Search

In this study levels and types of microbial contaminants were investigated in 88 different plant-based ingredients including many that are used to manufacture dairy alternatives. Studied ingredients encompassed samples of pulses (pea, faba bean, chickpea, and mung bean), cereals/pseudocereals (oat, rice, amaranth and quinoa) and drupes (coconut, almond and cashew). The microbial analysis included: i) total viable count (TVC), ii) total aerobic mesophilic spore count (TMS), iii) heat resistant aerobic thermophilic spore count (HRTS), iv) anaerobic sulfite reducing Clostridium spore count (SRCS), and v) Bacillus cereus spore count (BCES). Microorganisms isolated from the counting plates with the highest sample dilutions were identified using 16S rRNA and MALDI-TOF MS analyses. Many of the investigated ingredients showed a high proportion of spores as part of their total aerobic mesophilic counts. In 63 % of the samples, the difference between TVC and TMS counts was 1 Log 10 unit or less. This was particularly the case for the majority of pea isolates and concentrates, faba bean isolates, oat kernels and flakes, and for single samples of chickpea isolate, almond, amaranth, rice, quinoa, and coconut flours. Concentrations of TVC ranged between <1.0 and 5.3 Log 10 CFU/g in different samples, and TMS varied between <1.0 and 4.1 Log 10 CFU/g. Levels of HTRS, BCES and SRCS were generally low, typically around or below the LOD of 1.0 Log 10 CFU/g. In total, 845 individual bacterial colonies were isolated belonging to 33 different genera. Bacillus licheniformis and B. cereus group strains were most frequently detected among Bacillus isolates, and these species originated primarily from pea and oat samples. Geobacillus stearothermophilus was the main species encountered as part of the HRTS. Among the Clostridium isolates, Clostridum sporogenes/tepidum were predominant species, which were mostly found in pea and almond samples. Strains with potential to cause foodborne infection or intoxication were typed using the PCR-based method for toxin genes detection. In the B. cereus group, 9 % of isolates contained the ces gene, 28 % contained hbl, 42 % cytK, and 69 % were positive for the nhe gene. Absence of the boNT-A and -B genes was confirmed for all isolated C. sporogenes/tepidum strains. Nearly all (98 %) B. licheniformis isolates were positive for the lchAA gene. Insight into the occurrence of microbial contaminants in plant-based ingredients, combined with knowledge of their key inactivation and growth characteristics, can be used for the microbial risk assessment and effective design of plant-based food processing conditions and formulations to ensure food safety and prevent spoilage., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 The Authors. Published by Elsevier B.V. All rights reserved.)

Background: The Bacillus cereus Sigma B (SigB) dependent general stress response is activated via the two-component RsbKY system, which involves a phosphate transfer from RsbK to RsbY. It has been hypothesized that the Hpr-like phosphocarrier protein (Bc1009) encoded by bc1009 in the SigB gene cluster may play a role in this transfer, thereby acting as a regulator of SigB activation. Alternatively, Bc1009 may be involved in the activation of a subset of SigB regulon members., Results: We first investigated the potential role of bc1009 to act as a SigB regulator but ruled out this possibility as the deletion of bc1009 did not affect the expression of sigB and other SigB gene cluster members. The SigB-dependent functions of Bc1009 were further examined in B. cereus ATCC14579 via comparative proteome profiling (backed up by transcriptomics) of wt, Δbc1009 and ΔsigB deletion mutants under heat stress at 42 °C. This revealed 284 proteins displaying SigB-dependent alterations in protein expression levels in heat-stressed cells, including a subgroup of 138 proteins for which alterations were also Bc1009-dependent. Next to proteins with roles in stress defense, newly identified SigB and Bc1009-dependent proteins have roles in cell motility, signal transduction, transcription, cell wall biogenesis, and amino acid transport and metabolism. Analysis of lethal stress survival at 50 °C after pre-adaptation at 42 °C showed intermediate survival efficacy of Δbc1009 cells, highest survival of wt, and lowest survival of ΔsigB cells, respectively. Additional comparative proteome analysis of non-stressed wt and mutant cells at 30 °C revealed 96 proteins with SigB and Bc1009-dependent differences in levels: 51 were also identified under heat stress, and 45 showed significant differential expression at 30 °C. This includes proteins with roles in carbohydrate/ion transport and metabolism. Overlapping functions at 30 °C and 42 °C included proteins involved in motility, and ΔsigB and Δbc1009 cells showed reduced motility compared to wt cells in swimming assays at both temperatures., Conclusion: Our results extend the B. cereus SigB regulon to > 300 members, with a novel role of SigB-dependent Bc1009 in the activation of a subregulon of  > 180 members, conceivably via interactions with other transcriptional regulatory networks., (© 2023. The Author(s).)

Background: Sigma factor B (SigB) is the central regulator of the general stress response in Bacillus subtilis and regulates a group of genes in response to various stressors, known as the SigB regulon members. Genes that are directly regulated by SigB contain a promotor binding motif (PBM) with a previously identified consensus sequence., Results: In this study, refined SigB PBMs were derived and different spacer compositions and lengths (N 12 -N 17 ) were taken into account. These were used to identify putative SigB-regulated genes in the B. subtilis genome, revealing 255 genes: 99 had been described in the literature and 156 genes were newly identified, increasing the number of SigB putative regulon members (with and without a SigB PBM) to > 500 in B. subtilis. The 255 genes were assigned to five categories (I-V) based on their similarity to the original SigB consensus sequences. The functionalities of selected representatives per category were assessed using promoter-reporter fusions in wt and ΔsigB mutants upon exposure to heat, ethanol, and salt stress. The activity of the P rsbV (I) positive control was induced upon exposure to all three stressors. P ytoQ (II) showed SigB-dependent activity only upon exposure to ethanol, whereas P pucI (II) with a N 17 spacer and P ylaL (III) with a N 16 spacer showed mild induction regardless of heat/ethanol/salt stress. P ywzA (III) and P yaaI (IV) displayed ethanol-specific SigB-dependent activities despite a lower-level conserved - 10 binding motif. P gtaB (V) was SigB-induced under ethanol and salt stress while lacking a conserved - 10 binding region. The activities of P ygaO and P ykaA (III) did not show evident changes under the conditions tested despite having a SigB PBM that highly resembled the consensus. The identified extended SigB regulon candidates in B. subtilis are mainly involved in coping with stress but are also engaged in other cellular processes. Orthologs of SigB regulon candidates with SigB PBMs were identified in other Bacillales genomes, but not all showed a SigB PBM. Additionally, genes involved in the integration of stress signals to activate SigB were predicted in these genomes, indicating that SigB signaling and regulon genes are species-specific., Conclusion: The entire SigB regulatory network is sophisticated and not yet fully understood even for the well-characterized organism B. subtilis 168. Knowledge and information gained in this study can be used in further SigB studies to uncover a complete picture of the role of SigB in B. subtilis and other species., (© 2023. The Author(s).)

Bacillus licheniformis can cause foodborne intoxication due to the production of the surfactant lichenysin. The aim of this study was to measure the production of lichenysin by food isolates of B. licheniformis in LB medium and skimmed milk and its cytotoxicity for intestinal cells. Out of 11 B. licheniformis isolates tested, most showed robust growth in high salt (1M NaCl), 4% ethanol, at 37 or 55°C, and aerobic and anaerobic conditions. All strains produced lichenysin (in varying amounts), but not all strains were hemolytic. Production of this stable compound by selected strains (high producers B4094 and B4123, and type strain DSM13 T ) was subsequently determined using LB medium and milk, at 37 and 55°C. Lichenysin production in LB broth and milk was not detected at cell densities < 5 log 10 CFU/ml. The highest concentrations were found in the stationary phase of growth. Total production of lichenysin was 4-20 times lower in milk than in LB broth (maximum 36 μg/ml), and ∼10 times lower in the biomass obtained from milk agar than LB agar. Under all conditions tested, strain B4094 consistently yielded the highest amounts. Besides strain variation and medium composition, temperature also had an effect on lichenysin production, with twofold lower amounts of lichenysin produced at 55°C than at 37°C. All three strains produced lichenysin A with varying acyl chain lengths (C11-C18). The relative abundance of the C14 variant was highest in milk and the C15 variant highest in LB. The concentration of lichenysin needed to reduce cell viability by 50% (IC 50 ) was 16.6 μg/ml for Caco-2 human intestinal epithelial cells and 16.8 μg/ml for pig ileum organoids. Taken together, the presence of low levels (<5 log 10 CFU/ml) of B. licheniformis in foods is unlikely to pose a foodborne hazard related to lichenysin production. However, depending on the strain present, the composition, and storage condition of the food, a risk of foodborne intoxication may arise if growth to high levels is supported and such product is ingested., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Yeak, Perko, Staring, Fernandez-Ciruelos, Wells, Abee and Wells-Bennik.)

Undissociated lactic acid has been shown to play a major role in complete growth inhibition of Listeria monocytogenes in Gouda cheese. In addition, low water activity conditions may contribute to growth inhibition. In the current study, it was assessed whether the major factors that inhibit growth of L. monocytogenes in Gouda cheese are the factors that determine growth in other types of ready-to-eat cheese as well. Various types of cheeses were selected, some of which had been associated with listeriosis, while others had not. Based on the composition of the different cheese types, the concentrations of undissociated lactic acid were calculated for each type. The ability to support growth of L. monocytogenes was predicted using the Gamma model, based on literature data on total lactic acid content, moisture content, fat content, pH, Aw, and temperature, and optimal growth rates in milk at 30-37 °C. In addition, the actual specific growth rates of L. monocytogenes in the various cheeses were calculated based on available experimental growth data. In 9 out of the 10 RTE cheeses reviewed, the undissociated lactic acid concentrations and a w determined growth/no growth of L. monocytogenes. No growth was correctly predicted for feta, Cheddar and Gouda, and growth was correctly predicted for ricotta, queso fresco, Camembert, high-moisture mozzarella, cottage and blue cheese. Growth of L. monocytogenes was not observed in practice upon inoculation of Emmental, whereas growth in this cheese type was predicted when including the above mentioned factors in the models. Other factors, presumably acetic and propionic acid, are thought to be important to inhibit growth of the pathogen in Emmental. The results from our study show that for cheeses in which lactic acid is a main acid, our model based on undissociated lactic acid, temperature, pH and a w gives a good prediction of potential outgrowth of L. monocytogenes. Implications for L. monocytogenes legislation are discussed per type of RTE cheese reviewed., (Copyright © 2021 The Authors. Published by Elsevier B.V. All rights reserved.)

Abstract: The presence of bacterial spores in cocoa powders is inevitable due to the cocoa bean fermentation process, during which members of the genera Bacillus and Geobacillus are typically present. Spores are a concern in heat-treated foods when they survive heat treatments and the finished product supports germination, growth, and potentially toxin production. In this study, available methods for the enumeration of total mesophilic and thermophilic spores (TMS and TTS, respectively) were evaluated, leading to the recommendation of one global method specifically for cocoa powders. The proposed method was validated during a ring test on seven selected cocoa powders and applied during routine analyses on commercial powders. The method includes dilution of cocoa powder using buffered peptone water, heating at 80°C for 10 min for TMS and TTS counts, and heating at 100°C for 30 min for a heat-resistant (HR) spore count. Tryptic soy agar is used as a recovery medium with a maximal concentration of cocoa powder of 2.5 mg/mL (to prevent growth inhibition) and a nonnutrient agar overlay to prevent swarming of bacteria. Plates are incubated for at least 72 h at 30°C for recovery of mesophilic bacteria and 55°C for thermophilic bacteria. Suitable alternatives to specific method parameters are provided. Median values of total spore concentrations are low (<400 CFU/g for TMS and <75 CFU/g for TTS), and concentrations of HR spores are very low (<5 CFU/g). Importantly, the relation between concentrations of HR spores in cocoa powder and incidence of spoilage of heat-treated beverages containing cocoa is currently unclear. In the powders included in this study, Bacillus subtilis and Bacillus licheniformis were the predominant spore-forming species identified (49 and 39%, respectively). Both species are known for high variability in spore heat resistance. The development of reliable and sensitive molecular methods is therefore required to assess the risk of spoilage caused by spores present in cocoa powders., (Published 2020 by the International Association for Food Protection.)

In this study, different methods were evaluated for enumeration of spores of G. stearothermophilus, different sporulation methods were assessed for yields and wet heat resistances of obtained spores, and subsequently, the variation in heat resistances of spores was determined. Overall, tryptone soya agar (TSA) was the most suitable medium for enumeration of spores of this thermophilic bacterium. Sporulation on different media both at 55 and at 61 °C led to considerable variation in spore heat resistance. The heat resistance of spores was highest upon sporulation on medium supplemented with free ions of calcium, potassium, magnesium and manganese (CaKMgMn). For 18 different G. stearothermophilus strains that were isolated from various sources, spores were subsequently produced on nutrient agar supplemented with CaKMgMn at 55 °C. Strain ATCC 12980 T , also known as 9A20, which is commonly used in steam sterilization tests was included. The survival of spores of all strains was assessed at 125 °C and 130 °C using two independent spore batches per strain. The mean D 125°C for spores of the 18 strains was 1.1 min (95% PI 0.48-2.3 min) and the mean D 130°C was 0.37 min (95% PI 0.17-0.82 min). For spore inactivation of these 18 strains, a z-value of 11.1 °C was estimated, resulting in an estimated D-value of 2.4 min (95% PI 1.1-5.2) at the reference temperature 121.1 °C. Based on the data sets obtained in this study, it was found that the variability in spore heat resistance could largely be attributed to strain variability and conditions used during sporulation (especially the sporulation medium); reproduction and experimental variabilities were much smaller. The established variabilities were compared with the overall variability in spore heat resistance of G. stearothermophilus based on a meta-analysis of reported D-values. The data presented indicate that strain variability and history of sporulation each account for approximately half of the overall variability observed with respect to the heat resistance of spores of G. stearothermophilus. The findings presented in this study allow for optimal recovery of G. stearothermophilus spores from foods and a better understanding of factors that determine the heat resistance properties of spores of G. stearothermophilus. Moreover, this study once more underlines the limited effects of heat treatments used in the food industry on inactivation of spores of this bacterium., (Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.)

According to the World Health Organization estimates in 2015, 600 million people fall ill every year from contaminated food and 420,000 die. Microbial risk assessment (MRA) was developed as a tool to reduce and prevent risks presented by pathogens and/or their toxins. MRA is organized in four steps to analyse information and assist in both designing appropriate control options and implementation of regulatory decisions and programs. Among the four steps, hazard characterisation is performed to establish the probability and severity of a disease outcome, which is determined as function of the dose of toxin and/or pathogen ingested. This dose-response relationship is subject to both variability and uncertainty. The purpose of this review/opinion article is to discuss how Next Generation Omics can impact hazard characterisation and, more precisely, how it can improve our understanding of variability and limit the uncertainty in the dose-response relation. The expansion of omics tools (e.g. genomics, transcriptomics, proteomics and metabolomics) allows for a better understanding of pathogenicity mechanisms and virulence levels of bacterial strains. Detection and identification of virulence genes, comparative genomics, analyses of mRNA and protein levels and the development of biomarkers can help in building a mechanistic dose-response model to predict disease severity. In this respect, systems biology can help to identify critical system characteristics that confer virulence and explain variability between strains. Despite challenges in the integration of omics into risk assessment, some omics methods have already been used by regulatory agencies for hazard identification. Standardized methods, reproducibility and datasets obtained from realistic conditions remain a challenge, and are needed to improve accuracy of hazard characterisation. When these improvements are realized, they will allow the health authorities and government policy makers to prioritize hazards more accurately and thus refine surveillance programs with the collaboration of all stakeholders of the food chain., (Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.)

Heat treatments are widely used in food processing often with the aim of reducing or eliminating spoilage microorganisms and pathogens in food products. The efficacy of applying heat to control microorganisms is challenged by the natural diversity of microorganisms with respect to their heat robustness. This review gives an overview of the variations in heat resistances of various species and strains, describes modeling approaches to quantify heat robustness, and addresses the relevance and impact of the natural diversity of microorganisms when assessing heat inactivation. This comparison of heat resistances of microorganisms facilitates the evaluation of which (groups of) organisms might be troublesome in a production process in which heat treatment is critical to reducing the microbial contaminants, and also allows fine-tuning of the process parameters. Various sources of microbiological variability are discussed and compared for a range of species, including spore-forming and non-spore-forming pathogens and spoilage organisms. This benchmarking of variability factors gives crucial information about the most important factors that should be included in risk assessments to realistically predict heat inactivation of bacteria and spores as part of the measures for controlling shelf life and safety of food products.

Realistic prediction of microbial inactivation in food requires quantitative information on variability introduced by the microorganisms. Bacillus subtilis forms heat resistant spores and in this study the impact of strain variability on spore heat resistance was quantified using 20 strains. In addition, experimental variability was quantified by using technical replicates per heat treatment experiment, and reproduction variability was quantified by using two biologically independent spore crops for each strain that were heat treated on different days. The fourth-decimal reduction times and z-values were estimated by a one-step and two-step model fitting procedure. Grouping of the 20 B. subtilis strains into two statistically distinguishable groups could be confirmed based on their spore heat resistance. The reproduction variability was higher than experimental variability, but both variabilities were much lower than strain variability. The model fitting approach did not significantly affect the quantification of variability. Remarkably, when strain variability in spore heat resistance was quantified using only the strains producing low-level heat resistant spores, then this strain variability was comparable with the previously reported strain variability in heat resistance of vegetative cells of Listeria monocytogenes, although in a totally other temperature range. Strains that produced spores with high-level heat resistance showed similar temperature range for growth as strains that produced low-level heat resistance. Strain variability affected heat resistance of spores most, and therefore integration of this variability factor in modelling of spore heat resistance will make predictions more realistic., (Copyright © 2017. Published by Elsevier B.V.)

Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases spore responsiveness to nutrient germination triggers, among 17 strains of B. subtilis , including 9 isolates from spoiled food products. Spores of industrial foodborne isolates exhibited, on average, less efficient and slower germination responses and required more severe heat activation than spores from other sources. High heat activation requirements and inefficient, slow germination correlated with elevated resistance of spores to heat and with specific genetic features, indicating a common genetic basis of these three phenotypic traits. Clearly, interstrain variation and numerous factors that shape spore germination behavior challenge standardization of methods to recover highly heat-resistant spores from the environment and have an impact on the efficacy of preservation techniques used by the food industry to control spores., (Copyright © 2017 American Society for Microbiology.)

Spore germination of 17 Bacillus cereus food isolates and reference strains was evaluated using flow cytometry analysis in combination with fluorescent staining at a single-spore level. This approach allowed for rapid collection of germination data under more than 20 conditions, including heat activation of spores, germination in complex media (brain heart infusion [BHI] and tryptone soy broth [TSB]), and exposure to saturating concentrations of single amino acids and the combination of alanine and inosine. Whole-genome sequence comparison revealed a total of 11 clusters of operons encoding germinant receptors (GRs): GerK, GerI, and GerL were present in all strains, whereas GerR, GerS, GerG, GerQ, GerX, GerF, GerW, and GerZ (sub)clusters showed a more diverse presence/absence in different strains. The spores of tested strains displayed high diversity with regard to their sensitivity and responsiveness to selected germinants and heat activation. The two laboratory strains, B. cereus ATCC 14579 and ATCC 10987, and 11 food isolates showed a good germination response under a range of conditions, whereas four other strains (B. cereus B4085, B4086, B4116, and B4153) belonging to phylogenetic group IIIA showed a very weak germination response even in BHI and TSB media. Germination responses could not be linked to specific (combinations of) GRs, but it was noted that the four group IIIA strains contained pseudogenes or variants of subunit C in their gerL cluster. Additionally, two of those strains (B4086 and B4153) carried pseudogenes in the gerK and gerR I (sub)clusters that possibly affected the functionality of these GRs., Importance: Germination of bacterial spores is a critical step before vegetative growth can resume. Food products may contain nutrient germinants that trigger germination and outgrowth of Bacillus species spores, possibly leading to food spoilage or foodborne illness. Prediction of spore germination behavior is, however, very challenging, especially for spores of natural isolates that tend to show more diverse germination responses than laboratory strains. The approach used has provided information on the genetic diversity in GRs and corresponding subclusters encoded by B. cereus strains, as well as their germination behavior and possible associations with GRs, and it provides a basis for further extension of knowledge on the role of GRs in B. cereus (group member) ecology and transmission to the host., (Copyright © 2017 American Society for Microbiology.)

This study describes the diffusion of NaCl and water in Gouda cheese during brining and ripening. Furthermore, we established water activity as a function of the NaCl-in-moisture content in Gouda cheese during ripening. We determined NaCl content, water content, and water activity in block-type Gouda cheeses that were brined for 3.8d and foil-ripened for a period of 26 wk, and in wheel-type Gouda cheeses that were brined for 0.33, 2.1, or 8.9d and subsequently nature-ripened for a period of 26 wk. The calculated diffusion coefficients of NaCl during brining were 3.6·10(-10) m(2)s(-1) in the block-type Gouda cheeses and 3.5·10(-10) m(2)s(-1) in the wheel-type Gouda cheeses. Immediately after brining, gradients of NaCl and water were observed throughout both types of cheese. During ripening, these gradients disappeared, except for the water gradient in nature-ripened cheeses. An empirical model was derived for Gouda cheese, in which water activity is expressed as a function of the NaCl-in-moisture content, as established for different brining times, locations and ripening times. Moreover, the effect of reduced water activity on inhibition of growth of Listeria monocytogenes in Gouda cheese was calculated. In addition to the presence of lactate and a pH of 5.2 to 5.3, the reduced water activity as seen in Gouda cheese can substantially contribute to inhibition of microbial growth and even to inactivation when cheeses are brined and ripened for extended times and subjected to nature-ripening., (Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.)

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DeltarecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2) and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

The food-borne pathogen Listeria monocytogenes has the ability to survive extreme environmental conditions due to an extensive interacting network of stress responses. It is able to grow and survive at relatively high temperatures in comparison with other non-sporulating food-borne pathogens. To investigate the heat-shock response of L. monocytogenes, whole-genome expression profiles of cells that were grown at 37 degrees C and exposed to 48 degrees C were examined using DNA microarrays. Transcription levels were measured over a 40 min period after exposure of the culture to 48 degrees C and compared with those of unexposed cultures at 37 degrees C. After 3 min, 25 % of all genes were differentially expressed, while after 40 min only 2 % of all genes showed differential expression, indicative of the transient nature of the heat-shock response. The global transcriptional response was validated by analysing the expression of a set of 13 genes by quantitative PCR. Genes previously identified as part of the class I and class III heat-shock response and the class II stress response showed induction at one or more of the time points investigated. This is believed to be the first study to report that several heat-shock-induced genes are part of the SOS response in L. monocytogenes. Furthermore, numerous differentially expressed genes that have roles in the cell division machinery or cell wall synthesis were down-regulated. This expression pattern is in line with the observation that heat shock results in cell elongation and prevention of cell division.