Search

Milnesium tardigradum sensu stricto Doyère, 1840 (Figs 12–15, Table 3) Material examined. Neotype, 46 neoparatypes (all females), 2 exuvia with eggs mounted in Hoyer’s medium and eight additional specimens used for molecular analysis (COI and ITS 2 region sequencing): Zeesen, Wildau, Germany, 52 ° 16 ' 52 ''N and 13 ° 38 ' 23 ''E, 37 m asl, moss and lichen sample from a roof, 11.02. 2011, coll. Marcus Frohme. Description (measurements in Table 3). Body white/transparent in small individuals and yellowish to brownish in large ones. Eyes were present in 70 % of examined individuals (fixed in Hoyer’s medium). Cuticle smooth, without granulation or pores (Fig. 12). Two lateral and six peribuccal papillae present (ventral papilla smaller than other papillae). Buccal apparatus of the Milnesium type (Fig. 13). Six peribuccal lamellae around the mouth opening present. Buccal tube cylindrical (anterior and posterior diameters similar). Pharyngeal bulb elongated, pear-shaped and without placoids or septulum. Claws of the Milnesium type, slender (Figs 14–15). Primary branches on all legs with small, but distinct accessory points detaching from the branch at its greatest curvature. Secondary branches with rounded basal thickenings. Secondary branches of external claws I–III and posterior claws IV with two points, and secondary branches of internal claws I–III and anterior claws IV with three points (i.e. claw configuration: [2-3]-[3 - 2]). Single, long transversal, cuticular bars under claws I–III present (Fig. 14). CHARACTER N RANGE MEAN SD Neotype µm pt µm pt µm pt µm pt Posterior base + secondary branch 14 16.0 – 10.6 44.9 – 36.2 13.7 40.3 1.5 2.1 10.6 36.2 Eggs are oval, smooth and deposited in exuvium (in the two exuvia we found there were 6 and 8 eggs respectively). AGATATTGGGATATTATATTTTATTTTTGGTATTTGATGTGCTTTTGGTGGATCAGCCTTAAGTATGTTAATTCGT CTTGAGTTGTCTCAACCTAATACAATACTAATAAGTGAAGATATTTATAATGCGTTTATTACAAGTCATGCATTAG TAATAATTTTTTTTTTTGTTATACCTGTTTTAATTGGGGGCTTTGGAAATTGATTAGTTCCTTTAATAATTAGTTC ACCAGATATAGCTTTTCCACGAGTTAATAATGTCAGATTTTGAATATTGGTTGCTTCATTTATGTTATTAGTGTAT AGAATATTTTGTGGAGAGGGTGTTGGTGCTGGTTGGACTCTTTACCCTCCATTAACTAATATTTATGGCCATAGAA GAACAGCAGTTGATTATGCAATTTTATCATTACACATTGCTGGTGCTTCTTCTATTTTTAGAGCTATGAATTTTTT AACTACAATTTTTAATATACATTATTTTGGAGTTCGTATAGATAAGTTGCCTTTATTTGTTTGGTCAATTTTTATT ACAGCCTTGTTATTAGTGTTAGCTCTTCCGGTATTGGCTGGGGCTATTACTATATTGATTGCAGATCGTAATTTTG ATACTTCCTTTTTTGATCCTGCAGGGGGAGG AACGAAAATAAACCTGATAGCTACGTGTTTGCTATCGATTGTTTGTCATTCTCTACTGGCCTGCTTCTGTCTTCTC AGAGCAGAGCCAGGTTAAGGCTGACAGATGAAGTTTCGACCCTATGACGAGCGTGCTTCTTGATCTGTAGCAGATC GGAAGCCGACGCGTATCCATACATTTTGTGTACAAAGGACTGTATGATGAAAGTAGGTTGGCGGTCGCTGATGGGC GCTCTATTATCGCTTAGCTAGCAGTGCATGCGGCAGTTTTGCACAGATTGCTAGCGGTGTTTAGAGACGCTTGGCT AACCGAACGACAGTCCATTTTCCTTGTACGCAATCGGTATTGGAGCCATACGCGCTTCGGCTTTGAGTACAGATAT CAGTACGCTGAATTGTCATAGGTTGTAGACTGTATGCGTGCTTAACGCGTTACACACTCATTACGT Neotype locality. Zeesen, Wildau, Germany, 52 ° 16 ' 53 ''N and 13 ° 38 ' 23 ''E, 37 m asl, moss and lichen from a roof. Distribution. All previous records of M. tardigradum will now need to be re-examined; therefore not much can be stated regarding the species geographic distribution. Nevertheless, we can hypothesise that M. tardigradum s.s. is likely to be found throughout Europe, but it may also have a wider, Palearctic or Holoarctic range. Etymology. Louis Doyère named the genus after a French zoologist, Henri Milne-Edwards. The specific name comes from Spallanzani (1777), who first described specimens of Milnesium as ‘Tardigrado’. Type depositories. Neotype and 46 neoparatypes mounted in Hoyer’s medium are preserved at the Department of Animal Taxonomy and Ecology, A. Mickiewicz University, Umultowska 89, 61- 614 Poznań, Poland. Comparison with the original description. Specimens we designated as a new type series correspond well with the description and drawings in Doyère (1840). The cuticle appears to be smooth, buccal tube cylindrical and the claw configuration is [2-3]-[3 - 2]. Although in Doyère (1840) the claws were drawn without accessory points, we have assumed they were present M. tardigradum s.s., and have based our assumption on two reasons: (1) Doyère (1840) did not draw accessory points in any of his figures (e.g. all known Ramazzottius and Macrobiotus species have accessory points, whereas in Doyère’s drawings of these genera such structures were not shown); (2) only five, of seventeen known Milnesium species, do not have accessory points and none of these were for European records. Differential diagnosis. Apart from M. tardigradum s.s., there are four other described Milnesium species with the claw configuration [2-3]-[3 - 2]. M. tardigradum s.s. differs specifically from: M. krzysztofi by having smooth dorso-lateral cuticle (reticulated in M. krzysztofi). M. reductum Tumanov, 2006 by the presence of accessory points on the primary branches of claws (accessory points absent in M. reductum). M. reticulatum by having smooth dorso-lateral cuticle (reticulated and with gibbosities in M. reticulatum) and six peribuccal lamellae (four in M. reticulatum). M. tetralamellatum by having six peribuccal lamellae (four in M. tetralamellatum). In other words, smooth cuticle, the presence of accessory points on the primary branches of all claws, six peribuccal lamellae and cylindrical buccal tube create a unique combination of characters within the group of Milnesium species with the [2-3]-[3 - 2] claw configuration. Thus, we conclude that it is most unlikely that any synonym species of M. tardigradum s.s. have been described since Doyère (1840).

Milnesium eurystomum Maucci, 1991 (Figs 1–6, Table 2) Material examined. Holotype: Female from Southern Greenland, near Narssaq and around the Narssarssuaq airfield, along the road from the airfield to the Kiagtut glacier; Sermiat, on the front of the ‘Inlandsis’, ca. 61 ° 10 'N and 45 ° 23 'W, ca. 100 m asl, moss and lichen sample from a sun-exposed rock, 1987, coll. Walter Maucci. Female from Svalbard, Spitsbergen: Northern part of the Revdalen Valley, near the Revvatnet lake and the Revelva river, 77 °01' 41 ''N and 15 ° 22 ' 21 ''E, 67 m asl, moss from rock, 26.06. 2010., coll. Łukasz Kaczmarek and Jerzy Smykla. Description (measurements in Table 2). Body brownish, eyes present (but not visible after preparation). Cuticle smooth, without granulation or pores (Figs 1–2). Two lateral and six peribuccal papillae present (ventral papilla smaller than other papillae). Spitsbergen of Milnesium eurystomum and a paratype of Milnesium granulatum Ramazzotti, 1962. CHARACTER M. eurystomum M. granulatum Holotype Spitsbergen Paratype µm pt µm pt µm pt Buccal apparatus of the Milnesium type (Figs 3–4). Six peribuccal lamellae around the mouth opening present. Buccal tube wide and short (buccal tube standard width on average 63 % of its length), and funnel-shaped, wider anteriorly (posterior diameter on average 69 % of the anterior diameter). Pharyngeal bulb elongated, pear-shaped and without placoids or septulum. Claws of the Milnesium type, slender (Figs 5–6). Primary branches on all legs with small, but distinct accessory points detaching from the branch at its greatest curvature. Secondary branches with rounded basal thickenings. All secondary branches on all legs with three points (i.e. claw configuration: [3 - 3]-[3 - 3]). Single, long transversal, cuticular bars under claws I–III present (Fig. 5). Although eggs were not described by Maucci (1991) nor found in the Spitsbergen samples, we should probably expect them to be oval, smooth and deposited in exuvium as in all other known Milnesium species. Remarks. The specimen of M. eurystomum that was collected from Spitsbergen is very similar to the holotype (see Table 1 and Figs 1–6). In all known Milnesium species lateral papillae are cylindrical in shape, but they were flattened in the holotype and also on the photograph and on the drawing in Maucci (1991). This unusual appearance could however be an artefact caused by the preservation process. An observation of the lateral papillae on the Spitsbergen specimen could solve this problem, but unfortunately in our specimen the mouth was retracted and papillae were squashed, which currently makes it impossible to determine the shape of these structures for this species. In a more recent paper on Arctic tardigrades Maucci wrote that, “Other specimens [of M. eurystomum] were also found in the Argentinean Andes (the Onelli glacier) and in Chile (Punta Arenas).” (Maucci 1996). However, given that the type locality and these two South American locations lie on different continents and are in different zoogeographical regions, we hypothesise that Maucci could have found a different species that was similar to M. eurystomum. Until the slides from South America are located and re-examined, we suggest the reference to this region should be considered dubious. Locus typicus. Southern Greenland, near Narssaq and around the Narssarssuaq airfield, along the road from the airfield to the Kiagtut glacier; Sermiat, on the front of the ‘Inlandsis’, ca. 61 ° 10 'N and 45 ° 23 'W, ca. 100 m asl. Distribution. Currently confirmed localities are in the Arctic: Southern Greenland and Svalbard Archipelago (Spitsbergen) but see also Remarks above. Etymology. Walter Maucci named the species ‘ eurystomum ’ (= large-mouthed) because of the high ratio of the buccal tube width to its length. Type depositories. Holotype is preserved at the Natural History Museum of Verona, Italy. Differential diagnosis. The ratio of the buccal tube width to length is definitely the most striking of M. eurystomum characters: in the two specimens examined it exceeds 60 %. No other described Milnesium species has such a high ratio and the two other species with the highest ratios are: M. jacobi Meyer & Hilton, 2010 (ca. 55 %) and M. tetralamellatum Pilato & Binda 1991 (ca. 49 %). In the remaining known species the ratio of the buccal tube width to length varies between 21 % (M. katarzynae Kaczmarek, Michalczyk & Beasley 2004) to ca. 45 % (M. tardigradum s.s.). M. eurystomum, apart from the buccal tube standard width to length ratio, differs from: M. jacobi by more cylindrical and broader buccal tube (funnel-shaped in M. eurystomum and ca. 45.9–47.9 μm wide, in M. jacobi 15.3–27.2 μm wide; both standard widths) more anteriorly inserted stylet supports on the buccal tube (pt ca. 60 % in M. eurystomum and ca. 88 % in M. jacobi), and a different claw configuration ([3 – 3]- [3 – 3] in M. eurystomum and [2–3]-[3 – 3] in M. jacobi). M. tetralamellatum by having six peribuccal lamellae (four in M. tetralamellatum) and a different claw configuration ([3 – 3]–[3 – 3] in M. eurystomum and [2–3]–[3 – 2] in M. tetralamellatum).

Milnesium granulatum Ramazzotti, 1962, bona species (Figs 7–11, Table 2) Material examined. One paratype, female, slide labelled as follows: “Tipo 145. 1 H. baumanni, 1 M. tardigradum granulatum Ramazzotti; Fray Jorge (Cile) a m 620, 22.5. 62, Lichene su parmo (Polivinil).” Description (measurements in Table 2). Body colour unknown, eyes present according to the original description (Ramazzotti 1962), but now are no longer visible (Fig. 7). Dorso-lateral cuticle or only caudo-dorsal cuticle covered with a reticular design (diameter of polygons 0.5–1.5 μm) (Fig. 8). The design better developed on the caudal cuticle. Ventral cuticle smooth. Granulation or pores in cuticle absent. Two lateral and six peribuccal papillae present(ventral papilla smaller than other papillae). Buccal apparatus of the Milnesium type (Fig. 9). Six peribuccal lamellae around the mouth opening present. Buccal tube slightly funnel-shaped, wider anteriorly (posterior diameter 87 % of the anterior diameter). Pharyngeal bulb elongated, pear-shaped and without placoids or septulum. Claws of the Milnesium type, slender (Figs 10–11). Primary branches on all legs with small, but distinct accessory points detaching from the branch near its end. Secondary branches with rounded basal thickenings. All secondary branches on all legs with three points (i.e. claw configuration: [3 - 3]-[3 - 3]). Single, long transversal, cuticular bars under claws I–III present (Fig. 10). Although eggs were not described by Ramazzotti (1962), we should probably expect them to be oval, smooth and deposited in exuvium as in all other known Milnesium species. Remarks. Maucci (1973 – 74) reported M. tardigradum granulatum also from the Trieste Kras, but we have not had an occasion to examine those animals. However, given the locus typicus of M. granulatum lies on a different continent and in a different zoogeographical region, we hypothesise that Maucci could have found a different species of the Milnesium granulatum group. Until the record is re-examined, we suggest this report should be considered dubious. Locus typicus. Coquimbo Region, Bosque de Fray Jorge National Park, Ovalle, ca. 420 km to the North from Santiago de Chile, ca. 30 ° 40 'S and 71 ° 40 'W, ca. 600 m asl, temperate hygrophilous forest surrounded by steppe, mosses and lichens growing on shrubs. Distribution. Currently confirmed is only the type locality in Chile (but see also Remarks above). Etymology. Giuseppe Ramazzotti named the species ‘ granulatum ’ most likely because he interpreted the reticular design on the cuticle as granulation. In fact, ‘granules’ are shallow depression in the shape of rounded polygons (see Fig. 8). Type depositories. The type material is preserved at the Natural History Museum of Verona, Italy. Differential diagnosis. Apart from M. granulatum there are four other described Milnesium species with sculptured cuticle (see Table 1). M. granulatum differs specifically from: M. alabamae Wallendorf & Miller, 2009 by having accessory points on the primary branches. M. katarzynae Kaczmarek, Michalczyk & Beasley, 2004 by a different claw configuration ([3 - 3]-[3 - 3] in M. granulatum and [2 - 2]-[2 - 2] in M. katarzynae), a wider buccal tube (pt ca. 39 % in M. granulatum and pt ca. 21– 26 % in M. katarzynae) and stylet supports inserted in more anterior position (pt ca. 66 % in M. granulatum and pt. ca. 73–78 % in M. katarzynae). M. krzysztofi Kaczmarek & Michalczyk, 2007 by a different claw configuration ([3 - 3]-[3 - 3] in M. granulatum and [2-3]-[3 - 2] in M. krzysztofi). M. reticulatum Pilato, Binda & Lisi, 2002 by the absence of gibbosities, having six peribuccal lamellae (four in M. reticulatum) and a different claw configuration ([3 - 3]-[3 - 3] in M. granulatum and [2-3]-[3 - 2] in M. reticulatum).