjects: Computer Science - Networking and Internet Architecture, Computer Science - Artificial Intelligence, Computer Science - Distributed, Parallel, and Cluster Computing
Abstract: Blockchain promises to enhance distributed machine learning (ML) approaches such as federated learning (FL) by providing further decentralization, security, immutability, and trust, which are key properties for enabling collaborative intelligence in next-generation applications. Nonetheless, the intrinsic decentralized operation of peer-to-peer (P2P) blockchain nodes leads to an uncharted setting for FL, whereby the concepts of FL round and global model become meaningless, as devices' synchronization is lost without the figure of a central orchestrating server. In this paper, we study the practical implications of outsourcing the orchestration of FL to a democratic setting such as in a blockchain. In particular, we focus on the effects that model staleness and inconsistencies, endorsed by blockchains' modus operandi, have on the training procedure held by FL devices asynchronously. Using simulation, we evaluate the blockchained FL operation by applying two different ML models (ranging from low to high complexity) on the well-known MNIST and CIFAR-10 datasets, respectively, and focus on the accuracy and timeliness of the solutions. Our results show the high impact of model inconsistencies on the accuracy of the models (up to a ~35% decrease in prediction accuracy), which underscores the importance of properly designing blockchain systems based on the characteristics of the underlying FL application.
Published: 2023

31. AI/ML-based Load Prediction in IEEE 802.11 Enterprise Networks

Author: Wilhelmi, Francesc, Salami, Dariush, Fontanesi, Gianluca, Galati-Giordano, Lorenzo, and Kasslin, Mika
Subjects: Computer Science - Networking and Internet Architecture, Computer Science - Artificial Intelligence, Electrical Engineering and Systems Science - Signal Processing
Abstract: Enterprise Wi-Fi networks can greatly benefit from Artificial Intelligence and Machine Learning (AI/ML) thanks to their well-developed management and operation capabilities. At the same time, AI/ML-based traffic/load prediction is one of the most appealing data-driven solutions to improve the Wi-Fi experience, either through the enablement of autonomous operation or by boosting troubleshooting with forecasted network utilization. In this paper, we study the suitability and feasibility of adopting AI/ML-based load prediction in practical enterprise Wi-Fi networks. While leveraging AI/ML solutions can potentially contribute to optimizing Wi-Fi networks in terms of energy efficiency, performance, and reliability, their effective adoption is constrained to aspects like data availability and quality, computational capabilities, and energy consumption. Our results show that hardware-constrained AI/ML models can potentially predict network load with less than 20% average error and 3% 85th-percentile error, which constitutes a suitable input for proactively driving Wi-Fi network optimization.
Published: 2023

32. Chasing Gravitational Waves with the Cherenkov Telescope Array

Author: Green, Jarred Gershon, Carosi, Alessandro, Nava, Lara, Patricelli, Barbara, Schüssler, Fabian, Seglar-Arroyo, Monica, Consortium, Cta, Abe, Kazuki, Abe, Shotaro, Acharyya, Atreya, Adam, Remi, Aguasca-Cabot, Arnau, Agudo, Ivan, Alfaro, Jorge, Alvarez-Crespo, Nuria, Batista, Rafael Alves, Amans, Jean-Philippe, Amato, Elena, Ambrosino, Filippo, Angüner, Ekrem Oguzhan, Antonelli, Lucio Angelo, Aramo, Carla, Arcaro, Cornelia, Arrabito, Luisa, Asano, Katsuaki, Aschersleben, Jann, Ashkar, Halim, Stuani, Luiz Augusto, Baack, Dominik, Backes, Michael, Balazs, Csaba, Balbo, Matteo, Larriva, Andres Baquero, Martins, Victor Barbosa, de Almeida, Ulisses Barres, Barrio, Juan Abel, Bastieri, Denis, Batista, Pedro Ivo, Batković, Ivana, Batzofin, Rowan William, Baxter, Joshua Ryo, Beck, Geoffrey, Tjus, Julia Becker, Beiske, Lukas, Belardinelli, Daniele, Benbow, Wystan, Bernardini, Elisa, Medrano, Juan Bernete, Bernlöhr, Konrad, Berti, Alessio, Beshley, Vasyl, Bhattacharjee, Pooja, Bhattacharyya, Saptashwa, Bi, Baiyang, Biederbeck, Noah, Biland, Adrian, Bissaldi, Elisabetta, Blanch, Oscar, Blazek, Jiri, Boisson, Catherine, Bolmont, Julien, Bonnoli, Giacomo, Bordas, Pol, Bošnjak, Željka, Bradascio, Federica, Braiding, Catherine, Bronzini, Ettore, Brose, Robert, Brown, Anthony M., Brun, Francois, Brunelli, Giulia, Bulgarelli, Andrea, Burelli, Irene, Burmistrov, Leonid, Burton, Michael, Bylund, Tomas, Calisse, Paolo Gherardo, Campoy-Ordaz, Anna, Cantlay, Brandon Khan, Capalbi, Milvia, Caproni, Anderson, Capuzzo-Dolcetta, Roberto, Carlile, Colin, Caroff, Sami, Carosi, Roberto, Carrasco, Marie-Sophie, Cascone, Enrico, Cassol, Franca, Castrejon, Noelia, Catalani, Fernando, Cerasole, Davide, Cerruti, Matteo, Chaty, Sylvain, Chen, Andrew W, Chernyakova, Maria, Chiavassa, Andrea, Chudoba, Jiří, Araujo, Carlos Henrique Coimbra, Conforti, Vito, Conte, Francesco, Contreras, Jose Luis, Cossou, Christophe, Costa, Alessandro, Costantini, Heide, Cristofari, Pierre, Cuevas, Omar, Curtis-Ginsberg, Zachary, D'Amico, Giacomo, D'Ammando, Filippo, Dadina, Mauro, Dalchenko, Mykhailo, David, Ludovic, Davids, Isak Delberth, Dazzi, Francesco, De Angelis, Alessandro, de Lavergne, Mathieu de Bony, De Caprio, Vincenzo, De Cesare, Giovanni, Pino, Elisabete M. de Gouveia Dal, De Lotto, Barbara, de Lucia, Mario, de Menezes, Raniere, de Naurois, Mathieu, Wilhelmi, Emma de Oña, De Simone, Nicola, de Souza, Vitor, Del Peral, Luis, del Valle, Maria Victoria, Delagnes, Eric, Giler, Andres Gabriel Delgado, Delgado, Carlos, Dell'aiera, Michael, Della Ceca, Roberto, Della Valle, Massimo, Della Volpe, Domenico, Depaoli, Davide, Dettlaff, Antonios, Di Girolamo, Tristano, Di Piano, Ambra, Di Pierro, Federico, Di Tria, Riccardo, Di Venere, Leonardo, Díaz-Bahamondes, Christian, Dib, Claudio, Diebold, Sebastian, Dima, Razvan, Dinesh, Adithiya, Djannati-Ataï, Arache, Djuvsland, Julia Isabel, Dominguez, Alberto, Dominik, Rune Michael, Donini, Alice, Dorner, Daniela, Dörner, Julien, Doro, Michele, Anjos, Rita de Cassia dos, Dournaux, Jean-Laurent, Dravins, Dainis, Duangchan, Chaimongkol, Dubos, Coline, Ducci, Lozenzo, Dwarkadas, Vikram V., Ebr, Jan, Eckner, Christopher, Egberts, Kathrin, Einecke, Sabrina, Elsässer, Dominik, Emery, Gabriel, Godoy, Miguel Escobar, Escudero, Juan, Esposito, Paolo, Falceta-Gonçalves, Diego, Ramazani, Vandad Fallah, Faure, Alice, Fedorova, Elena, Fegan, Stephen, Feijen, Kirsty, Feng, Qi, Ferrand, Gilles, Ferrarotto, Fabio, Fiandrini, Emanuele, Fiasson, Armand, Fioretti, Valentina, Foffano, Luca, Guiteras, Lluis Font, Fontaine, Gerard, Fröse, Stefan, Fukami, Satoshi, Fukui, Yasuo, Funk, Stefan, Gaggero, Daniele, Galanti, Giorgio, Galaz, Gaspar, Gallant, Yves A., Gallozzi, Stefano, Gammaldi, Viviana, Gasbarra, Claudio, Gaug, Markus, Ghalumyan, Arsen, Gianotti, Fulvio, Giarrusso, Marina, Giglietto, Nicola, Giordano, Francesco, Giuliani, Andrea, Glicenstein, Jean-Francois, Glombitza, Jonas, Goldoni, Paolo, González, José Mauricio, González, Maria Magdalena, Coelho, Jaziel Goulart, Granot, Jonathan, Grasso, Dario, Haro, Roger Grau, Green, David, Greenshaw, Tim, Grolleron, Guillaume, Grube, Jeff, Gueta, Orel, Gunji, Shuichi, Hadasch, Daniela, Hamal, Petr, Hanlon, William, Hara, Satoshi, Harvey, Violet M., Hashiyama, Kazuaki, Hassan, Tarek, Heller, Matthieu, Cadena, Sergio Hernández, Hie, Jonathan, Hiroshima, Nagisa, Hnatyk, Bohdan, Hnatyk, Roman, Hoffmann, Dirk, Hofmann, Werner, Holler, Markus, Horan, Deirdre, Horvath, Pavel, Hovatta, Talvikki, Hrupec, Dario, Hussain, Saqib, Iarlori, Marco, Inada, Tomohiro, Incardona, Federico, Inome, Yusuke, Inoue, Susumu, Iocco, Fabio, Ishio, Kazuma, Jamrozy, Marek, Janecek, Petr, Jankowsky, Felix, Jarnot, Christian, Jean, Pierre, Martínez, Irene Jiménez, Jin, Weidong, Jocou, Laurent, Juramy-Gilles, Claire, Jurysek, Jakub, KALEKIN, Oleg, Kantzas, Dimitrios, Karas, Vladimir, Kaufmann, Sarah, Kerszberg, Daniel, Khelifi, Bruno, Kieda, David B, Kleiner, Tobias Kai, Kluźniak, Włodzimierz, Kobayashi, Yukiho, Kohri, Kazunori, Komin, Nukri, Kornecki, Paula, Kosack, Karl, Kubo, Hidetoshi, Kushida, Junko, La Barbera, Antonino, La Palombara, Nicola, Lainez, Maria, Lamastra, Alessandra, Lapington, Jon S, Lazarevic, Sanja, Lazendic-Galloway, Jasmina, Leach, Steven, Lemoine-Goumard, Marianne, Lenain, Jean-Philippe, Leto, Giuseppe, Leuschner, Fabian, Lindfors, Elina, Linhoff, Maximilian, Liodakis, Ioannis, Loïc, Lozach, Lombardi, Saverio, Longo, Francesco, López-Coto, Rubén, López-Moya, Marcos, López-Oramas, Alicia, Loporchio, Serena, Bahilo, Julio Lozano, Luque-Escamilla, Pedro L., Macias, Oscar, Maier, Gernot, Majumdar, Pratik, Malyshev, Denys, Malyshev, Dmitry, Mandat, Dusan, Manicò, Giulio, Marinos, Peter David, Markoff, Sera, Márquez, Isabel, Marquez, Patricia, Marsella, Giovanni, Martí, Josep, Martin, Pierrick, Martínez, Gustavo Augusto, Martínez, Manel, Martinez, Oibar, Marty, Christophe, Mas-Aguilar, Alvaro, Mastropietro, Michele, Maurin, Gilles, Max-Moerbeck, Walter, Mazin, Daniel, Melkumyan, David, Menchiari, Stefano, Mestre, Enrique, Meunier, Jean-Luc, Meyer, Dominique M. -A., Miceli, Davide, Michailidis, Miltiadis, Michałowski, Jerzy, Miener, Tjark, Miranda, Jose Miguel, Mitchell, Alison, Mizote, Masaya, Mizuno, Tsunefumi, Moderski, Rafal, Mohrmann, Lars, Molero, Miguel, Molfese, Cesare, Molina, Edgar, Montaruli, Teresa, Moralejo, Abelardo, Morcuende, Daniel, Morik, Katharina, Morselli, Aldo, Moulin, Emmanuel, Zamanillo, Victor Moya, Mukherjee, Reshmi, Munari, Kevin, Muraczewski, Adam, Muraishi, Hiroshi, Nakamori, Takeshi, Nayak, Amrit, Nemmen, Rodrigo, Nickel, Lukas, Niemiec, Jacek, Nieto, Daniel, Rosillo, Mireia Nievas, Nikołajuk, Marek, Nishijima, Kyoshi, Noda, Koji, Nosek, Dalibor, Novosyadlyj, Bohdan, Novotný, Vladimír, Nozaki, Seiya, O'Brien, Paul, Ohishi, Michiko, Ohtani, Yoshiki, Okumura, Akira, Olive, Jean-François, Olmi, Barbara, Ong, Rene A., Orienti, Monica, Orito, Reiko, Orlandini, Mauro, Orlando, Elena, Ostrowski, Michal, Otte, Nepomuk, Oya, Igor, Pagano, Isabella, Pagliaro, Antonio, Palatiello, Michele, Panebianco, Gabriele, Paredes, Josep M., Parmiggiani, Nicolò, Patel, Sonal Ramesh, Pavlović, Dijana, Pe'er, Asaf, Pech, Miroslav, Pecimotika, Mario, Peresano, Michele, Pérez-Romero, Judit, Peron, Giada, Persic, Massimo, Petrucci, Pierre-Olivier, Petruk, Oleh, Pfeifle, Felix, Pintore, Fabio, Pirola, Giorgio, Pittori, Carlotta, Plard, Cyann, Podobnik, Franjo, Pohl, Martin, Pons, Estelle, Prandini, Elisa, Prast, Julie, Principe, Giacomo, Priyadarshi, Chaitanya, Produit, Nicolas, Prokhorov, Dmitry, Pueschel, Elisa, Pühlhofer, Gerd, Pumo, Maria Letizia, Punch, Michael, Quirrenbach, Andreas, Raino, Silvia, Randazzo, Nunzio, Rando, Riccardo, Ravel, Thierry, Razzaque, Soebur, Regeard, Maxime, Reichherzer, Patrick, Reimer, Anita, Reimer, Olaf, Reisenegger, Andreas, Reposeur, Thierry, Reville, Brian, Rhode, Wolfgang, Ribó, Marc, Richtler, Tom, Rieger, Frank, Roache, Emmet, Fernandez, Gonzalo Rodriguez, Frías, Maria Dolores Rodríguez, Rodríguez-Vázquez, Juan José, Romano, Patrizia, Romeo, Giuseppe, Rosado, Jaime, Rowell, Gavin P, Rudak, Bronislaw, Ruiter, Ashley J., Rulten, Cameron Boyd, Russo, Federico, Sadeh, Iftach, Saha, Lab, Saito, Takayuki, Sakurai, Shunsuke, Salzmann, Heiko, Sanchez, David, Sanchez-Conde, Miguel, Sangiorgi, Pierluca, Sano, Hidetoshi, Santander, Marcos, Santangelo, Andrea, Santos-Lima, Reinaldo, Sanuy, Andreu, Šarić, Toni, Sarkar, Arkadipta, Sarkar, Subir, Saturni, Francesco Gabriele, Savchenko, Volodymyr, Scherer, Andres, Schipani, Pietro, Schleicher, Bernd, Schovanek, Petr, Schubert, Jan Lukas, Schwanke, Ullrich, Schwefer, Georg, Scuderi, Salvatore, Arroyo, Monica Seglar, Seitenzahl, Ivo, Sergijenko, Olga, Sguera, Vito, Shang, Ruo-Yu, Sharma, Pooja, Sidibe, Guereguin Der Sylvestre, Sidoli, Lara, Siejkowski, Hubert, Siqueira, Clarissa, Sizun, Patrick, Sliusar, Vitalii, Slowikowska, Agnieszka, Sol, Helene, Specovius, Andreas, Spencer, Samuel Timothy, Spiga, Daniele, Stamerra, Antonio, Stanič, Samo, Starecki, Tomasz, Starling, Rhaana, Steppa, Constantin, Stolarczyk, Thierry, Strišković, Jelena, Strzys, Marcel C., Suda, Yusuke, Suomijarvi, Tiina, Tak, Donggeun, Takahashi, Mitsunari, Takeishi, Ryuji, Tam, Pak-Hin Thomas, Tanaka, Shuta J, Tanaka, Takaaki, Terauchi, Kenta, Testa, Vincenzo, Tibaldo, Luigi, Tibolla, Omar, Torradeflot, Francesc, Torres, Diego F., Torresi, Eleonora, Tothill, Nick, Toussenel, Francois, Touzard, Victoria, Tramacere, Andrea, Travnicek, Petr, Tripodo, Giovanni, Truzzi, Stefano, Tsiahina, Adellain, Tutone, Antonio, Vacula, Martin, Vallage, Bertrand, Vallania, Piero, Vallés, Ramon, van Eldik, Christopher, van Scherpenberg, Juliane, Vandenbroucke, Justin, Vassiliev, Vladimir, Venault, Philippe, Ventura, Sofia, Vercellone, Stefano, Verna, Gaia, Viana, Aion, Viaux, Nicolás, Vigliano, Alessandro, Vignatti, Jonatan, Vigorito, Carlo francesco, Vitale, Vincenzo, Vodeb, Veronika, Voisin, Vincent, Vorobiov, Serguei, Voutsinas, Georgios Gerasimos, Vovk, Ievgen, Waegebaert, Vincent, Wagner, Stefan Joachim, Walter, Roland, Ward, Martin, Wechakama, Maneenate, White, Richard, Wierzcholska, Alicja, Will, Martin, Williams, David A., Wohlleben, Frederik, Wolter, Anna, Yamamoto, Tokonatsu, Yamazaki, Ryo, Yang, Lili, Yoshida, Tatsuo, Yoshikoshi, Takanori, Zacharias, Michael, Sanchez, Ricardo Zanmar, Zavrtanik, Danilo, Zavrtanik, Marko, Zdziarski, Andrzej A., Zech, Andreas, Zhdanov, Valery I., Ziȩtara, Krzysztof, Živec, Miha, and Zuriaga-Puig, Jaume
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: The detection of gravitational waves from a binary neutron star merger by Advanced LIGO and Advanced Virgo (GW170817), along with the discovery of the electromagnetic counterparts of this gravitational wave event, ushered in a new era of multimessenger astronomy, providing the first direct evidence that BNS mergers are progenitors of short gamma-ray bursts (GRBs). Such events may also produce very-high-energy (VHE, > 100GeV) photons which have yet to be detected in coincidence with a gravitational wave signal. The Cherenkov Telescope Array (CTA) is a next-generation VHE observatory which aims to be indispensable in this search, with an unparalleled sensitivity and ability to slew anywhere on the sky within a few tens of seconds. New observing modes and follow-up strategies are being developed for CTA to rapidly cover localization areas of gravitational wave events that are typically larger than the CTA field of view. This work will evaluate and provide estimations on the expected number of of gravitational wave events that will be observable with CTA, considering both on- and off-axis emission. In addition, we will present and discuss the prospects of potential follow-up strategies with CTA., Comment: Presented at the 38th International Cosmic Ray Conference (ICRC 2023), 2023 (arXiv:2309.08219)
Published: 2023

33. Discovery of a Radiation Component from the Vela Pulsar Reaching 20 Teraelectronvolts

Author: Collaboration, The H. E. S. S., Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Bi, B., Böttcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bradascio, F., Breuhaus, M., Brose, R., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Bylund, T., Cangemi, F., Caroff, S., Casanova, S., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, O., Cotter, G., Mbarubucyeye, J. Damascene, Djannati-Ataï, A., Dmytriiev, A., Egberts, K., Ernenwein, J. -P., Feijen, K., Fiasson, A., de Clairfontaine, G. Fichet, Fontaine, G., Füßling, M., Funk, S., Gabici, S., Gallant, Y. A., Ghafourizadeh, S., Giavitto, G., Giunti, L., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Grondin, M. -H., Haerer, L., Haupt, M., Hinton, J. A., Hofmann, W., Holch, T. L., Holler, M., Horns, D., Huang, Zhiqiu, Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khélifi, B., Klepser, S., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Lang, R. G., Stum, S. Le, Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Leuschner, F., Lohse, T., Luashvili, A., Lypova, I., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marcowith, A., Marinos, P., Martí-Devesa, G., Marx, R., Maurin, G., Meyer, M., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Muller, J., Murach, T., Nakashima, K., de Naurois, M., Niemiec, J., Noel, A. Priyana, OBrien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Parsons, R. D., Peron, G., Pita, S., Prokhorov, D. A., Prokoph, H., Pühlhofer, G., Punch, M., Quirrenbach, A., Reichherzer, P., Reimer, A., Reimer, O., Renaud, M., Rieger, F., Rowell, G., Rudak, B., Ruiz-Velasco, E., Sahakian, V., Sailer, S., Salzmann, H., Sanchez, D. A., Santangelo, A., Sasaki, M., Schüssler, F., Schwanke, U., Shapopi, J. N. S., Sinha, A., Sol, H., Specovius, A., Spencer, S., Spir-Jacob, M., Stawarz, L., Steenkamp, R., Steinmassl, S., Steppa, C., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Tavernier, T., Terrier, R., Thorpe-Morgan, C., Tluczykont, M., Tsirou, M., Tsuji, N., van Eldik, C., Vecchi, M., Veh, J., Venter, C., Vink, J., Wagner, S. J., Werner, F., White, R., Wierzcholska, A., Wong, Yu Wun, Yassin, H., Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zhu, S. J., Zouari, S., Żywucka, N., Zanin, R., Kerr, M., Johnston, S., Shannon, R. M., and Smith, D. A.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: Gamma-ray observations have established energetic isolated pulsars as outstanding particle accelerators and antimatter factories in the Galaxy. There is, however, no consensus regarding the acceleration mechanisms and the radiative processes at play, nor the locations where these take place. The spectra of all observed gamma-ray pulsars to date show strong cutoffs or a break above energies of a few gigaelectronvolt (GeV). Using the H.E.S.S. array of Cherenkov telescopes, we discovered a novel radiation component emerging beyond this generic GeV cutoff in the Vela pulsar's broadband spectrum. The extension of gamma-ray pulsation energies up to at least 20 teraelectronvolts (TeV) shows that Vela pulsar can accelerate particles to Lorentz factors higher than $4\times10^7$. This is an order of magnitude larger than in the case of the Crab pulsar, the only other pulsar detected in the TeV energy range. Our results challenge the state-of-the-art models for high-energy emission of pulsars while providing a new probe, i.e. the energetic multi-TeV component, for constraining the acceleration and emission processes in their extreme energy limit., Comment: 38 pages, 6 figures. This preprint has not undergone peer review or any post-submission improvements or corrections. The Version of Record of this article is published in Nature Astronomy, Nat Astron (2023), and is available online at https://doi.org/10.1038/s41550-023-02052-3
Published: 2023
Full Text: View/download PDF

34. Towards Energy-Aware Federated Traffic Prediction for Cellular Networks

Author: Perifanis, Vasileios, Pavlidis, Nikolaos, Yilmaz, Selim F., Wilhelmi, Francesc, Guerra, Elia, Miozzo, Marco, Efraimidis, Pavlos S., Dini, Paolo, and Koutsiamanis, Remous-Aris
Subjects: Computer Science - Machine Learning, Computer Science - Artificial Intelligence, Computer Science - Distributed, Parallel, and Cluster Computing, Computer Science - Networking and Internet Architecture
Abstract: Cellular traffic prediction is a crucial activity for optimizing networks in fifth-generation (5G) networks and beyond, as accurate forecasting is essential for intelligent network design, resource allocation and anomaly mitigation. Although machine learning (ML) is a promising approach to effectively predict network traffic, the centralization of massive data in a single data center raises issues regarding confidentiality, privacy and data transfer demands. To address these challenges, federated learning (FL) emerges as an appealing ML training framework which offers high accurate predictions through parallel distributed computations. However, the environmental impact of these methods is often overlooked, which calls into question their sustainability. In this paper, we address the trade-off between accuracy and energy consumption in FL by proposing a novel sustainability indicator that allows assessing the feasibility of ML models. Then, we comprehensively evaluate state-of-the-art deep learning (DL) architectures in a federated scenario using real-world measurements from base station (BS) sites in the area of Barcelona, Spain. Our findings indicate that larger ML models achieve marginally improved performance but have a significant environmental impact in terms of carbon footprint, which make them impractical for real-world applications., Comment: International Symposium on Federated Learning Technologies and Applications (FLTA), 2023
Published: 2023

35. Throughput Analysis of IEEE 802.11bn Coordinated Spatial Reuse

Author: Wilhelmi, Francesc, Galati-Giordano, Lorenzo, Geraci, Giovanni, Bellalta, Boris, Fontanesi, Gianluca, and Nuñez, David
Subjects: Computer Science - Networking and Internet Architecture, Computer Science - Information Theory, Electrical Engineering and Systems Science - Signal Processing
Abstract: Multi-Access Point Coordination (MAPC) is becoming the cornerstone of the IEEE 802.11bn amendment, alias Wi-Fi 8. Among the MAPC features, Coordinated Spatial Reuse (C-SR) stands as one of the most appealing due to its capability to orchestrate simultaneous access point transmissions at a low implementation complexity. In this paper, we contribute to the understanding of C-SR by introducing an analytical model based on Continuous Time Markov Chains (CTMCs) to characterize its throughput and spatial efficiency. Applying the proposed model to several network topologies, we show that C-SR opportunistically enables parallel high-quality transmissions and yields an average throughput gain of up to 59% in comparison to the legacy 802.11 Distributed Coordination Function (DCF) and up to 42% when compared to the 802.11ax Overlapping Basic Service Set Packet Detect (OBSS/PD) mechanism.
Published: 2023

36. Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

Author: Balasubramanian, Vimal Kumar, Veličković, Dušan, Del Mar Rubio Wilhelmi, Maria, Anderton, Christopher R, Stewart, C Neal, DiFazio, Stephen, Blumwald, Eduardo, and Ahkami, Amir H
Subjects: Plant Biology, Biological Sciences, palisade mesophyll, vascular, MALDI-MSI imaging, spatial metabolomics, secondary metabolites, drought, Crop and pasture production, Plant biology
Abstract: The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.
Published: 2024

37. The reference genome and abiotic stress responses of the model perennial grass Brachypodium sylvaticum

Author: Lei, Li, Gordon, Sean P, Liu, Lifeng, Sade, Nir, Lovell, John T, Del Mar Rubio Wilhelmi, Maria, Singan, Vasanth, Sreedasyam, Avinash, Hestrin, Rachel, Phillips, Jeremy, Hernandez, Bryan T, Barry, Kerrie, Shu, Shengqiang, Jenkins, Jerry, Schmutz, Jeremy, Goodstein, David M, Thilmony, Roger, Blumwald, Eduardo, and Vogel, John P
Subjects: Biochemistry and Cell Biology, Biological Sciences, Genetics, Mathematical Sciences, Statistics, Humans, Brachypodium, Genome, Plant, Biomass, Transcriptome, Stress, Physiological, genome, perennial grass, transcriptome, abiotic stress, transposable element, Plant Genetics and Genomics, Biochemistry and cell biology
Abstract: Perennial grasses are important forage crops and emerging biomass crops and have the potential to be more sustainable grain crops. However, most perennial grass crops are difficult experimental subjects due to their large size, difficult genetics, and/or their recalcitrance to transformation. Thus, a tractable model perennial grass could be used to rapidly make discoveries that can be translated to perennial grass crops. Brachypodium sylvaticum has the potential to serve as such a model because of its small size, rapid generation time, simple genetics, and transformability. Here, we provide a high-quality genome assembly and annotation for B. sylvaticum, an essential resource for a modern model system. In addition, we conducted transcriptomic studies under 4 abiotic stresses (water, heat, salt, and freezing). Our results indicate that crowns are more responsive to freezing than leaves which may help them overwinter. We observed extensive transcriptional responses with varying temporal dynamics to all abiotic stresses, including classic heat-responsive genes. These results can be used to form testable hypotheses about how perennial grasses respond to these stresses. Taken together, these results will allow B. sylvaticum to serve as a truly tractable perennial model system.
Published: 2023

38. The vanishing of the primary emission region in PKS 1510-089

Author: Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Martins, V. Barbosa, Barnard, J., Batzofin, R., Becherini, Y., Berge, D., Bernloehr, K., Bi, B., de Lavergne, M. de Bony, Boettcher, M., Boisson, C., Bolmont, J., Borowska, J., Bouyahiaoui, M., Bradascio, F., Breuhaus, M., Brose, R., Brown, A. M., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Caroff, S., Casanova, S., Cecil, R., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Mbarubucyeye, J. Damascene, Davids, I. D., Djannati-Atai, A., Dmytriiev, A., Doroshenko, V., Egberts, K., Einecke, S., Ernenwein, J. -P., Fegan, S., Fontaine, G., Fuessling, M., Funk, S., Gabici, S., Ghafourizadeh, S., Giavitto, G., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Haerer, L., Hofmann, W., Holch, T. L., Holler, M., Horns, D., Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyski, K., Khatoon, R., Khelifi, B., Klu/'zniak, W., Komin, Nu., Kosack, K., Kostunin, D., Lang, R. G., Stum, S. Le, Leitl, F., Lemiere, A., Lenain, J. -P., Leuschner, F., Luashvili, A., Mackey, J., Marandon, V., Marchegiani, P., Marti-Devesa, G., Marx, R., Mehta, A., Meyer, M., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., de Naurois, M., Niemiec, J., Noel, A. Priyana, O'Brien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Peron, G., Prokhorov, D. A., Puehlhofer, G., Punch, M., Quirrenbach, A., Reichherzer, P., Reimer, A., Reimer, O., Ren, H., Rieger, F., Rowell, G., Rudak, B., Ricarte, H. Rueda, Ruiz-Velasco, E., Sahakian, V., Salzmann, H., Sanchez, D. A., Santangelo, A., Sasaki, M., Schuessler, F., Schutte, H. M., Schwanke, U., Shapopi, J. N. S., Sol, H., Specovius, A., Spencer, S., Stawarz, L., Steenkamp, R., Steinmassl, S., Steppa, C., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Terrier, R., Tsuji, N., van Eldik, C., van Soelen, B., Vecchi, M., Veh, J., Vink, J., Wach, T., Wagner, S. J., Wierzcholska, A., Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zouari, S., Zywucka, N., Buckley, D. A. H., Cooper, J., and Groenewald, D.
Subjects: Astrophysics - High Energy Astrophysical Phenomena, Astrophysics - Astrophysics of Galaxies
Abstract: In July 2021, PKS 1510-089 exhibited a significant flux drop in the high-energy gamma-ray (by a factor 10) and optical (by a factor 5) bands and remained in this low state throughout 2022. Similarly, the optical polarization in the source vanished, resulting in the optical spectrum being fully explained through the steady flux of the accretion disk and the broad-line region. Unlike the aforementioned bands, the very-high-energy gamma-ray and X-ray fluxes did not exhibit a significant flux drop from year to year. This suggests that the steady-state very-high-energy gamma-ray and X-ray fluxes originate from a different emission region than the vanished parts of the high-energy gamma-ray and optical jet fluxes. The latter component has disappeared through either a swing of the jet away from the line-of-sight or a significant drop in the photon production efficiency of the jet close to the black hole. Either change could become visible in high-resolution radio images., Comment: 18 pages, 4 figures, 6 tables; accepted for publication in ApJ Letters; corresponding authors: Joleen Barnard, Markus Boettcher, Hester Schutte, Michael Zacharias
Published: 2023
Full Text: View/download PDF

39. Multiwavelength Observations of the Blazar PKS 0735+178 in Spatial and Temporal Coincidence with an Astrophysical Neutrino Candidate IceCube-211208A

Author: Acharyya, A., Adams, C. B., Archer, A., Bangale, P., Bartkoske, J. T., Batista, P., Benbow, W., Brill, A., Buckley, J. H., Christiansen, J. L., Chromey, A. J., Errando, M., Falcone, A., Feng, Q., Foote, G. M., Fortson, L., Furniss, A., Gallagher, G., Hanlon, W., Hanna, D., Hervet, O., Hinrichs, C. E., Hoang, J., Holder, J., Humensky, T. B., Jin, W., Kaaret, P., Kertzman, M., Kherlakian, M., Kieda, D., Kleiner, T. K., Korzoun, N., Kumar, S., Lang, M. J., Lundy, M., Maier, G., McGrath, C. E, Millard, M. J., Millis, J., Mooney, C. L., Moriarty, P., Mukherjee, R., O'Brien, S., Ong, R. A., Pohl, M., Pueschel, E., Quinn, J., Ragan, K., Reynolds, P. T., Ribeiro, D., Roache, E., Sadeh, I., Sadun, A. C., Saha, L., Santander, M., Sembroski, G. H., Shang, R., Splettstoesser, M., Talluri, A. Kaushik, Tucci, J. V., Vassiliev, V. V., Weinstein, A., Williams, D. A., Wong, S. L., Woo, J., Aharonian, F., Aschersleben, J., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlohr, K., Bi, B., Bottcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bouyahiaoui, M., Bradascio, F., Breuhaus, M., Brose, R., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Caroff, S., Casanova, S., Cecil, R., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Dai, S., Mbarubucyeye, J. Damascene, Djannati-Atai, A., Dmytriiev, A., Doroshenko, V., Einecke, S., Ernenwein, J. -P., de Clairfontaine, G. Fichet, Filipovic, M., Fontaine, G., Fussling, M., Funk, S., Gabici, S., Ghafourizadeh, S., Giavitto, G., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Haerer, L., Hinton, J. A., Holch, T. L., Holler, M., Horns, D., Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzynski, K., Khatoon, R., Khelifi, B., Klepser, S., Kluzniak, W., Kosack, K., Kostunin, D., Lang, R. G., Stum, S. Le, Lemiere, A., Lenain, J. P., Leuschner, F., Lohse, T., Luashvili, A., Lypova, I., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marcowith, A., Marti-Devesa, G., Marx, R., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Murach, T., Nakashima, K., Niemiec, J., Noel, A. Priyana, O'Brien, P., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Peron, G., Prokhorov, D. A., Puhlhofer, G., Punch, M., Quirrenbach, A., Reichherzer, P., Reimer, A., Reimer, O., Ren, H., Renaud, M., Rieger, F., Rudak, B., Ruiz-Velasco, E., Sahakian, V., Santangelo, A., Sasaki, M., Schafer, J., Schussler, F., Schutte, H. M., Schwanke, U., Shapopi, J. N. S., Specovius, A., Spencer, S., Stawarz, L., Steenkamp, R., Steinmassl, S., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Terrier, R., van Eldik, C., Vecchi, M., Veh, J., Venter, C., Vink, J., White, R., Wierzcholska, A., Wong, Yu Wun, Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zouari, S., Zywucka, N., and Mori, K.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: We report on multiwavelength target-of-opportunity observations of the blazar PKS 0735+178, located 2.2$^\circ$ away from the best-fit position of the IceCube neutrino event IceCube-211208A detected on December 8, 2021. The source was in a high-flux state in the optical, ultraviolet, X-ray, and GeV gamma-ray bands around the time of the neutrino event, exhibiting daily variability in the soft X-ray flux. The X-ray data from Swift-XRT and NuSTAR characterize the transition between the low-energy and high-energy components of the broadband spectral energy distribution (SED), and the gamma-ray data from Fermi -LAT, VERITAS, and H.E.S.S. require a spectral cut-off near 100 GeV. Both X-ray and gamma-ray measurements provide strong constraints on the leptonic and hadronic models. We analytically explore a synchrotron self-Compton model, an external Compton model, and a lepto-hadronic model. Models that are entirely based on internal photon fields face serious difficulties in matching the observed SED. The existence of an external photon field in the source would instead explain the observed gamma-ray spectral cut-off in both leptonic and lepto-hadronic models and allow a proton jet power that marginally agrees with the Eddington limit in the lepto-hadronic model. We show a numerical lepto-hadronic model with external target photons that reproduces the observed SED and is reasonably consistent with the neutrino event despite requiring a high jet power., Comment: 21 pages, 3 figures, accepted by ApJ
Published: 2023

40. Vertex-shellings of Euclidean Oriented Matroids

Author: Hochstättler, Winfried and Wilhelmi, Michael
Subjects: Mathematics - Combinatorics, 52C40 (Primary) 90C05, 90C27 (Secondary)
Abstract: We prove that a lexicographical extension of a Euclidean oriented matroid remains Euclidean. Based on that result we show that in a Euclidean oriented matroid program there exists a topological sweep inducing a recursive atom-ordering (a shelling of the cocircuits) of the tope cell of the feasible region. We extend that sweep and obtain also a vertex-shelling of the whole oriented matroid and finally describe some connections to the notion of stackable zontope tilings and to a counterexample of a conjecture of A. Mandel., Comment: 41 pages, 7 figures
Published: 2023

41. Constraints on the intergalactic magnetic field using Fermi-LAT and H.E.S.S. blazar observations

Author: S., H. E. S., Collaborations, Fermi-LAT, Aharonian, F., Aschersleben, J., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bi, B., Bouyahiaoui, M., Breuhaus, M., Brose, R., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Bylund, T., Caroff, S., Casanova, S., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., de Bony, M., Egberts, K., Ernenwein, J. -P., de Clairfontaine, G. Fichet, Filipovic, M., Fontaine, G., Füßling, M., Funk, S., Gabici, S., Ghafourizadeh, S., Giavitto, G., Glawion, D., Glicenstein, J. F., Goswami, P., Grondin, M. -H., Haerer, L., Holch, T. L., Holler, M., Horns, D., Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzynński, K., Khatoon, R., Khélifi, B., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lenain, J. -P., Leuschner, F., Lohse, T., Luashvili, A., Lypova, I., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marcowith, A., Martí-Devesa, G., Marx, R., Meyer, M., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Muller, J., Murach, T., Nakashima, K., Niemiec, J., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Panny, S., Panter, M., Parsons, R. D., Peron, G., Prokhorov, D. A., Prokoph, H., Pühlhofer, G., Punch, M., Quirrenbach, A., Reichherzer, P., Reimer, A., Reimer, O., Reville, B., Rieger, F., Rowell, G., Rudak, B., Ruiz-Velasco, E., Sahakian, V., Sanchez, D. A., Sasaki, M., Schüussler, F., Schutte, H. M., Schwanke, U., Shapopi, J. N. S., Sol, H., Spencer, S., Steinmassl, S., Suzuki, H., Takahashi, T., Tanaka, T., Taylor, A. M., Terrier, R., Thorpe-Morgan, C., Tsirou, M., Tsuji, N., Uchiyama, Y., van Eldik, C., Veh, J., Venter, C., Wagner, S. J., White, R., Wierzcholska, A., Wong, Yu Wun, Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zouari, S., and Zywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena, Astrophysics - Cosmology and Nongalactic Astrophysics
Abstract: Magnetic fields in galaxies and galaxy clusters are believed to be the result of the amplification of intergalactic seed fields during the formation of large-scale structures in the universe. However, the origin, strength, and morphology of this intergalactic magnetic field (IGMF) remain unknown. Lower limits on (or indirect detection of) the IGMF can be obtained from observations of high-energy gamma rays from distant blazars. Gamma rays interact with the extragalactic background light to produce electron-positron pairs, which can subsequently initiate electromagnetic cascades. The $\gamma$-ray signature of the cascade depends on the IGMF since it deflects the pairs. Here we report on a new search for this cascade emission using a combined data set from the Fermi Large Area Telescope and the High Energy Stereoscopic System. Using state-of-the-art Monte Carlo predictions for the cascade signal, our results place a lower limit on the IGMF of $B > 7.1\times10^{-16}$ G for a coherence length of 1 Mpc even when blazar duty cycles as short as 10 yr are assumed. This improves on previous lower limits by a factor of 2. For longer duty cycles of $10^4$ ($10^7$) yr, IGMF strengths below $1.8\times10^{-14}$ G ($3.9\times10^{-14}$ G) are excluded, which rules out specific models for IGMF generation in the early universe., Comment: 20 pages, 7 figures, 4 tables. Accepted for publication in ApJ Letters. Auxiliary data is provided in electronic format at https://zenodo.org/record/8014311
Published: 2023
Full Text: View/download PDF

42. The hunt for PeVatrons as the origin of the most energetic photons observed in the Galaxy

Author: de Oña Wilhelmi, Emma, López-Coto, Ruben, Aharonian, Felix, Amato, Elena, Cao, Zhen, Gabici, Stefano, and Hinton, Jim
Published: 2024
Full Text: View/download PDF

43. Non-alcoholic fatty liver disease in patients with morbid obesity: the gut microbiota axis as a potential pathophysiology mechanism

Author: Cornejo-Pareja, Isabel, Amiar, Mohamed Reda, Ocaña-Wilhelmi, Luís, Soler-Humanes, Rocío, Arranz-Salas, Isabel, Garrido-Sánchez, Lourdes, Gutiérrez-Repiso, Carolina, and Tinahones, Francisco Jose
Published: 2024
Full Text: View/download PDF

44. Molecular signatures of angiogenesis inhibitors: a single-embryo untargeted metabolomics approach in zebrafish

Author: Wilhelmi, Pia, Haake, Volker, Zickgraf, Franziska M., Giri, Varun, Ternes, Philipp, Driemert, Peter, Nöth, Julia, Scholz, Stefan, Barenys, Marta, Flick, Burkhard, Birk, Barbara, Kamp, Hennicke, Landsiedel, Robert, and Funk-Weyer, Dorothee
Published: 2024
Full Text: View/download PDF

45. Constraining the cosmic-ray pressure in the inner Virgo Cluster using H.E.S.S. observations of M 87

Author: Collaboration, H. E. S. S., Aharonian, F., Benkhali, F. Ait, Arcaro, C., Aschersleben, J., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Bi, B., Böttcher, M., Boisson, C., Bolmont, J., Borowska, J., Bradascio, F., Breuhaus, M., Brose, R., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Bylund, T., Caroff, S., Casanova, S., Cecil, R., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Mbarubucyeye, J. Damascene, Djannati-Ataï, A., Egberts, K., Ernenwein, J. -P., de Clairfontaine, G. Fichet, Filipovic, M., Fontaine, G., Füßling, M., Funk, S., Gabici, S., Ghafourizadeh, S., Giavitto, G., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Grondin, M. -H., Haerer, L., Haupt, M., Hermann, G., Hinton, J. A., Holch, T. L., Horns, D., Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khatoon, R., Khélifi, B., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Leuschner, F., Lohse, T., Luashvili, A., Lypova, I., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marcowith, A., Marinos, P., Martí-Devesa, G., Marx, R., Meyer, M., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Muller, J., Nakashima, K., de Naurois, M., Niemiec, J., Noel, A. Priyana, O'Brien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Panny, S., Panter, M., Parsons, R. D., Peron, G., Pita, S., Prokhorov, D. A., Prokoph, H., Pühlhofer, G., Quirrenbach, A., Reichherzer, P., Reimer, A., Reimer, O., Renaud, M., Rieger, F., Rowell, G., Rudak, B., Velasco, E. Ruiz, Sahakian, V., Salzmann, H., Sanchez, D. A., Santangelo, A., Sasaki, M., Schäfer, J., Schüssler, F., Schwanke, U., Shapopi, J. N. S., Sol, H., Specovius, A., Spencer, S., Stawarz, Ł., Steenkamp, R., Steinmassl, S., Steppa, C., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Taylor, A. M., Terrier, R., Tsirou, M., Tsuji, N., Uchiyama, Y., van Eldik, C., van Soelen, B., Vecchi, M., Veh, J., Venter, C., Vink, J., Wach, T., Wagner, S. J., White, R., Wierzcholska, A., Wong, Yu Wun, Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zouari, S., and Żywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena, Astrophysics - Astrophysics of Galaxies
Abstract: The origin of the gamma-ray emission from M87 is currently a matter of debate. This work aims to localize the VHE (100 GeV-100 TeV) gamma-ray emission from M87 and probe a potential extended hadronic emission component in the inner Virgo Cluster. The search for a steady and extended gamma-ray signal around M87 can constrain the cosmic-ray energy density and the pressure exerted by the cosmic rays onto the intra-cluster medium, and allow us to investigate the role of the cosmic rays in the active galactic nucleus feedback as a heating mechanism in the Virgo Cluster. H.E.S.S. telescopes are sensitive to VHE gamma rays and have been utilized to observe M87 since 2004. We utilized a Bayesian block analysis to identify M87 emission states with H.E.S.S. observations from 2004 until 2021, dividing them into low, intermediate, and high states. Because of the causality argument, an extended ($\gtrsim$kpc) signal is allowed only in steady emission states. Hence, we fitted the morphology of the 120h low state data and found no significant gamma-ray extension. Therefore, we derived for the low state an upper limit of 58"(corresponding to $\approx$4.6kpc) in the extension of a single-component morphological model described by a rotationally symmetric 2D Gaussian model at 99.7% confidence level. Our results exclude the radio lobes ($\approx$30 kpc) as the principal component of the VHE gamma-ray emission from the low state of M87. The gamma-ray emission is compatible with a single emission region at the radio core of M87. These results, with the help of two multiple-component models, constrain the maximum cosmic-ray to thermal pressure ratio $X_{{CR,max.}}$$\lesssim$$0.32$ and the total energy in cosmic-ray protons (CRp) to $U_{CR}$$\lesssim$5$\times10^{58}$ erg in the inner 20kpc of the Virgo Cluster for an assumed CRp power-law distribution in momentum with spectral index $\alpha_{p}$=2.1., Comment: 15 pages, 7 figures. Accepted for publication in A&A. Corresponding authors: Victor Barbosa Martins, Stefan Ohm, Cornelia Arcaro, Natalia \.Zywucka, Mathieu de Naurois
Published: 2023
Full Text: View/download PDF

46. High energy gamma-ray emission powered by a young protostar: the case of S255 NIRS 3

Author: Wilhelmi, Emma de Oña, López-Coto, Rubén, and Su, Yang
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: Evidence of efficient acceleration of cosmic rays in massive young stellar objects has been recently reported. Among these massive protostars, S255 NIRS 3 for which extreme flaring events associated with radio jets have been detected, is one of the best objects to test this hypothesis. We search for gamma-ray emission associated with this object in Fermi-LAT data and inspect the gas content in different molecular lines using the MWISP survey. A GeV source dubbed 4FGL J0613.1+1749c lies on top of the MYSO region, where two filamentary ~10 pc CO structures extend along the same direction of the sub-parsec radio jets. We investigate the spectrum, morphology, and light curve of the gamma-ray source and compare it with the theoretical emission expected from hadronic and leptonic populations accelerated in the radio jets. We argue that the gamma-ray source could be powered by particles accelerated in the S255 NIRS 3 jets, radiating via Bremsstrahlung or proton-proton interaction, and with a synchrotron component shinning in radio from primary or secondary electrons in the case of a leptonic or hadronic population., Comment: accepted for publication in Monthly Notices of the Royal Astronomical Society
Published: 2023
Full Text: View/download PDF

47. Detection of extended gamma-ray emission around the Geminga pulsar with H.E.S.S

Author: Collaboration, H. E. S. S., Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Bi, B., Böttcher, M., Boisson, C., Bolmont, J., Borowska, J., Bouyahiaoui, M., Bradascio, F., Brose, R., Brun, F., Bruno, B., Bulik, T., Scheidlin, C. Burger, Cangemi, F., Caroff, S., Casanova, S., Celic, J., Cerruti, M., Chambery, P., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Mbarubucyeye, J. Damascene, Devin, J., Djannati-Ataï, A., Dmytriiev, A., Egberts, K., Einecke, S., Ernenwein, J. P., Feijen, K., de Clairfontaine, G. Fichet, Filipovic, M., Fontaine, G., Füssling, M., Funk, S., Gabici, S., Gallant, Y. A., Ghafourizadeh, S., Giavitto, G., Giunti, L., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Grondin, M. -H., Haerer, L., Haupt, M., Hermann, G., Hinton, J. A., Hofmann, W., Holch, T. L., Holler, M., Horns, D., Huang, Zhiqiu, Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khélifi, B., Kluźniak, W., Komin, Nu., Kosack, K., Kostunin, D., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lemoine-Goumard, M., Lenain, J. -P., Leuschner, F., Lohse, T., Luashvili, A., Lypova, I., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marcowith, A., Marinos, P., Martí-Devesa, G., Marx, R., Maurin, G., Meintjes, P. J., Meyer, M., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Muller, J., Nakashima, K., de Naurois, M., Niemiec, J., Noel, A. Priyana, O'Brien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Parsons, R. D., Peron, G., Prokhorov, D. A., Pühlhofer, G., Quirrenbach, A., Reimer, A., Reimer, O., Renaud, M., Reville, B., Rieger, F., Rowell, G., Rudak, B., Ricarte, H. Rueda, Ruiz-Velasco, E., Sahakian, V., Salzmann, H., Santangelo, A., Sasaki, M., Schüssler, F., Schutte, H. M., Schwanke, U., Shapopi, J. N. S., Sinha, A., Sol, H., Specovius, A., Spencer, S., Stawarz, Ł., Steinmassl, S., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Tavernier, T., Taylor, A. M., Terrier, R., Thorpe-Morgan, C., Tsirou, M., Tsuji, N., Vecchi, M., Venter, C., Vink, J., Wagner, S. J., White, R., Wierzcholska, A., Wong, Yu Wun, Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zouari, S., and Żywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: Geminga is an enigmatic radio-quiet gamma-ray pulsar located at a mere 250 pc distance from Earth. Extended very-high-energy gamma-ray emission around the pulsar was discovered by Milagro and later confirmed by HAWC, which are both water Cherenkov detector-based experiments. However, evidence for the Geminga pulsar wind nebula in gamma rays has long evaded detection by imaging atmospheric Cherenkov telescopes (IACTs) despite targeted observations. The detection of gamma-ray emission on angular scales > 2 deg poses a considerable challenge for the background estimation in IACT data analysis. With recent developments in understanding the complementary background estimation techniques of water Cherenkov and atmospheric Cherenkov instruments, the H.E.S.S. IACT array can now confirm the detection of highly extended gamma-ray emission around the Geminga pulsar with a radius of at least 3 deg in the energy range 0.5-40 TeV. We find no indications for statistically significant asymmetries or energy-dependent morphology. A flux normalisation of $(2.8\pm0.7)\times10^{-12}$ cm$^{-2}$s$^{-1}$TeV$^{-1}$ at 1 TeV is obtained within a 1 deg radius region around the pulsar. To investigate the particle transport within the halo of energetic leptons around the pulsar, we fitted an electron diffusion model to the data. The normalisation of the diffusion coefficient obtained of $D_0 = 7.6^{+1.5}_{-1.2} \times 10^{27}$ cm$^2$s$^{-1}$, at an electron energy of 100 TeV, is compatible with values previously reported for the pulsar halo around Geminga, which is considerably below the Galactic average., Comment: 16 pages, 15 figures, 7 tables. Accepted for publication in Astronomy & Astrophysics
Published: 2023
Full Text: View/download PDF

48. Sensitivity of the Cherenkov Telescope Array to spectral signatures of hadronic PeVatrons with application to Galactic Supernova Remnants

Author: Consortium, The Cherenkov Telescope Array, Acero, F., Acharyya, A., Adam, R., Aguasca-Cabot, A., Agudo, I., Aguirre-Santaella, A., Alfaro, J., Aloisio, R., Crespo, N. Álvarez, Batista, R. Alves, Amati, L., Amato, E., Ambrosi, G., Angüner, E. O., Aramo, C., Arcaro, C., Armstrong, T., Asano, K., Ascasibar, Y., Aschersleben, J., Backes, M., Baktash, A., Balazs, C., Balbo, M., Ballet, J., Larriva, A. Baquero, Martins, V. Barbosa, de Almeida, U. Barres, Barrio, J. A., Bastieri, D., Baxter, J. R., Tjus, J. Becker, Benbow, W., Bernardos-Martín, M. I., Bernete, J., Berti, A., Bertucci, B., Beshley, V., Bhattacharjee, P., Bhattacharyya, S., Biland, A., Bissaldi, E., Biteau, J., Blanch, O., Bordas, P., Bottacini, E., Bregeon, J., Brose, R., Bucciantini, N., Bulgarelli, A., Capasso, M., Dolcetta, R. A. Capuzzo, Caraveo, P., Cardillo, M., Carosi, R., Casanova, S., Cascone, E., Cassol, F., Catalani, F., Cerruti, M., Chadwick, P., Chaty, S., Chen, A., Chernyakova, M., Chiavassa, A., Chudoba, J., Coimbra-Araujo, C., Conforti, V., Contreras, J. L., Costa, A., Costantini, H., Cristofari, P., Crocker, R., D'Amico, G., D'Ammando, F., De Angelis, A., De Caprio, V., Pino, E. M. de Gouveia Dal, Wilhelmi, E. de Ona, de Souza, V., Delgado, C., della Volpe, D., Depaoli, D., Di Girolamo, T., Di Pierro, F., Di Tria, R., Di Venere, L., Diebold, S., Djuvsland, J. I., Donini, A., Doro, M., Anjos, R. d. C. Dos, Dwarkadas, V. V., Einecke, S., Elsässer, D., Emery, G., Evoli, C., Falceta-Goncalves, D., Fedorova, E., Fegan, S., Ferrand, G., Fiandrini, E., Filipovic, M., Fioretti, V., Fiori, M., Foffano, L., Fontaine, G., Fukami, S., Galanti, G., Galaz, G., Gammaldi, V., Gasbarra, C., Ghalumyan, A., Ghirlanda, G., Giarrusso, M., Giavitto, G., Giglietto, N., Giordano, F., Giroletti, M., Giuliani, A., Giunti, L., Godinovic, N., Coelho, J. Goulart, Gréaux, L., Green, D., Grondin, M-H., Gueta, O., Gunji, S., Hassan, T., Heller, M., Hernández-Cadena, S., Hinton, J., Hnatyk, B., Hnatyk, R., Hoffmann, D., Hofmann, W., Holder, J., Horan, D., Horvath, P., Hrabovsky, M., Hrupec, D., Inada, T., Incardona, F., Inoue, S., Ishio, K., Jamrozy, M., Janecek, P., Martínez, I. Jiménez, Jin, W., Jung-Richardt, I., Jurysek, J., Kaaret, P., Karas, V., Katz, U., Kerszberg, D., Khélifi, B., Kieda, D. B., Kissmann, R., Kleiner, T., Kluge, G., Kluzniak, W., Knödlseder, J., Kobayashi, Y., Kohri, K., Komin, N., Kornecki, P., Kubo, H., La Palombara, N., Láinez, M., Lamastra, A., Lapington, J., Lemoine-Goumard, M., Lenain, J. -P., Leone, F., Leto, G., Leuschner, F., Lindfors, E., Liodakis, I., Lohse, T., Lombardi, S., Longo, F., López-Coto, R., López-Moya, M., López-Oramas, A., Loporchio, S., Luque-Escamilla, P. L., Macias, O., Mackey, J., Majumdar, P., Mandat, D., Manganaro, M., Manicò, G., Marconi, M., Martí, J., Martínez, G., Martinez, M., Martinez, O., Mello, A. J. T. S., Menchiari, S., Meyer, D. M. -A., Micanovic, S., Miceli, D., Miceli, M., Michalowski, J., Miener, T., Miranda, J. M., Mitchell, A., Mode, B., Moderski, R., Mohrmann, L., Molina, E., Montaruli, T., Morcuende, D., Morlino, G., Morselli, A., Mosè, M., Moulin, E., Mukherjee, R., Munari, K., Murach, T., Nagai, A., Nagataki, S., Nemmen, R., Niemiec, J., Nieto, D., Rosillo, M. Nievas, Nikolajuk, M., Nishijima, K., Noda, K., Novosyadlyj, B., Nozaki, S., Ohishi, M., Ohm, S., Ohtani, Y., Okumura, A., Olmi, B., Ong, R. A., Orienti, M., Orito, R., Orlandini, M., Orlando, E., Orlando, S., Ostrowski, M., Oya, I., Pantaleo, F. R., Paredes, J. M., Patricelli, B., Pecimotika, M., Peresano, M., Pérez-Romero, J., Persic, M., Petruk, O., Piano, G., Pietropaolo, E., Pirola, G., Pittori, C., Pohl, M., Ponti, G., Prandini, E., Principe, G., Priyadarshi, C., Pueschel, E., Pühlhofer, G., Pumo, M. L., Quirrenbach, A., Rando, R., Razzaque, S., Reichherzer, P., Reimer, A., Reimer, O., Renaud, M., Reposeur, T., Ribó, M., Richtler, T., Rico, J., Rieger, F., Rigoselli, M., Riitano, L., Rizi, V., Roache, E., Romano, P., Romeo, G., Rosado, J., Rowell, G., Rudak, B., Sadeh, I., Safi-Harb, S., Saha, L., Sailer, S., Sánchez-Conde, M., Sarkar, S., Satalecka, K., Saturni, F. G., Scherer, A., Schovánek, P., Schussler, F., Schwanke, U., Scuderi, S., Seglar-Arroyo, M., Sergijenko, O., Servillat, M., Shang, R-Y., Sharma, P., Siejkowski, H., Sliusar, V., Słowikowska, A., Sol, H., Specovius, A., Spencer, S. T., Spengler, G., Stamerra, A., Stanič, S., Starecki, T., Starling, R., Stolarczyk, T., Pereira, L. A. Stuani, Suda, Y., Suomijarvi, T., Sushch, I., Tajima, H., Tam, P-H. T., Tanaka, S. J., Tavecchio, F., Testa, V., Tian, W., Tibaldo, L., Torres, D. F., Tothill, N., Vallage, B., Vallania, P., van Eldik, C., van Scherpenberg, J., Vandenbroucke, J., Acosta, M. Vazquez, Vecchi, M., Vercellone, S., Verna, G., Viana, A., Vignatti, J., Vitale, V., Vodeb, V., Vorobiov, S., Vuillaume, T., Wagner, S. J., Walter, R., White, M., Wierzcholska, A., Will, M., Williams, D., Yang, L., Yoshida, T., Yoshikoshi, T., Zaharijas, G., Zampieri, L., Zavrtanik, D., Zavrtanik, M., Zhdanov, V. I., and Živec, M.
Subjects: Astrophysics - High Energy Astrophysical Phenomena, Astrophysics - Instrumentation and Methods for Astrophysics
Abstract: The local Cosmic Ray (CR) energy spectrum exhibits a spectral softening at energies around 3~PeV. Sources which are capable of accelerating hadrons to such energies are called hadronic PeVatrons. However, hadronic PeVatrons have not yet been firmly identified within the Galaxy. Several source classes, including Galactic Supernova Remnants (SNRs), have been proposed as PeVatron candidates. The potential to search for hadronic PeVatrons with the Cherenkov Telescope Array (CTA) is assessed. The focus is on the usage of very high energy $\gamma$-ray spectral signatures for the identification of PeVatrons. Assuming that SNRs can accelerate CRs up to knee energies, the number of Galactic SNRs which can be identified as PeVatrons with CTA is estimated within a model for the evolution of SNRs. Additionally, the potential of a follow-up observation strategy under moonlight conditions for PeVatron searches is investigated. Statistical methods for the identification of PeVatrons are introduced, and realistic Monte--Carlo simulations of the response of the CTA observatory to the emission spectra from hadronic PeVatrons are performed. Based on simulations of a simplified model for the evolution for SNRs, the detection of a $\gamma$-ray signal from in average 9 Galactic PeVatron SNRs is expected to result from the scan of the Galactic plane with CTA after 10 hours of exposure. CTA is also shown to have excellent potential to confirm these sources as PeVatrons in deep observations with $\mathcal{O}(100)$ hours of exposure per source., Comment: 34 pages, 16 figures, Accepted for publication in Astroparticle Physics
Published: 2023
Full Text: View/download PDF

49. Search for the evaporation of primordial black holes with H.E.S.S

Author: collaboration, H. E. S. S., Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Boettcher, M., Backes, M., Martins, V. Barbosa, Batzo, R., Becherini, Y., Berge, D., Bi, B., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bradascio, F., Brose, R., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Caro, S., Casanova, S., Celic, J., Cerruti, M., Chand, T., Chen, A., Chibueze, O., Cotter, G., Mbarubucyeye, J. Damascene, Djannati-Atai, A., Egberts, K., van Eldik, C., Ernenwein, J. -P., Fussling, M., Fiasson, A., de Clairfontaine, G. Fichet, Fontaine, G., Gabici, S., Ghafourizadeh, S., Giavitto, G., Glawion, D., Glicenstein, J. F., Grolleron, G., Grondin, M. -H., Haerer, L., Haupt, M., Hinton, J. A., Hofmann, W., Holler, M., Horns, D., Huang, Zhiqiu, Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzynski, K., Khelifi, B., Klepser, S., Kluzniak, W., Komin, Nu., Kosack, K., Kostunin, D., Holch, T. L., Lang, R. G., Stum, S. Le, Leitl, F., Lemiere, A., Lenain, J. -P., Leuschner, F., Lohse, T., Luashvili, A., Lypova, I., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marinos, P., Marti-Devesa, G., Marx, R., Mitchell, A., Moderski, R., Mohrmann, L., Montanari, A., Moulin, E., Muller, J., Nakashima, K., de Naurois, M., Niemiec, J., O'Brien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Puehlhofer, G., Panny, S., Panter, M., Parsons, R. D., Peron, G., Noel, A. Priyana, Prokhorov, D. A., Prokoph, H., Punch, M., Quirrenbach, A., Reichherzer, P., Reimer, O., Rieger, F., Rowell, G., Rudak, B., Ricarte, H. Rueda, Sahakian, V., Salzmann, H., Sanchez, D. A., Santangelo, A., Sasaki, M., Schutte, H. M., Schwanke, U., Shapopi, J. N. S., Sol, H., Specovius, A., Spencer, S., Stawarz, L., Steenkamp, R., Steinmassl, S., Steppa, C., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Tavernier, T., Thorpe-Morgan, C., Tsuji, N., Uchiyama, Y., Vecchi, M., Veh, J., Venter, C., Vink, J., Wagner, S. J., White, R., Wierzcholska, A., Wong, Yu Wun, Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zouari, S., and Zywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: Primordial Black Holes (PBHs) are hypothetical black holes predicted to have been formed from density fluctuations in the early Universe. PBHs with an initial mass around $10^{14}-10^{15}$g are expected to end their evaporation at present times in a burst of particles and very-high-energy (VHE) gamma rays. Those gamma rays may be detectable by the High Energy Stereoscopic System (H.E.S.S.), an array of imaging atmospheric Cherenkov telescopes. This paper reports on the search for evaporation bursts of VHE gamma rays with H.E.S.S., ranging from 10 to 120 seconds, as expected from the final stage of PBH evaporation and using a total of 4816 hours of observations. The most constraining upper limit on the burst rate of local PBHs is $2000$ pc$^{-3}$ yr$^{-1}$ for a burst interval of 120 seconds, at the 95\% confidence level. The implication of these measurements for PBH dark matter are also discussed., Comment: Accepted for publication in JCAP, corresponding authors: F.Brun, J-F. Glicenstein, V. Marandon, T. Tavernier
Published: 2023
Full Text: View/download PDF

50. H.E.S.S. follow-up observations of GRB221009A

Author: Collaboration, H. E. S. S., Aharonian, F., Benkhali, F. Ait, Aschersleben, J., Ashkar, H., Backes, M., Baktash, A., Martins, V. Barbosa, Batzofin, R., Becherini, Y., Berge, D., Bernlöhr, K., Bi, B., Böttcher, M., Boisson, C., Bolmont, J., de Lavergne, M. de Bony, Borowska, J., Bouyahiaoui, M., Bradascio, F., Breuhaus, M., Brose, R., Brun, F., Bruno, B., Bulik, T., Burger-Scheidlin, C., Caroff, S., Casanova, S., Celic, J., Cerruti, M., Chand, T., Chandra, S., Chen, A., Chibueze, J., Chibueze, O., Cotter, G., Dai, S., Mbarubucyeye, J. Damascene, Devin, J., Djannati-Ataï, A., Dmytriiev, A., Doroshenko, V., Egberts, K., Einecke, S., Ernenwein, J. -P., Fegan, S., de Clairfontaine, G. Fichet, Filipovic, M., Fontaine, G., Füßling, M., Funk, S., Gabici, S., Ghafourizadeh, S., Giavitto, G., Glawion, D., Glicenstein, J. F., Goswami, P., Grolleron, G., Hinton, M. -H. Grondin J. A., Holch, T. L., Holler, M., Horns, D., Huang, Zhiqiu, Jamrozy, M., Jankowsky, F., Joshi, V., Jung-Richardt, I., Kasai, E., Katarzyński, K., Khatoon, R., Khélifi, B., Kluźniak, W., Komin, Nu., Konno, R., Kosack, K., Kostunin, D., Lang, R. G., Stum, S. Le, Leitl, F., Lemière, A., Lemoine-Goumard, M., Lenain, J. P., Leuschner, F., Lohse, T., Lypova, I., Mackey, J., Malyshev, D., Marandon, V., Marchegiani, P., Marcowith, A., Martí-Devesa, G., Marx, R., Meyer, M., Mitchell, A., Mohrmann, L., Montanari, A., Moulin, E., Murach, T., Nakashima, K., de Naurois, M., Niemiec, J., Noel, A. Priyana, O'Brien, P., Ohm, S., Olivera-Nieto, L., Wilhelmi, E. de Ona, Ostrowski, M., Panny, S., Panter, M., Parsons, R. D., Peron, G., Prokhorov, D. A., Prokoph, H., Pühlhofer, G., Punch, M., Quirrenbach, A., Reichherzer, P., Reimer, A., Reimer, O., Ren, H., Renaud, M., Reville, B., Rieger, F., Rowell, G., Rudak, B., Ruiz-Velasco, E., Sahakian, V., Salzmann, H., Santangelo, A., Sasaki, M., Schäfer, J., Schüssler, F., Schutte, H. M., Schwanke, U., Shapopi, J. N. S., Specovius, A., Spencer, S., Stawarz, Ł., Steenkamp, R., Steinmassl, S., Steppa, C., Sushch, I., Suzuki, H., Takahashi, T., Tanaka, T., Terrier, R., Tsuji, N., Uchiyama, Y., Vecchi, M., Venter, C., Vink, J., Wagner, S. J., White, R., Wierzcholska, A., Wong, Yu Wun, Zacharias, M., Zargaryan, D., Zdziarski, A. A., Zech, A., Zhu, S. J., and Żywucka, N.
Subjects: Astrophysics - High Energy Astrophysical Phenomena
Abstract: GRB221009A is the brightest gamma-ray burst ever detected. To probe the very-high-energy (VHE, $>$\!100 GeV) emission, the High Energy Stereoscopic System (H.E.S.S.) began observations 53 hours after the triggering event, when the brightness of the moonlight no longer precluded observations. We derive differential and integral upper limits using H.E.S.S. data from the third, fourth, and ninth nights after the initial GRB detection, after applying atmospheric corrections. The combined observations yield an integral energy flux upper limit of $\Phi_\mathrm{UL}^{95\%} = 9.7 \times 10^{-12}~\mathrm{erg\,cm^{-2}\,s^{-1}}$ above $E_\mathrm{thr} = 650$ GeV. The constraints derived from the H.E.S.S. observations complement the available multiwavelength data. The radio to X-ray data are consistent with synchrotron emission from a single electron population, with the peak in the SED occurring above the X-ray band. Compared to the VHE-bright GRB190829A, the upper limits for GRB221009A imply a smaller gamma-ray to X-ray flux ratio in the afterglow. Even in the absence of a detection, the H.E.S.S. upper limits thus contribute to the multiwavelength picture of GRB221009A, effectively ruling out an IC dominated scenario., Comment: 10 pages, 4 figures. Accepted for publication in APJL. Corresponding authors: J. Damascene Mbarubucyeye, H. Ashkar, S. J. Zhu, B. Reville, F. Sch\"ussler
Published: 2023
Full Text: View/download PDF

Catalog

Books, media, physical & digital resources

See catalog results

Searchworks

Select search scope, currently: Articles Catalog books, media & more in Jio Institute collections Articles journal articles & other e-resources

Search

Search Constraints

Refine your results

Search Limiters

Topic

Publication Year Range

Language

Publication Type

Journal

Region

Database

Publisher

9,407 results on '"Wilhelmi A"'

Search Results

Catalog

Select search scope, currently: Articles

Catalog

books, media & more in Jio Institute collections

Articles

journal articles & other e-resources