Search

Your search keyword '"W. Sheng"' showing total 1,429 results
Start Over Author "W. Sheng"

Refine your results

more »

more »

more »

more »

more »
1,429 results on '"W. Sheng"'

1. Teaching Aids for Remedial Mathematics Instruction: A Systematic Review

Author

Low W. Sheng, Mohd M. Tahar, and Siti M. Maat

Abstract

Poor numeracy skills among remedial pupils remained a critical issue for Malaysia to achieve educational goals. This systematic literature review identified research trends and evidence-based practices on teaching aids to enhance remedial mathematics instruction. The review followed PRISMA model through four phases, searching WoS and Scopus databases to analyze 29 studies from 2014 to 2023 that met the inclusion criteria. The predominant focus was on Indonesia, Taiwan, Malaysia and the United States. Mainly quantitative and qualitative research designs were utilized. Findings revealed diverse teaching aids were proposed, including digital technologies such as systems, smartphone apps, games, multimedia, augmented reality, virtual reality, as well as manipulatives, number lines and instructional modules. Both digital and handson manipulative teaching aids have been applied in remedial mathematics interventions with promising results. Key findings indicate the effectiveness of teaching aids depends on alignment with pupils' individual needs and suitable pedagogical approaches based on local context. Implications emerge for developing new teaching aids and teacher training tailored to local remedial mathematics learners. Rigorous research is needed, particularly in the Malaysian context, to evaluate the usability of teaching aids over time. Investing in specialized teaching aids and aligned instruction will help provide quality remedial mathematics education. This review highlights promising teaching aids and gaps to build essential numeracy skills among remedial pupils in Malaysia for equitable math outcomes.

Published
2024

2. Leaching of High Arsenic Content Dust and a New Process for the Preparation of Copper Arsenate

Author

W. Sheng, Y.-Y. Shen, and Z. Sheng-Quan

Subjects
high-arsenic dust, acidic leaching, alkaline leaching, copper arsenate, comprehensive utilisation of resources, Mining engineering. Metallurgy, TN1-997, Materials of engineering and construction. Mechanics of materials, TA401-492
Abstract

In this research, the high arsenic content dust of copper smelting, as a raw material, the extraction of copper and arsenic from the high arsenic content dust in the leaching system containing acidic and alkaline compounds was investigated. Meanwhile, the effects of acid/alkaline initial concentration, liquid to solid ratio, leaching temperature, leaching time on the leaching rate of copper and arsenic were studied. The optimum conditions for the leaching of high arsenic content dust and preparation of copper arsenate were determined. The results showed that acidic/alkaline leaching of high arsenic content dust was particularly effective. 93.2% of the copper, and 91.6% of the arsenic were leached in an acidic leaching process and 95% of the arsenic, while less than 3% of the copper, less than 5% of the antimony, less than 2% of the bismuth was also leached in an alkaline leaching process. A new method (the parallel flow drop precipitate method) was developed in the synthesis of copper arsenate process. The parallel flow drop method was employed to adjust the molar ratio (copper to arsenic) of the mixed solution of the acid-leaching solution and the alkali-leaching solution by taking the drop acceleration of an acidic leaching solution and an alkaline leaching solution at 10 mL/min and 12 mL/min, at a temperature of 60°C and a reaction time of 1 h. Copper arsenate was prepared by mixing an acidic leaching solution and an alkaline leaching solution. The main phases of copper arsenate were CuHAsO4·1.5H2O and Cu5As4O15·9H2O. Copper arsenate contained 30.13% copper and 31.10% arsenic.

Published
2018
Full Text
View/download PDF

5. The enhanced negative thermal expansion in less-oxygen-vacancies copper pyrophosphate

Author

L. Lu Xie, T. Fei Shi, J. Chao Lin, X. Kai Zhang, X. Kang Zhong, K. Ke Liu, B. Ke Dong, Cheng Yang, X. Lian Wang, T. Jiao Xiong, W. Sheng Yan, J. Ping Xu, H. Can Chen, Wen Yin, Ming Li, Peng Tong, W. Hai Song, and Y. Ping Sun

Subjects
Polymers and Plastics, Mechanics of Materials, Mechanical Engineering, Materials Chemistry, Metals and Alloys, Ceramics and Composites
Published
2023
Full Text
View/download PDF

6. Predicted stable electrides in Mg–Al systems under high pressure

Author

Cong Li, Weiwei Li, Xiaoliang Zhang, Liangcong Du, and H. W. Sheng

Subjects
General Physics and Astronomy, Physical and Theoretical Chemistry
Abstract

Magnesium and aluminum, as adjacent light metal elements, have difficulty forming stable stoichiometric compounds under ambient conditions. In this work, using evolutionary

Published
2022
Full Text
View/download PDF

8. [Research progress in the copy number variation and congenital heart diseases]

Author

H, Gao, W, Sheng, and G Y, Huang

Subjects
Heart Defects, Congenital, DNA Copy Number Variations, Humans
Abstract

先天性心脏病（简称先心病）的病因及发病机制尚未完全明确。随着微阵列比较基因组杂交技术及二代测序技术的开展，在先心病患儿中检出越来越多的拷贝数变异，并在细胞及动物水平得到致病性验证。本文综述先心病拷贝数变异的研究现状、常见拷贝数变异的心脏表型和遗传学特征以及拷贝数变异在先心病发病中的可能机制。.

Published
2022

12. The synthesis and characterizations of Li4Ti5O12–CNTs anode material

Author

X. Ping Zhou, G.G. Wang, W. Sheng Li, and H. Luo

Subjects
Materials science, Energy Engineering and Power Technology, chemistry.chemical_element, 02 engineering and technology, Carbon nanotube, 010402 general chemistry, 01 natural sciences, law.invention, chemistry.chemical_compound, law, chemistry.chemical_classification, Renewable Energy, Sustainability and the Environment, Polymer, 021001 nanoscience & nanotechnology, Condensed Matter Physics, 0104 chemical sciences, Anode, Fuel Technology, chemistry, Chemical engineering, Polymerization, Nanocrystal, Lithium, 0210 nano-technology, Ethylene glycol, Titanium
Abstract

An anode material with Li4Ti5O12 nanocrystals entangled by carbon nanotubes is prepared by polymerization of titanium tetra-isopropoxide with ethylene glycol in the presentence of carbon nanotubes. The resulted polymer is hydrolyzed in LiOH/H2O solution, and then thermally decomposed to obtain the topic anode material. The characterizations show that the synthesis method yields a type of material that has both of high electronic conductivity and high lithium ion diffusion rate. The material has stable deep discharge capability (down to 0.01 V), high specific capacity (237 mAhg−1 at 0.30 Ag-1), and long cycling life time (254 mAhg−1 at 0.10 Ag-1, more than 500 discharge/charge cycles). High specific capacities of 258 and 158 mAhg−1 are obtained at current densities of 0.10 and 3.00 Ag-1, respectively. The deep discharge capability of the material offers an average voltage below 1.0 V (vs metal Li), which is lower than that of pristine Li4Ti5O12 (1.55 V).

Published
2020
Full Text
View/download PDF

13. Analysis of Gene Expression Responses to a Infection in Rugao Chicken Intestine Using GeneChips

Author

D. Q. Luan, G. B. Chang, Z. W. Sheng, Y. Zhang, W. Zhou, Z. Z. Li, Y. Liu, and G. H. Chen

Subjects
Rugao Chickens, GeneChips, Intestine Tissues, Gene Expression Profile, Quantitative Real-time PCR, Animal culture, SF1-1100, Animal biochemistry, QP501-801
Abstract

Poultry products are an important source of Salmonella enterica. An effective way to reduce food poisoning due to Salmonella would be to breed chickens more resistant to infection. Unfortunately host responses to Salmonella are complex with many factors involved. To learn more about responses to Salmonella in young chickens of 2 wk old, a cDNA Microarray containing 13,319 probes was performed to compare gene expression profiles between two chicken groups under control and Salmonella infected conditions. Newly hatched chickens were orally infected with S. enterica serovar Enteritidis. Since the intestine is one of the important barriers the bacteria encounter after oral inoculation, intestine gene expression was investigated at 2 wk old. There were 588 differentially expressed genes detected, of which 276 were known genes, and of the total number 266 were up-regulated and 322 were down-regulated. Differences in gene expression between the two chicken groups were found in control as well as Salmonella infected conditions indicating a difference in the intestine development between the two chicken groups which might be linked to the difference in Salmonella susceptibility. The differential expressions of 4 genes were confirmed by quantitative real-time PCR and the results indicated that the expression changes of these genes were generally consistent with the results of GeneChips. The findings in this study have lead to the identification of novel genes and possible cellular pathways, which are host dependent.

Published
2012
Full Text
View/download PDF

15. PPARα activation by fenofibrate ameliorates radiation‐induced skin injury

Author

D. Yu, W. Sheng, F. Geng, Zhang Jie, P. Liu, and Shuai Zhang

Subjects
Fenofibrate, Swine, Skin Injury, business.industry, Radiation induced, Dermatology, Pharmacology, Mice, Radiation Injuries, Experimental, Infectious Diseases, Animals, Humans, Swine, Miniature, Medicine, PPAR alpha, Radiodermatitis, business, Signal Transduction, medicine.drug
Published
2021
Full Text
View/download PDF

17. Deep Submucosal Invasion as Independent Risk Factor or Lymph Node Metastasis In T1 Colorectal Cancer: a Systematic Review and Meta-Analysis

Author

Hiroshi Kawachi, Baj Bastiaansen, Roel Hompes, Paul Fockens, Liselotte W. Zwager, Nahid Mostafavi, Katsuro Ichimasa, W Sheng, L.M.G. Moons, Shinji Tanaka, I Machado, V Barresi, Kazutomo Togashi, E. Dekker, and Tadahiko Masaki

Subjects
Oncology, medicine.medical_specialty, business.industry, Colorectal cancer, Meta-analysis, Internal medicine, medicine, Lymph node metastasis, Risk factor, business, medicine.disease
Published
2021
Full Text
View/download PDF

19. The development of a full range analytical interatomic potential

Author

X. W. Sheng and K. T. Tang

Subjects
Physics, General Physics and Astronomy, Order (ring theory), Interaction model, Interatomic potential, symbols.namesake, Range (mathematics), Simple (abstract algebra), Phenomenological model, symbols, Development (differential geometry), Statistical physics, Physical and Theoretical Chemistry, van der Waals force
Abstract

A chronological account is given to the development of a full range interatomic potential. Starting with a simple phenomenological model, the terms in the model are gradually modified, so that they can carry some definite physical meaning. To gain insight, a systematic, order by order interaction potential theory is developed. Conversely, this theory suggests the functional form for the potential model. At present, we have a simple interaction model that is capable of describing the van der Waals potentials of many systems from R = 0 to R → ∞.

Published
2020

21. Elastosonography and two-dimensional ultrasonography in diagnosis of axillary lymph node metastasis in breast cancer

Author

W. Sheng, X.-N. Xia, Y.-M. Yin, H.-L. Hou, Y. Zhang, J.-J. He, L.-T. Ruan, and Q.-L. Zhao

Subjects
Adult, medicine.medical_specialty, Axillary lymph nodes, Lymph Node Hilum, Breast Neoplasms, Lymph node metastasis, Sensitivity and Specificity, 030218 nuclear medicine & medical imaging, 03 medical and health sciences, 0302 clinical medicine, Breast cancer, medicine, Humans, Radiology, Nuclear Medicine and imaging, Prospective Studies, Lymph node, Aged, business.industry, Two dimensional ultrasonography, Significant difference, General Medicine, Middle Aged, medicine.disease, medicine.anatomical_structure, Lymphatic Metastasis, 030220 oncology & carcinogenesis, Axilla, Elasticity Imaging Techniques, Female, Ultrasonography, Mammary, Radiology, business, Subcutaneous tissue
Abstract

To compare diagnostic value of two-dimensional (2D) ultrasonography and elastosonography for suspected axillary lymph node metastasis of breast cancer.Elastosonography and 2D ultrasonography were performed on 78 axillary lymph nodes of 78 patients with suspected breast cancer. Scores of shape, long- to short-axis ratio, cortical thickness, and lymph node hilum were summed as the score of each lymph node at 2D ultrasonography, while a four-point scale was adopted for elasticity scoring. The combined score of each lymph node was obtained by summing the score at 2D ultrasonography and that at elasticity scoring. The strain ratio was calculated by comparison of the average strain of the lymph node with that of the subcutaneous tissue. Diagnostic efficacies of 2D ultrasonography, elasticity scoring, and the combined method were compared.There were 78 axillary lymph nodes, including 34 non-metastatic and 44 metastatic nodes. The elasticity scores of non-metastatic and metastatic axillary lymph nodes were 1.44±0.82 and 3.11±0.75, respectively (p0.05). The difference in area under the operating characteristic curve (AUC) was statistically significant between 2D ultrasonography and the combined method (p0.05). The sensitivity, specificity, and accuracy of 2D ultrasonography and elasticity scoring were 77.3% versus 86.4%, 76.5% versus 85.3%, and 76.9% versus 85.9%, respectively (all p0.05), and those of the combined method were 93.2%, 73.5%, and 84.6%, respectively. There was a significant difference in sensitivity between 2D ultrasonography and the combined method (p0.05).Combined application of 2D ultrasonography with elastosonography can improve the diagnostic capability for metastatic axillary lymph node characterisation in breast cancer.

Published
2018
Full Text
View/download PDF

22. Correction: The development of a full range analytical interatomic potential

Author

K. T. Tang and X. W. Sheng

Subjects
Physics, Range (statistics), General Physics and Astronomy, Interatomic potential, 02 engineering and technology, Physical and Theoretical Chemistry, 010402 general chemistry, 021001 nanoscience & nanotechnology, 0210 nano-technology, 01 natural sciences, 0104 chemical sciences, Computational physics
Abstract

Correction for ‘The development of a full range analytical interatomic potential’ by X. W. Sheng et al., Phys. Chem. Chem. Phys., 2021, DOI: 10.1039/d0cp04083e.

Published
2021
Full Text
View/download PDF

23. Ab initio and atomistic study of generalized stacking fault energies in Mg and Mg–Y alloys

Author

Z Pei, L-F Zhu, M Friák, S Sandlöbes, J von Pezold, H W Sheng, C P Race, S Zaefferer, B Svendsen, D Raabe, and J Neugebauer

Subjects
Science, Physics, QC1-999
Abstract

Magnesium–yttrium alloys show significantly improved room temperature ductility when compared with pure Mg. We study this interesting phenomenon theoretically at the atomic scale employing quantum-mechanical (so-called ab initio ) and atomistic modeling methods. Specifically, we have calculated generalized stacking fault energies for five slip systems in both elemental magnesium (Mg) and Mg–Y alloys using (i) density functional theory and (ii) a set of embedded-atom-method (EAM) potentials. These calculations predict that the addition of yttrium results in a reduction in the unstable stacking fault energy of basal slip systems. Specifically in the case of an I _2 stacking fault, the predicted reduction of the stacking fault energy due to Y atoms was verified by experimental measurements. We find a similar reduction for the stable stacking fault energy of the $\{11\bar {2}2\}\langle 11\bar {2}3\rangle $ non-basal slip system. On the other hand, other energies along this particular γ -surface profile increase with the addition of Y. In parallel to our quantum-mechanical calculations, we have also developed a new EAM Mg–Y potential and thoroughly tested its performance. The comparison of quantum-mechanical and atomistic results indicates that the new potential is suitable for future large-scale atomistic simulations.

Published
2013
Full Text
View/download PDF

24. Characteristics of α-Amylase gene and its association with growth traits in Meretrix meretrix

Author

Y Dong, X Gao, W Sheng, H Yao, and Z Lin

Subjects
lcsh:Biology (General), activity, expression, cloning, Meretrix meretrix, α-Amylase, growth traits, lcsh:QH301-705.5
Abstract

α-Amylase is a major digestive enzyme in phytophagous animals that catalyzes the hydrolysis of starch into sugars so that it affects the carbohydrate metabolism and growth of many species. In the present study, the full-length cDNA and intron sequences of α-amylase (MmAmy) were investigated by rapid amplification of cDNA ends (RACE) method. The genomic DNA sequence of MmAmy is 6689 bp, which contains 7 exons and 6 introns. The cDNA of MmAmy is 1783 bp, with a 1569 bp of open reading frame (ORF) encoding 522 amino acids. No expression was detected in the early stages of unfertilized mature eggs, fertilized eggs, 4-cell embryo, blastula, gastrulae, trochophore, whereas it was detected after D-shaped larva showing the highest expression in umbo larvae. The quantitative expression of six different tissues in adults showed that expression of MmAmy was enriched in visceral mass, while no expression was detected in other tissues. Furthermore, gene expression and enzyme activity of MmAmy in visceral mass were highly correlated with the growth rates of four shell color strains. The positive correlation between MmAmy and growth traits suggested that α-amylase gene could be used as a candidate gene in the molecular breeding programs to improve clam growth., Invertebrate Survival Journal, Vol 15 No 1 (2018)

Published
2018
Full Text
View/download PDF

25. [Discussion on medicinal history and germplasm resource of

Author

G Y, Li, X W, Song, W W, Sheng, and M, Wang

Subjects
Tracheophyta, Materia Medica, History, 20th Century
Abstract

By sorting out the literature on materiamedica, it is found that medicinal history of断血流药用历史比较久远，可以追溯至南宋《履巉岩本草》的"草血竭"，其功效及用法记载明确。断血流的来源植物普遍认为是荫风轮Clinopodium polycephalum (Vaniot) C. Y. Wu et Hsuan与风轮菜C. chinensis (Benth.) O. Kuntze2个独立的种，也有学者认为荫风轮与风轮菜为同一种植物。荫风轮为断血流的主流来源，与风轮菜可能是原种与变种的关系。.

Published
2017

27. Numerical Simulations for Super Large-Scale Natural Draft Cooling Tower With an Optimized Non-Uniform Water Distribution

Author

W. Sheng, H. Wang, and J. Y. Li

Subjects
Engineering, Distribution (mathematics), Meteorology, Scale (ratio), business.industry, Hull, Mass transfer, Nozzle, Cooling tower, Mechanics, business
Abstract

The great spray area of a Super Large-Scale Natural Draft Cooling Tower (SLNDWCT) makes it difficult to achieve an uniform wind field, and non-uniform water spray distributions are adopted in engineering. In this paper, to improve the cooling performance, optimized non-uniform water spray distributions are designed by utilizing network hydraulic calculations and numerical simulations. In the network calculations, the node-formula is applied to figure out the water pressure and flow rate of each spray nozzle, providing more precise data in simulations for the heat and mass transfer. Simulations for operating in summer, Spring/Autumn and winter seasons, which are different in water spray density, have been presented. In the operating in summer, the spray zone is divided into two regions (inner and outer regions), and by adjusting the water spray density and areas of the two regions, an improved water distribution is achieved.

Published
2017
Full Text
View/download PDF

28. The Application of Semi-quantitative Total Hydrocarbon Chromatography Technology in Determining Production Allocation of Individual Sand Layer in a Commingled Production Well

Author

Mang Lu, Q.-W. Sheng, G. Qin, Y.-H. Xu, X.-D. Shen, and J. W. Pan

Subjects
chemistry.chemical_classification, Chromatography, General Chemical Engineering, Energy Engineering and Power Technology, General Chemistry, Geotechnical Engineering and Engineering Geology, Fuel Technology, Hydrocarbon, chemistry, Fingerprint, Environmental science, Gas chromatography, Layer (electronics), Semi quantitative, Single layer
Abstract

The authors present a case study of using semi-quantitative oil fingerprinting technology to correctly back allocate production of individual sand layer in commingled well. A large number of oil samples were collected over time and analyzed by gas chromatography (GC) for their oil fingerprints. The results showed that the production allocation of single layer in two-layer commingled well and the hydrocarbon concentrations of commingled oil were in a liner relationship. However, the production allocation of single layer and oil GC fingerprint parameters were in curvilinear relationship. The semi-quantitative oil fingerprinting technology was suitable for the case of two-layer commingled well, and three-layer commingled well with larger gas chromatography differences among oil of each layer.

Published
2014
Full Text
View/download PDF

29. A meta-analysis of pemetrexed-based doublet compared with pemetrexed alone for the second-line treatment of advanced non-small-cell lung cancer

Author

J Q Han, X Xu, X W Wang, W Sheng, C T Sun, and S L Wen

Subjects
Oncology, Economics and Econometrics, medicine.medical_specialty, Guanine, Lung Neoplasms, medicine.medical_treatment, Antineoplastic Agents, Pemetrexed, Neutropenia, Glutamates, Carcinoma, Non-Small-Cell Lung, Internal medicine, Antineoplastic Combined Chemotherapy Protocols, Materials Chemistry, Media Technology, medicine, Carcinoma, Humans, Lung cancer, Survival rate, Randomized Controlled Trials as Topic, Chemotherapy, business.industry, Forestry, Combination chemotherapy, medicine.disease, Treatment Outcome, Docetaxel, Disease Progression, business, medicine.drug
Abstract

Purpose: This meta-analysis investigated pemetrexed-based doublet compared with pemetrexed alone as second-line therapy for patients with advanced non-small cell lung cancer. Methods: Randomized controlled trials which compared pemetrexed-based doublet with single-agent pemetrexed in patients as second-line treatment of advanced non-small cell lung cancer were searched. Overall survival (OS) was the primary end point, while secondary end points included progression-free survival, overall response rate, 1-year survival rate, and grade 3 or 4 toxicity. Results: Four eligible randomized clinical trials including 1,084 patients were selected. Meta-analysis demon- strated that pemetrexed-based doublet arm signifi cantly improved the overall response rate (OR=2.70, 95% CI: 1.76-4.15, p=0.000), compared with docetaxel alone group, while there were no signifi cant differences in over- all survival (HR=0.88, 95% CI: 0.74-1.04, p=0.132), progression-free survival (HR=0.91, 95% CI: 0.73-1.15, p=0.443), and 1-year survival rate (OR=1.43, 95% CI: 0.85-2.40, p=0.178) between the two arms. However, there were more frequencies of grade 3-4 leucopenia (OR=2.86, 95% CI: 1.32-6.20, p=0.008), neutropenia (OR=2.69, 95% CI: 1.55-4.68, p=0.000) and thrombocytopenia (OR=6.92, 95% CI: 2.51-19.07, p=0.000) in pemetrexed-based doublet group. Grade 3-4 anemia (OR=0.62, 95% CI: 0.33-1.18, p=0.144) and fatigue (OR=1.15, 95% CI: 0.73-1.79, p=0.550) had equivalent incidences in the two groups. Conclusions: This is the fi rst meta-analysis to compare pemetrexed-based doublet with single-agent pemetrexed in second-line therapy of non-small cell lung cancer. Our meta-analysis suggested that pemetrexed combination chemotherapy was not superior to single-agent arm and was not recommended as the second-line chemotherapy for patients with non-small cell lung cancer (Tab. 2, Fig. 6, Ref. 20). Text in PDF www.elis.sk.

Published
2014
Full Text
View/download PDF

30. [Relationship and clinicopathological significance of Numb and epithelial-mesenchymal transition related proteins in human pancreatic cancer]

Author

W W, Sheng, M, Dong, Z R, Liu, Y J, Li, J P, Zhou, and Q, Dong

Subjects
Epithelial-Mesenchymal Transition, Membrane Proteins, Nerve Tissue Proteins, Kaplan-Meier Estimate, Adenocarcinoma, Cadherins, Prognosis, Real-Time Polymerase Chain Reaction, Immunohistochemistry, Pancreatic Neoplasms, Antigens, CD, Lymphatic Metastasis, Humans, Vimentin
Published
2016

31. The mutant neoantigen specific T cell is a personalized immunotherapy in refractory solid tumour

Author

Q. Song, T. Zhang, J. Li, W. Sheng, J. Wang, Q. Gan, L. Han, Q. Sun, N. Zhou, X. Zhou, Y. Zhou, L. Wu, J. LI, L. Chang, Z. Zhou, Y. Song, L. Zhang, and S. Jiao

Subjects
biology, business.industry, medicine.medical_treatment, T cell, CD137, Mutant, Cell, T-cell receptor, Hematology, Immunotherapy, Human leukocyte antigen, medicine.anatomical_structure, Oncology, medicine, Cancer research, biology.protein, Antibody, business
Abstract

Background Immune checkpoint inhibitors are an important therapy. However, their essence is nonspecific and efficiency of single usage is not satisfactory. The mutant neoantigen specific T (Nas-T) cell, as an adoptive cell treatment, is a specific immunotherapy for each individual. Our previous research has proved that the combined immunotherapy of mutant Nas-T cell and PD1 antibody is more effective than PD1 alone in prolonging PFS (World Conference on Lung Cancer 2018). We aim to evaluate the characteristics of the immune repertoire (IR) as a predictive biomarker for immunotherapy and to construct personalized and specific TCR-T. Methods 14 patients with advanced solid tumors who failed after multiline treatments were recruited. They were divided into durable clinical benefit (complete response, partial response or stable disease for more than 3 months) and non-durable clinical benefit (DCB and NCB) based on PFS. Peripheral blood was collected at baseline and each cycle. IR-seq of the CDR3 regions of human TCRβ chains was used to interrogate the TCRs frequency. We used single neoantigen to stimulate the infused T cells and performed RNAseq for the sorted CD137(+) cells to obtain the full-length TCR α and β chain. Lastly, we constructed TCR-T cells via transfecting the TCR α/β pair into the T cells of patients and co-cultured with neoantigen to analyze the functionality of TCRs. Results After neoantigen pulsing, the clonality of infused T cells pool significantly increased (P = 0.0001), suggesting some tumor-specific T-cells were expanded and enriched after neoantigen pulsing. Compared to baseline, T-cell repertoire of NCB and DCB after 1st cycle displayed significant changes: Shannon 1.19 vs 0.97 (P = 0.002); clonality 0.68 vs 1.19 (P = 0.001). Elevated clonality may indicate expanded tumor-specific T-cells which could recognize mutant neoantigen specifically. Besides, based on the in vitro TCR-T experiments, the constructed TCR-T cells can specifically recognize the mutant neoantigen and lyse the target cells expressing the corresponding neoantigen. Table . 1228P Neoantigen Sequence HLA-I typing TCR Vα TCR Vβ Gene name Sequence* All V Hits With Score# Clonal Sequence# All V Hits With Score# Clonal Sequence# MTAP/SPINK1 Fused Gene VLLPRHMKV A0201 TRAV35 (574.6) TGTGCTGGGTATGGCTCTAGCAA CACAGGCAAACTAATCTTT TRBV19 (646.8) TGTGCCAGTCGGACAGGGGGA TCACCCCTCCACTTT FER NYVSNVSKF A2301 TRAV29DV5 (667.6) TGTGCAGCTTCAACTGGGGCAAA CAACCTCTTCTTT TRBV7-2 (626.7) TGTGCCAGCACCTCTGCCCCC TCCTACGAGCAGTACTTC SPINK1 FLLSALALL B4403 TRAV20 (589.1) TGTGCTGTTCCCCTGGGAACAGG CTTTCAGAAACTTGTATTT (response to neoantigen) TRBV21-1 (557.8) TGTGCCAGCAGCAAAGACCCT AGCGGGAATCAAGAGACCCAGTACTTC CLCN6 ALIGAAASL B6701 TRAV19 (612.4) TGTGCTCTTCTGAATTATGGTGGTGC TACAAACAAGCTCATCTTT TRBV6-5 (675.4) TGTGCCAGCAGTGGGACAGCCAATGA GCAGTTCTTC (response to neoantigen) MTAP AESFMFRTW C0401 TRAV38-2DV8 (658.4) TGTGCTTATTGGGAGCTTGTCTCTGGGG CTGGGAGTTACCAACTCACTTTC TRBV5-1 (637.6) TGCGCCAGCAGCTTGACTAGCGGGGGG TTCTACGAGCAGTACTTC TAP1 RLSLFLALV C0702 TRAV16 (622.2) TGTGCTCCCTGGGCCCTAGGAGGAGG TGCTGACGGACTCACCTTT TRBV30 (403.4) TGTGCCTGGAGTGTAACAGGGGGC AAAGCAGATACGCAGTATTTT MAN2C1 FLQGRNFFL Conclusions The mutant Nas-T cell is a personalized immunotherapy. IR is a potential predictive biomarker. Legal entity responsible for the study Shunchang Jiao. Funding Has not received any funding. Disclosure All authors have declared no conflicts of interest.

Published
2019
Full Text
View/download PDF

33. An Evaluation Scheme of Skywave Radar Coverage of Ship Target Based on GRG

Author

W. Sheng, X.H. Zhang, and S.H. Liu

Subjects
Skywave, Scheme (programming language), Basis (linear algebra), Computer science, Analytic hierarchy process, General Medicine, computer.software_genre, law.invention, law, Data mining, Radar, computer, computer.programming_language, Remote sensing
Abstract

An evaluation scheme of skywave radar coverage of ship target is researched. On the basis of fifteen kinds of indexes of the skywave radar coverage, a sort of model of coverage quantitative evaluation with three levels of hiberarchy is established by means of the modified analytical hierarchy process (AHP) based on grey relational grade (GRG), the quantitative calculation method of all level indexes is discussed, and the effectiveness ofthe model is verified. This method solve the problem in AHP effectively. The result shows that the evaluation scheme of skywave radar coverage is feasibility.

Published
2013
Full Text
View/download PDF

34. Effects of Rare-Earth Doping on Dielectric Properties of CaCu3Ti4O12Ceramics

Author

B. Fu, J. Cai, C. Lu, H. Lu, C. Huang, J. W. Sheng, and Jia Li

Subjects
Materials science, Condensed matter physics, Doping, Rare earth, Analytical chemistry, Dielectric, Conductivity, Atmospheric temperature range, Condensed Matter Physics, Electronic, Optical and Magnetic Materials, visual_art, visual_art.visual_art_medium, Dielectric loss, Ceramic
Abstract

The Ca1−xNdxCu3Ti4O12(x = 0.0%, 0.1%, 0.5% and 1.0%, respectively) ceramics were synthesized by the solid-state reaction method in the temperature range of 1000°C to 1100°C, and single-phase structures with space group Im3 were obtained up to x = 1.0%. The effects of Nd-substitution on the dielectric properties and conductivity of Ca1−xNdxCu3Ti4O12ceramics were investigated and discussed. The room temperature dielectric constant and dielectric loss of Ca1−xNdxCu3Ti4O12ceramics slightly decreased with x = 0.1% and 0.5%, but increased with x = 1.0%. The Nd-substitution has little effect on the giant dielectric constant step but a strong effect on the high-temperature dielectric relaxations.

Published
2013
Full Text
View/download PDF

35. Poster Session Wednesday 5 December all day Display * Determinants of left ventricular performance

Author

J. Skranes, I. Andreadou, A. Germain, A. Alghamdi, C. Santoro, Z. Markovic, G. Jones, N. Lousada, K. Shahgaldi, A. Iqbal, L. Carpinteiro, O. Dzikowska-Diduch, J. Khoo, H. Vago, Y. Juilliere, M. L. Del Pino, M. Lisi, J. Choi, Y. Yotov, M. Monaghan, P. Seferovic, R. Beanlands, K. Dima, J. Suarez De Lezo Herreros De Tejada, I. D-Angeli, S. Veioglanis, A. Magalhaes, R. Esposito, D. Damaskos, L. Faber, M. Centeno, A. Sahlen, A. Stoylen, K. Adamyan, R. Gao, C. Zito, M. Gomez-Rubin, A. Simon, N. Markovic Nikolic, J. Gibbs, J. Dahl, S. Gati, A. Omran, K. Aonuma, B. Michalski, B. Zweig, V. Katsi, S. Giannitsi, S. Wrideier, D. Marcadet, S. Malm, S. Rahman Haley, B. Rybus-Kalinowska, S. Yurdakul, N. Haas, C. Katseli, M. Caplin, D. Haghi, L. Drvol, S. Bosi, M. M. Gurzun, B. Merkely, T. Alvarez, L. Capotosto, G. Draganic, C. Lowery, D. J. Cuthbertson, T. Kovats, S. Gherardi, F. Elmkies, H.-J. Trappe, S. Backovic, A. Koumoulidis, W. Sheng, S. G. Da Silva, M. Alam, I. Felekos, L. Badano, A. Manouras, W. Burchert, H. Direskeneli, M. Alraies, B. Natali, L. Weinert, A. Scullion, Y. Noguchi, K. Chun, M. Borggrefe, A. Barbieri, S. Hassantash, M. Banovic, M. Takeuchi, E. Sfendouraki, D. Horstkotte, W. Gin-Sing, K. Gatzoulis, W. Choi, K. Grudzka, G. Luzza, J. Sellal, M. Galderisi, C. Halley, O. Hallioglu, T. Sueselbeck, A. Nagy, S. Eroglu, N. Mansencal, H. Seggewiss, V. Kuznetsov, M. Anastasiou-Nana, M. Lourenco, W. Jaber, L. Howard, S. Piret, P. Palczewski, A. Mohamed, R. Dekemp, S. Habash, L. Videbaek, B. Kilicaslan, E. Nestaas, C. Marin, C. Selton-Suty, I. Ikonomidis, G. Sjoberg, L. Stefanczyk, S. Goliszek, A. Charalampopoulos, A. Travlou, V. Pipitone, N. Matveeva, T. G. Alujas, K. Ananthasubramaniam, M. Karvandi, D. Ermacora, A. Rodriguez-Ogando, J. Silva Marques, J. Kim, L. Michalis, M. Prull, O. Wendler, J. Chattahi, M. Baldelli, J.-L. Philip, A. Squeri, D. Jiminez, I. Tzoulaki, J. Hallberg, G. Truscelli, P. Zinzius, L. Santos, D. Tousoulis, I. B. Surribas, B. Stojcevski, C. Reverberi, S. Ghani, F. Toledano Delgado, D. Han, M. Hedger, I. Ilic-Djordjevic, S. Berthier, B. Tasdelen, G. Pushkarev, P. Maccarthy, M. Cikes, L. Arnold, M. Ostojic, A. Massoni, D. Fugelseth, K. Szymczyk, F. Caranci, Y. Seo, O. Kunchev, E. Picano, A. Nunes Diogo, V. Vukcevic, S. Martins, C. Doesch, M. Chiavarelli, M. Petrovic, O. Enescu, H. Al-Shehri, D. Cini, M. Kalinowski, A. Zaidi, T. Song, Z. Cosic, S. Lupu, I. Koutagiar, J. Stabryla, S. Rangamani, M. Ciurzynski, C. Medrano, L. Tong, A. Ylitalo, J. Sanderson, B. Prendergast, L. R. Tumasyan, E. Gunyeli, F. Castillo Bernal, A. Vershinina, M. Krupa, A. Madaffari, D. Ledoux, M. Ozeren, A. Baltabaeva, A. Mladenovic, T. Christophersen, T. Papavassiliu, C. Yu, P. Lipiec, M. Fischer, D. Bacic, A. Padiyath, I. Paraskevaidis, T. Kukulski, M. Stamatelatou, H. Houle, S. Sideris, G. Kolunin, S. Boedeker, K.-L. Ang, G. A. Derumeaux, L. Agoston-Coldea, M. Baeza Garzon, B. Buyukakilli, S. Antoniou, A. Buno, G. Roussakis, L. Sargento, A. Ouss, M. Losito, O. Azevedo, M. M. Urdaniz, G. Arpesella, B. Lichodziejewska, B. Vujisic-Tesic, T. Butz, J. Davar, M. Poulsen, A. Grasso, G. Gkiouras, J. Moller, A. Apor, O. Dettori, T. Ruddy, W. Aljaroudi, G. Saifullina, C. Mabbet, N. Sheikh, M. De Maio, R. Sharma, G. Sutherland, J. Sun, M. Frenneaux, A. Saitta, D. Mahadevan, A. Angelov, F. Maffessanti, C. Gouva, A. Almeida, W. Serra, G. Tamborini, R. Winter, R. Medeiros, R. Ionasec, L. Gapon, P. Carrilho Ferreira, E. Ramirez, D. Roberson, A. Sadykov, R. P. Dos Reis, M. Burgess, P. Bruno, J. Hamilton, A. E. Masip, F. Oner, A. Erraki, M. Naldi, M. Massetti, C. Calisto, J. Lopez-Sendon, S. Gao, E. Kartsagoulis, J. Lof, D. Muraru, J. Kwong, V. Muthurangu, F. Degener, B. Bijnens, R. Arunkumar, S. Ranjbar, S. Longo, M. Pietila, W. Streb, T. Bombardini, H. Zemir, D. Silva, Q. Zhang, S. Lee, K. Naka, F. Vecchio, F. Schaefer, C. Marcos, A. Kottam, L. Brunvand, A. Burghardt, M. Satendra, I. Machado, M. Toth, J. Nowak, G. Gnanavelu, S. Stojkovic, E. Maroto, Y. Park, S. Coulibaly, N. Ozgunes, O. Oldenburg, S. Gurgul, M. Canales, T. Rudbaek, T. Lopez-Fernandez, P. Katsimbri, M. Dekleva, F. Liu, J. Thomas, L. Garcia Cuenllas, P. Meimoun, K. Egstrup, T. Mocan, J. Coghlan, R. Bader, B. Loegstrup, F. Barilla, S. Ribeiro, S. Akhunova, F. Sibellas, C. Aggeli, N. Swaminathan, I. Zyrianov, D. Citirik, J. Suzic Lazic, A. Lourenco, A. Cox, S. Tzortzis, G. Makavos, M. Szulik, P. Massion, R. Sicari, B. Wozniakowski, B. Bahlay, A. Rosner, S. Kutty, J. Lekakis, R. Tripodi, D. Hofsten, M. Pepi, J. Davies, D. Trifunovic, B. Sasko, A. Bircan, M. Camino, J. Stepanovic, A. Bernardes, P. Marie, S. H. Kim, R. Dulgheru, S. Aytekin, B. Pencic, I. Papadakis, G. Dwivedi, D. Danford, J. Sousa, R. Klein, P. Pruszczyk, M. Altman, J. Schwartz, F. De Torres, A. Sahinarslan, A. Moysich, A. Chilingaryan, P. Goktas, N. Cortez-Dias, M. Maccherini, M. Mpougialkli, K. Kurnicka, L.-A. Mohlkert, M D Mesa Rubio, E. Imbalzano, O. Huttin, T. Kiviniemi, P. Wiesen, M. Norman, A. Sezgin, B. Pirat, M. Mercy, N. Shurkevich, J. Clerc, A. Pereira, K. Katopodis, P. Dilaveris, A. Saraste, A. Kisheva, B. Chow, S. Sahin, A. Ionescu, C. Toumpanakis, A. Rudd, J. Srinivasan, S. Chachalos, T. Kuehne, X. Liu, S. Mihaila, A. Aydinalp, T. Ishizu, M. Cameli, G. Pavlidis, A. Aussoleil, M. Hussein, F. Streitner, H. Schirmer, J.-C. Eicher, C. Bergerot, L. A. Pierard, A. Chernjavskiy, H. Raju, S. Mondillo, A. Taylor, S. Carerj, T. Lehtinen, C. Stefanadis, D. Chin, C. Barreiros, R. Davies, M. Schumann, R. Riezebos, D. Gemma, R. Capoulade, B. Montalvan, A. Ciobanu, J. D'hooge, D. I. Del Valle, J. Feliu, D. Duman, D. Donato, D. G. Dorado, V. Bistola, J. B. Rius, M. Kleut, T. Myrmel, M. Bessonova, F. Ballesteros, M. Delgado Ortega, I. Grapsa, C. Papadopoulos, P. Pellikka, D. Muthukumar, A. Flyvbjerg, H. Triantafyllidi, M. Al-Mallah, L. Mircheva, I. Quelhas, R. Rimbas, M. Boricic, J. F. R. Palomares, J. Kasprzak, M. Ravi, Y. Harimura, F. Sargin, V. Dhandapani, D. Knight, J.-L. Canivet, N. Kouris, A. Sljivic, R. A. Dobson, G. Nartsissova, G. T. Tura, P. Trivilou, C. Sousa, I. Ali, C. Jorge, S. Chidambaram, A. Rotkiewicz, R. Grimm, K. Yun, E. Yaroslavskaya, E. Poulidakis, O. Dubourg, P. Lancellotti, D. Dedovic, H. Muderrisoglu, P. Pibarot, A. Rodriguez, A. Vitarelli, D. Kececioglu, R. Placido, P. T. Mas, C. Halvorsen, F. Fang, M. van Bracht, M. Galinanes, A. Toth, Z. Kalarus, M. Ruiz Ortiz, M. Bjerre, J.-E. Wolf, A. Majstorovic, G. Karthikeyan, N. D. Papamichael, E. Szymczyk, I. Kallikazaros, S. Singh, S. Venkatesan, A. Chan, A. Stevanovic, L. Sade, L. G. Garcia-Moreno, B. Lorcerie, A. Tsantes, M. Loudon, C. Olympios, B. K. Avci, K. Laser, Y. Feng, H. Koerperich, L. Rodriguez, I. Schilling, A. Avgeropoulou, S. Goncalves, J. Guardado, R. Reynolds, V. De Cicco, V. Kostopoulos, D. Karassavidou, R. Lang, S. Stankovic, S. Granja, H. Thibault, L. Rasmussen, C. Prinz, N. Banner, F. Mazuelos, E. Bonnefoy-Cudraz, R. Jasaityte, B. Popovic, L. Li, R. Del Bene, P. Karjalainen, W. Tsang, I. Vlasseros, P. Gripari, S. Binno, K. Airaksinen, V. Celic, J. Magne, D. Krinochkin, E. Ferdenzi, D. Avenarius, K. Meenakshi, D. Vinereanu, Z. Elhonsali, S. Sharma, J. D'arcy, D. Dawson, M. Cusma-Piccione, A. Inan, A. Rodriguez Lopez, G. M. Nasr, M. Kostrubiec, D. Iaccarino, H. Botker, M. Morenate Navio, V. Cui, and A. Luycx-Bore

Subjects
medicine.medical_specialty, business.industry, Physical therapy, Medicine, Radiology, Nuclear Medicine and imaging, General Medicine, Session (computer science), Cardiology and Cardiovascular Medicine, business
Published
2012
Full Text
View/download PDF

36. Suppression of Sea Clutter of Skywave Radar Based on AR Model

Author

W. Sheng, S.H. Liu, and X.H. Zhang

Subjects
Skywave, Autoregressive model, law, Chaotic, Clutter, General Medicine, Radar, Radar horizon, Signal, Geology, law.invention, Remote sensing, Constant false alarm rate
Abstract

The prediction of chaotic time sequence based on AR model is studied. The forming mechanism of the first-order Bragg lines of sea clutter is analyzed. According to the signal characteristic of sea clutter, a sea clutter time sequence predictor and a skywave radar sea clutter suppression system based on AR model are presented. The cancelling of sea clutter is achieved by subtracting the predicted signal from the original signal. The simulation results show that the first-order Bragg lines in the signal were suppressed effectively after processed by this sea clutter suppression system, the detecting performance of skywave radar was increased dominatively.

Published
2012
Full Text
View/download PDF

37. Intraoperative Electron Beam Radiotherapy for Primary Treatment of Stage IIB Cervical Cancer: A Retrospective Study

Author

Juan Wang, Zi Liu, Wei Luo, Juan Ren, YL Soong, Xi Chen, Ying Gao, Fan Gao, W Sheng, and Lingmin Zhang

Subjects
Adult, medicine.medical_specialty, Brachytherapy, Uterine Cervical Neoplasms, Hysterectomy, Biochemistry, Disease-Free Survival, Intraoperative Period, Young Adult, Electron beam radiotherapy, medicine, Humans, Stage iib, Aged, Neoplasm Staging, Retrospective Studies, Cervical cancer, business.industry, Biochemistry (medical), Radiotherapy Dosage, Stage IIB Cervical Cancer, Retrospective cohort study, Cell Biology, General Medicine, Middle Aged, medicine.disease, Combined Modality Therapy, Surgery, Carcinoma, Squamous Cell, Lymph Node Excision, Female, Primary treatment, business
Abstract

Objective: A retrospective study to evaluate intraoperative electron beam radiotherapy (IOERT) as a primary treatment modality for stage IIB cervical squamous cell carcinoma. Methods: Patients underwent treatment with IOERT (n = 78) or radical radiotherapy (RT; n = 89). Patients in the IOERT group received 20 Gy external beam radiotherapy (EBRT) in 10 fractions, intracavitary brachy -therapy (7 - 14 Gy, in patients with tumours ≥ 4 cm in diameter) and simple hysterectomy/selective lymphadenectomy with 18 - 20 Gy IOERT. Patients in the RT group received 50 Gy EBRT in 25 fractions followed by intracavitary brachytherapy (35 - 40 Gy). Results: Median duration of follow-up was 92 months. IOERT resulted in significantly better 5- and 10-year overall survival, disease-free survival and local control rates, as well as fewer rectal and bladder complications, compared with RT. Conclusion: IOERT is an effective primary treatment for stage IIB cervical squamous cell carcinoma.

Published
2012
Full Text
View/download PDF

38. Erratum to: Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition) (Autophagy, 12, 1, 1-222, 10.1080/15548627.2015.1100356

Author

Klionsky, D.J. Abdelmohsen, K. Abe, A. Abedin, M.J. Abeliovich, H. Arozena, A.A. Adachi, H. Adams, C.M. Adams, P.D. Adeli, K. Adhihetty, P.J. Adler, S.G. Agam, G. Agarwal, R. Aghi, M.K. Agnello, M. Agostinis, P. Aguilar, P.V. Aguirre-Ghiso, J. Airoldi, E.M. Ait-Si-Ali, S. Akematsu, T. Akporiaye, E.T. Al-Rubeai, M. Albaiceta, G.M. Albanese, C. Albani, D. Albert, M.L. Aldudo, J. Algül, H. Alirezaei, M. Alloza, I. Almasan, A. Almonte-Beceril, M. Alnemri, E.S. Alonso, C. Altan-Bonnet, N. Altieri, D.C. Alvarez, S. Alvarez-Erviti, L. Alves, S. Amadoro, G. Amano, A. Amantini, C. Ambrosio, S. Amelio, I. Amer, A.O. Amessou, M. Amon, A. An, Z. Anania, F.A. Andersen, S.U. Andley, U.P. Andreadi, C.K. Andrieu-Abadie, N. Anel, A. Ann, D.K. Anoopkumar-Dukie, S. Antonioli, M. Aoki, H. Apostolova, N. Aquila, S. Aquilano, K. Araki, K. Arama, E. Aranda, A. Araya, J. Arcaro, A. Arias, E. Arimoto, H. Ariosa, A.R. Armstrong, J.L. Arnould, T. Arsov, I. Asanuma, K. Askanas, V. Asselin, E. Atarashi, R. Atherton, S.S. Atkin, J.D. Attardi, L.D. Auberger, P. Auburger, G. Aurelian, L. Autelli, R. Avagliano, L. Avantaggiati, M.L. Avrahami, L. Azad, N. Awale, S. Bachetti, T. Backer, J.M. Bae, D.-H. Bae, J.-S. Bae, O.-N. Bae, S.H. Baehrecke, E.H. Baek, S.-H. Baghdiguian, S. Bagniewska-Zadworna, A. Bai, H. Bai, J. Bai, X.-Y. Bailly, Y. Balaji, K.N. Balduini, W. Ballabio, A. Balzan, R. Banerjee, R. Bánhegyi, G. Bao, H. Barbeau, B. Barrachina, M.D. Barreiro, E. Bartel, B. Bartolomé, A. Bassham, D.C. Bassi, M.T. Bast, R.C., Jr. Basu, A. Batista, M.T. Batoko, H. Battino, M. Bauckman, K. Baumgarner, B.L. Bayer, K.U. Beale, R. Beaulieu, J.-F. Beck, G.R., Jr. Becker, C. Beckham, J.D. Bédard, P.-A. Bednarski, P.J. Begley, T.J. Behl, C. Behrends, C. Behrens, G.M.N. Behrns, K.E. Bejarano, E. Belaid, A. Belleudi, F. Bénard, G. Berchem, G. Bergamaschi, D. Bergami, M. Berkhout, B. Berliocchi, L. Bernard, A. Bernard, M. Bernassola, F. Bertolotti, A. Bess, A.S. Besteiro, S. Bettuzzi, S. Bhalla, S. Bhattacharyya, S. Bhutia, S.K. Biagosch, C. Bianchi, M.W. Biard-Piechaczyk, M. Billes, V. Bincoletto, C. Bingol, B. Bird, S.W. Bitoun, M. Bjedov, I. Blackstone, C. Blanc, L. Blanco, G.A. Blomhoff, H.K. Boada-Romero, E. Böckler, S. Boes, M. Boesze-Battaglia, K. Boise, L.H. Bolino, A. Boman, A. Bonaldo, P. Bordi, M. Bosch, J. Botana, L.M. Botti, J. Bou, G. Bouché, M. Bouchecareilh, M. Boucher, M.-J. Boulton, M.E. Bouret, S.G. Boya, P. Boyer-Guittaut, M. Bozhkov, P.V. Brady, N. Braga, V.M.M. Brancolini, C. Braus, G.H. Bravo-San-Pedro, J.M. Brennan, L.A. Bresnick, E.H. Brest, P. Bridges, D. Bringer, M.-A. Brini, M. Brito, G.C. Brodin, B. Brookes, P.S. Brown, E.J. Brown, K. Broxmeyer, H.E. Bruhat, A. Brum, P.C. Brumell, J.H. Brunetti-Pierri, N. Bryson-Richardson, R.J. Buch, S. Buchan, A.M. Budak, H. Bulavin, D.V. Bultman, S.J. Bultynck, G. Bumbasirevic, V. Burelle, Y. Burke, R.E. Burmeister, M. Bütikofer, P. Caberlotto, L. Cadwell, K. Cahova, M. Cai, D. Cai, J. Cai, Q. Calatayud, S. Camougrand, N. Campanella, M. Campbell, G.R. Campbell, M. Campello, S. Candau, R. Caniggia, I. Cantoni, L. Cao, L. Caplan, A.B. Caraglia, M. Cardinali, C. Cardoso, S.M. Carew, J.S. Carleton, L.A. Carlin, C.R. Carloni, S. Carlsson, S.R. Carmona-Gutierrez, D. Carneiro, L.A.M. Carnevali, O. Carra, S. Carrier, A. Carroll, B. Casas, C. Casas, J. Cassinelli, G. Castets, P. Castro-Obregon, S. Cavallini, G. Ceccherini, I. Cecconi, F. Cederbaum, A.I. Ceña, V. Cenci, S. Cerella, C. Cervia, D. Cetrullo, S. Chaachouay, H. Chae, H.-J. Chagin, A.S. Chai, C.-Y. Chakrabarti, G. Chamilos, G. Chan, E.Y.W. Chan, M.T.V. Chandra, D. Chandra, P. Chang, C.-P. Chang, R.C.-C. Chang, T.Y. Chatham, J.C. Chatterjee, S. Chauhan, S. Che, Y. Cheetham, M.E. Cheluvappa, R. Chen, C.-J. Chen, G. Chen, G.-C. Chen, G. Chen, H. Chen, J.W. Chen, J.-K. Chen, M. Chen, M. Chen, P. Chen, Q. Chen, Q. Chen, S.-D. Chen, S. Chen, S.S.-L. Chen, W. Chen, W.-J. Chen, W.Q. Chen, W. Chen, X. Chen, Y.-H. Chen, Y.-G. Chen, Y. Chen, Y. Chen, Y. Chen, Y.-J. Chen, Y.-Q. Chen, Y. Chen, Z. Chen, Z. Cheng, A. Cheng, C.H.K. Cheng, H. Cheong, H. Cherry, S. Chesney, J. Cheung, C.H.A. Chevet, E. Chi, H.C. Chi, S.-G. Chiacchiera, F. Chiang, H.-L. Chiarelli, R. Chiariello, M. Chieppa, M. Chin, L.-S. Chiong, M. Chiu, G.N.C. Cho, D.-H. Cho, S.-G. Cho, W.C. Cho, Y.-Y. Cho, Y.-S. Choi, A.M.K. Choi, E.-J. Choi, E.-K. Choi, J. Choi, M.E. Choi, S.-I. Chou, T.-F. Chouaib, S. Choubey, D. Choubey, V. Chow, K.-C. Chowdhury, K. Chu, C.T. Chuang, T.-H. Chun, T. Chung, H. Chung, T. Chung, Y.-L. Chwae, Y.-J. Cianfanelli, V. Ciarcia, R. Ciechomska, I.A. Ciriolo, M.R. Cirone, M. Claerhout, S. Clague, M.J. Cl� ria, J. Clarke, P.G.H. Clarke, R. Clementi, E. Cleyrat, C. Cnop, M. Coccia, E.M. Cocco, T. Codogno, P. Coers, J. Cohen, E.E.W. Colecchia, D. Coletto, L. Coll, N.S. Colucci-Guyon, E. Comincini, S. Condello, M. Cook, K.L. Coombs, G.H. Cooper, C.D. Cooper, J.M. Coppens, I. Corasaniti, M.T. Corazzari, M. Corbalan, R. Corcelle-Termeau, E. Cordero, M.D. Corral-Ramos, C. Corti, O. Cossarizza, A. Costelli, P. Costes, S. Cotman, S.L. Coto-Montes, A. Cottet, S. Couve, E. Covey, L.R. Cowart, L.A. Cox, J.S. Coxon, F.P. Coyne, C.B. Cragg, M.S. Craven, R.J. Crepaldi, T. Crespo, J.L. Criollo, A. Crippa, V. Cruz, M.T. Cuervo, A.M. Cuezva, J.M. Cui, T. Cutillas, P.R. Czaja, M.J. Czyzyk-Krzeska, M.F. Dagda, R.K. Dahmen, U. Dai, C. Dai, W. Dai, Y. Dalby, K.N. Valle, L.D. Dalmasso, G. D'amelio, M. Damme, M. Darfeuille-Michaud, A. Dargemont, C. Darley-Usmar, V.M. Dasarathy, S. Dasgupta, B. Dash, S. Dass, C.R. Davey, H.M. Davids, L.M. Dávila, D. Davis, R.J. Dawson, T.M. Dawson, V.L. Daza, P. de Belleroche, J. de Figueiredo, P. de Figueiredo, R.C.B.Q. de la Fuente, J. De Martino, L. De Matteis, A. De Meyer, G.R.Y. De Milito, A. De Santi, M. de Souza, W. De Tata, V. De Zio, D. Debnath, J. Dechant, R. Decuypere, J.-P. Deegan, S. Dehay, B. Del Bello, B. Del Re, D.P. Delage-Mourroux, R. Delbridge, L.M.D. Deldicque, L. Delorme-Axford, E. Deng, Y. Dengjel, J. Denizot, M. Dent, P. Der, C.J. Deretic, V. Derrien, B. Deutsch, E. Devarenne, T.P. Devenish, R.J. Di Bartolomeo, S. Di Daniele, N. Di Domenico, F. Di Nardo, A. Di Paola, S. Di Pietro, A. Di Renzo, L. Di Antonio, A. Díaz-Araya, G. Díaz-Laviada, I. Diaz-Meco, M.T. Diaz-Nido, J. Dickey, C.A. Dickson, R.C. Diederich, M. Digard, P. Dikic, I. Dinesh-Kumar, S.P. Ding, C. Ding, W.-X. Ding, Z. Dini, L. Distler, J.H.W. Diwan, A. Djavaheri-Mergny, M. Dmytruk, K. Dobson, R.C.J. Doetsch, V. Dokladny, K. Dokudovskaya, S. Donadelli, M. Dong, X.C. Dong, X. Dong, Z. Donohue, T.M., Jr. Donohue-Jr, T.M. Doran, K.S. D'orazi, G. Dorn, G.W., II Dosenko, V. Dridi, S. Drucker, L. Du, J. Du, L.-L. Du, L. du Toit, A. Dua, P. Duan, L. Duann, P. Dubey, V.K. Duchen, M.R. Duchosal, M.A. Duez, H. Dugail, I. Dumit, V.I. Duncan, M.C. Dunlop, E.A. Dunn, W.A., Jr. Dupont, N. Dupuis, L. Durán, R.V. Durcan, T.M. Duvezin-Caubet, S. Duvvuri, U. Eapen, V. Ebrahimi-Fakhari, D. Echard, A. Eckhart, L. Edelstein, C.L. Edinger, A.L. Eichinger, L. Eisenberg, T. Eisenberg-Lerner, A. Eissa, N.T. El-Deiry, W.S. El-Khoury, V. Elazar, Z. Eldar-Finkelman, H. Elliott, C.J.H. Emanuele, E. Emmenegger, U. Engedal, N. Engelbrecht, A.-M. Engelender, S. Enserink, J.M. Erdmann, R. Erenpreisa, J. Eri, R. Eriksen, J.L. Erman, A. Escalante, R. Eskelinen, E.-L. Espert, L. Esteban-Martínez, L. Evans, T.J. Fabri, M. Fabrias, G. Fabrizi, C. Facchiano, A. Færgeman, N.J. Faggioni, A. Fairlie, W.D. Fan, C. Fan, D. Fan, J. Fang, S. Fanto, M. Fanzani, A. Farkas, T. Faure, M. Favier, F.B. Fearnhead, H. Federici, M. Fei, E. Felizardo, T.C. Feng, H. Feng, Y. Feng, Y. Ferguson, T.A. Fernández, Á.F. Fernandez-Barrena, M.G. Fernandez-Checa, J.C. Fernández-López, A. Fernandez-Zapico, M.E. Feron, O. Ferraro, E. Ferreira-Halder, C.V. Fesus, L. Feuer, R. Fiesel, F.C. Filippi-Chiela, E.C. Filomeni, G. Fimia, G.M. Fingert, J.H. Finkbeiner, S. Finkel, T. Fiorito, F. Fisher, P.B. Flajolet, M. Flamigni, F. Florey, O. Florio, S. Floto, R.A. Folini, M. Follo, C. Fon, E.A. Fornai, F. Fortunato, F. Fraldi, A. Franco, R. Francois, A. François, A. Frankel, L.B. Fraser, I.D.C. Frey, N. Freyssenet, D.G. Frezza, C. Friedman, S.L. Frigo, D.E. Fu, D. Fuentes, J.M. Fueyo, J. Fujitani, Y. Fujiwara, Y. Fujiya, M. Fukuda, M. Fulda, S. Fusco, C. Gabryel, B. Gaestel, M. Gailly, P. Gajewska, M. Galadari, S. Galili, G. Galindo, I. Galindo, M.F. Galliciotti, G. Galluzzi, L. Galluzzi, L. Galy, V. Gammoh, N. Gandy, S. Ganesan, A.K. Ganesan, S. Ganley, I.G. Gannagé, M. Gao, F.-B. Gao, F. Gao, J.-X. Nannig, L.G. Véscovi, E.G. Garcia-Macía, M. Garcia-Ruiz, C. Garg, A.D. Garg, P.K. Gargini, R. Gassen, N.C. Gatica, D. Gatti, E. Gavard, J. Gavathiotis, E. Ge, L. Ge, P. Ge, S. Gean, P.-W. Gelmetti, V. Genazzani, A.A. Geng, J. Genschik, P. Gerner, L. Gestwicki, J.E. Gewirtz, D.A. Ghavami, S. Ghigo, E. Ghosh, D. Giammarioli, A.M. Giampieri, F. Giampietri, C. Giatromanolaki, A. Gibbings, D.J. Gibellini, L. Gibson, S.B. Ginet, V. Giordano, A. Giorgini, F. Giovannetti, E. Girardin, S.E. Gispert, S. Giuliano, S. Gladson, C.L. Glavic, A. Gleave, M. Godefroy, N. Gogal, R.M., Jr. Gokulan, K. Goldman, G.H. Goletti, D. Goligorsky, M.S. Gomes, A.V. Gomes, L.C. Gomez, H. Gomez-Manzano, C. Gómez-Sánchez, R. Gonçalves, D.A.P. Goncu, E. Gong, Q. Gongora, C. Gonzalez, C.B. Gonzalez-Alegre, P. Gonzalez-Cabo, P. González-Polo, R.A. Goping, I.S. Gorbea, C. Gorbunov, N.V. Goring, D.R. Gorman, A.M. Gorski, S.M. Goruppi, S. Goto-Yamada, S. Gotor, C. Gottlieb, R.A. Gozes, I. Gozuacik, D. Graba, Y. Graef, M. Granato, G.E. Grant, G.D. Grant, S. Gravina, G.L. Green, D.R. Greenhough, A. Greenwood, M.T. Grimaldi, B. Gros, F. Grose, C. Groulx, J.-F. Gruber, F. Grumati, P. Grune, T. Guan, J.-L. Guan, K.-L. Guerra, B. Guillen, C. Gulshan, K. Gunst, J. Guo, C. Guo, L. Guo, M. Guo, W. Guo, X.-G. Gust, A.A. Gustafsson, Å.B. Gutierrez, E. Gutierrez, M.G. Gwak, H.-S. Haas, A. Haber, J.E. Hadano, S. Hagedorn, M. Hahn, D.R. Halayko, A.J. Hamacher-Brady, A. Hamada, K. Hamai, A. Hamann, A. Hamasaki, M. Hamer, I. Hamid, Q. Hammond, E.M. Han, F. Han, W. Handa, J.T. Hanover, J.A. Hansen, M. Harada, M. Harhaji-Trajkovic, L. Harper, J.W. Harrath, A.H. Harris, A.L. Harris, J. Hasler, U. Hasselblatt, P. Hasui, K. Hawley, R.G. Hawley, T.S. He, C. He, C.Y. He, F. He, G. He, R.-R. He, X.-H. He, Y.-W. He, Y.-Y. Heath, J.K. Hébert, M.-J. Heinzen, R.A. Helgason, G.V. Hensel, M. Henske, E.P. Her, C. Herman, P.K. Hernández, A. Hernandez, C. Hernández-Tiedra, S. Hetz, C. Hiesinger, P.R. Higaki, K. Hilfiker, S. Hill, B.G. Hill, J.A. Hill, W.D. Hino, K. Hofius, D. Hofman, P. Höglinger, G.U. Höhfeld, J. Holz, M.K. Hong, Y. Hood, D.A. Hoozemans, J.J.M. Hoppe, T. Hsu, C. Hsu, C.-Y. Hsu, L.-C. Hu, D. Hu, G. Hu, H.-M. Hu, H. Hu, M.C. Hu, Y.-C. Hu, Z.-W. Hua, F. Hua, Y. Huang, C. Huang, H.-L. Huang, K.-H. Huang, K.-Y. Huang, S. Huang, S. Huang, W.-P. Huang, Y.-R. Huang, Y. Huang, Y. Huber, T.B. Huebbe, P. Huh, W.-K. Hulmi, J.J. Hur, G.M. Hurley, J.H. Husak, Z. Hussain, S.N.A. Hussain, S. Hwang, J.J. Hwang, S. Hwang, T.I.S. Ichihara, A. Imai, Y. Imbriano, C. Inomata, M. Into, T. Iovane, V. Iovanna, J.L. Iozzo, R.V. Ip, N.Y. Irazoqui, J.E. Iribarren, P. Isaka, Y. Isakovic, A.J. Ischiropoulos, H. Isenberg, J.S. Ishaq, M. Ishida, H. Ishii, I. Ishmael, J.E. Isidoro, C. Isobe, K.-I. Isono, E. Issazadeh-Navikas, S. Itahana, K. Itakura, E. Ivanov, A.I. Iyer, A.K.V. Izquierdo, J.M. Izumi, Y. Izzo, V. Jäättelä, M. Jaber, N. Jackson, D.J. Jackson, W.T. Jacob, T.G. Jacques, T.S. Jagannath, C. Jain, A. Jana, N.R. Jang, B.K. Jani, A. Janji, B. Jannig, P.R. Jansson, P.J. Jean, S. Jendrach, M. Jeon, J.-H. Jessen, N. Jeung, E.-B. Jia, K. Jia, L. Jiang, H. Jiang, H. Jiang, L. Jiang, T. Jiang, X. Jiang, X. Jiang, Y. Jiang, Y. Jiménez, A. Jin, C. Jin, H. Jin, L. Jin, M. Jin, S. Jinwal, U.K. Jo, E.-K. Johansen, T. Johnson, D.E. Johnson, G.V.W. Johnson, J.D. Jonasch, E. Jones, C. Joosten, L.A.B. Jordan, J. Joseph, A.-M. Joseph, B. Joubert, A.M. Ju, D. Ju, J. Juan, H.-F. Juenemann, K. Juhász, G. Jung, H.S. Jung, J.U. Jung, Y.-K. Jungbluth, H. Justice, M.J. Jutten, B. Kaakoush, N.O. Kaarniranta, K. Kaasik, A. Kabuta, T. Kaeffer, B. Kågedal, K. Kahana, A. Kajimura, S. Kakhlon, O. Kalia, M. Kalvakolanu, D.V. Kamada, Y. Kambas, K. Kaminskyy, V.O. Kampinga, H.H. Kandouz, M. Kang, C. Kang, R. Kang, T.-C. Kanki, T. Kanneganti, T.-D. Kanno, H. Kanthasamy, A.G. Kantorow, M. Kaparakis-Liaskos, M. Kapuy, O. Karantza, V. Karim, M.R. Karmakar, P. Kaser, A. Kaushik, S. Kawula, T. Kaynar, A.M. Ke, P.-Y. Ke, Z.-J. Kehrl, J.H. Keller, K.E. Kemper, J.K. Kenworthy, A.K. Kepp, O. Kern, A. Kesari, S. Kessel, D. Ketteler, R. Kettelhut, I.C. Khambu, B. Khan, M.M. Khandelwal, V.K.M. Khare, S. Kiang, J.G. Kiger, A.A. Kihara, A. Kim, A.L. Kim, C.H. Kim, D.R. Kim, D.-H. Kim, E.K. Kim, H.Y. Kim, H.-R. Kim, J.-S. Kim, J.H. Kim, J.C. Kim, J.H. Kim, K.W. Kim, M.D. Kim, M.-M. Kim, P.K. Kim, S.W. Kim, S.-Y. Kim, Y.-S. Kim, Y. Kimchi, A. Kimmelman, A.C. Kimura, T. King, J.S. Kirkegaard, K. Kirkin, V. Kirshenbaum, L.A. Kishi, S. Kitajima, Y. Kitamoto, K. Kitaoka, Y. Kitazato, K. Kley, R.A. Klimecki, W.T. Klinkenberg, M. Klucken, J. Knævelsrud, H. Knecht, E. Knuppertz, L. Ko, J.-L. Kobayashi, S. Koch, J.C. Koechlin-Ramonatxo, C. Koenig, U. Koh, Y.H. Köhler, K. Kohlwein, S.D. Koike, M. Komatsu, M. Kominami, E. Kong, D. Kong, H.J. Konstantakou, E.G. Kopp, B.T. Korcsmaros, T. Korhonen, L. Korolchuk, V.I. Koshkina, N.V. Kou, Y. Koukourakis, M.I. Koumenis, C. Kovács, A.L. Kovács, T. Kovacs, W.J. Koya, D. Kraft, C. Krainc, D. Kramer, H. Kravic-Stevovic, T. Krek, W. Kretz-Remy, C. Krick, R. Krishnamurthy, M. Kriston-Vizi, J. Kroemer, G. Kruer, M.C. Kruger, R. Ktistakis, N.T. Kuchitsu, K. Kuhn, C. Kumar, A.P. Kumar, A. Kumar, A. Kumar, D. Kumar, D. Kumar, R. Kumar, S. Kundu, M. Kung, H.-J. Kuno, A. Kuo, S.-H. Kuret, J. Kurz, T. Kwok, T. Kwon, T.K. Kwon, Y.T. Kyrmizi, I. La Spada, A.R. Lafont, F. Lahm, T. Lakkaraju, A. Lam, T. Lamark, T. Lancel, S. Landowski, T.H. Lane, D.J.R. Lane, J.D. Lanzi, C. Lapaquette, P. Lapierre, L.R. Laporte, J. Laukkarinen, J. Laurie, G.W. Lavandero, S. Lavie, L. Lavoie, M.J. Law, B.Y.K. Law, H.K.-W. Law, K.B. Layfield, R. Lazo, P.A. Le Cam, L. Le Roch, K.G. Le Stunff, H. Leardkamolkarn, V. Lecuit, M. Lee, B.-H. Lee, C.-H. Lee, E.F. Lee, G.M. Lee, H.-J. Lee, H. Lee, J.K. Lee, J. Lee, J.-H. Lee, J.H. Lee, M. Lee, M.-S. Lee, P.J. Lee, S.W. Lee, S.-J. Lee, S.-J. Lee, S.Y. Lee, S.H. Lee, S.S. Lee, S.-J. Lee, S. Lee, Y.-R. Lee, Y.J. Lee, Y.H. Leeuwenburgh, C. Lefort, S. Legouis, R. Lei, J. Lei, Q.-Y. Leib, D.A. Leibowitz, G. Lekli, I. Lemaire, S.D. Lemasters, J.J. Lemberg, M.K. Lemoine, A. Leng, S. Lenz, G. Lenzi, P. Lerman, L.O. Barbato, D.L. Leu, J.I.J. Leung, H.Y. Levine, B. Lewis, P.A. Lezoualch, F. Li, C. Li, F. Li, F.-J. Li, J. Li, K. Li, L. Li, M. Li, Q. Li, R. Li, S. Li, W. Li, X. Li, Y. Lian, J. Liang, C. Liang, Q. Liao, Y. Liberal, J. Liberski, P.P. Lie, P. Lieberman, A.P. Lim, H.J. Lim, K.-L. Lim, K. Lima, R.T. Lin, C.-S. Lin, C.-F. Lin, F. Lin, F. Lin, F.-C. Lin, K. Lin, K.-H. Lin, P.-H. Lin, T. Lin, W.-W. Lin, Y.-S. Lin, Y. Linden, R. Lindholm, D. Lindqvist, L.M. Lingor, P. Linkermann, A. Liotta, L.A. Lipinski, M.M. Lira, V.A. Lisanti, M.P. Liton, P.B. Liu, B. Liu, C. Liu, C.-F. Liu, F. Liu, H.-J. Liu, J. Liu, J.-J. Liu, J.-L. Liu, K. Liu, L. Liu, L. Liu, Q. Liu, R.-Y. Liu, S. Liu, S. Liu, W. Liu, X.-D. Liu, X. Liu, X.-H. Liu, X. Liu, X. Liu, X. Liu, Y. Liu, Y. Liu, Z. Liu, Z. Liuzzi, J.P. Lizard, G. Ljujic, M. Lodhi, I.J. Logue, S.E. Lokeshwar, B.L. Long, Y.C. Lonial, S. Loos, B. López-Otín, C. López-Vicario, C. Lorente, M. Lorenzi, P.L. Lõrincz, P. Los, M. Lotze, M.T. Lovat, P.E. Lu, B. Lu, B. Lu, J. Lu, Q. Lu, S.-M. Lu, S. Lu, Y. Luciano, F. Luckhart, S. Lucocq, J.M. Ludovico, P. Lugea, A. Lukacs, N.W. Lum, J.J. Lund, A.H. Luo, H. Luo, J. Luo, S. Luparello, C. Lyons, T. Ma, J. Ma, Y. Ma, Y. Ma, Z. Machado, J. Machado-Santelli, G.M. Macian, F. MacIntosh, G.C. MacKeigan, J.P. Macleod, K.F. MacMicking, J.D. MacMillan-Crow, L.A. Madeo, F. Madesh, M. Madrigal-Matute, J. Maeda, A. Maeda, T. Maegawa, G. Maellaro, E. Maes, H. Magariños, M. Maiese, K. Maiti, T.K. Maiuri, L. Maiuri, M.C. Maki, C.G. Malli, R. Malorni, W. Maloyan, A. Mami-Chouaib, F. Man, N. Mancias, J.D. Mandelkow, E.-M. Mandell, M.A. Manfredi, A.A. Manié, S.N. Manzoni, C. Mao, K. Mao, Z. Mao, Z.-W. Marambaud, P. Marconi, A.M. Marelja, Z. Marfe, G. Margeta, M. Margittai, E. Mari, M. Mariani, F.V. Marin, C. Marinelli, S. Mariño, G. Markovic, I. Marquez, R. Martelli, A.M. Martens, S. Martin, K.R. Martin, S.J. Martin, S. Martin-Acebes, M.A. Martín-Sanz, P. Martinand-Mari, C. Martinet, W. Martinez, J. Martinez-Lopez, N. Martinez-Outschoorn, U. Martínez-Velázquez, M. Martinez-Vicente, M. Martins, W.K. Mashima, H. Mastrianni, J.A. Matarese, G. Matarrese, P. Mateo, R. Matoba, S. Matsumoto, N. Matsushita, T. Matsuura, A. Matsuzawa, T. Mattson, M.P. Matus, S. Maugeri, N. Mauvezin, C. Mayer, A. Maysinger, D. Mazzolini, G.D. McBrayer, M.K. McCall, K. McCormick, C. McInerney, G.M. McIver, S.C. McKenna, S. McMahon, J.J. McNeish, I.A. Mechta-Grigoriou, F. Medema, J.P. Medina, D.L. Megyeri, K. Mehrpour, M. Mehta, J.L. Mei, Y. Meier, U.-C. Meijer, A.J. Meléndez, A. Melino, G. Melino, S. de Melo, E.J.T. Mena, M.A. Meneghini, M.D. Menendez, J.A. Menezes, R. Meng, L. Meng, L.-H. Meng, S. Menghini, R. Menko, A.S. Menna-Barreto, R.F.S. Menon, M.B. Meraz-Ríos, M.A. Merla, G. Merlini, L. Merlot, A.M. Meryk, A. Meschini, S. Meyer, J.N. Mi, M.-T. Miao, C.-Y. Micale, L. Michaeli, S. Michiels, C. Migliaccio, A.R. Mihailidou, A.S. Mijaljica, D. Mikoshiba, K. Milan, E. Miller-Fleming, L. Mills, G.B. Mills, I.G. Minakaki, G. Minassian, B.A. Ming, X.-F. Minibayeva, F. Minina, E.A. Mintern, J.D. Minucci, S. Miranda-Vizuete, A. Mitchell, C.H. Miyamoto, S. Miyazawa, K. Mizushima, N. Mnich, K. Mograbi, B. Mohseni, S. Moita, L.F. Molinari, M. Molinari, M. Møller, A.B. Mollereau, B. Mollinedo, F. Mongillo, M. Monick, M.M. Montagnaro, S. Montell, C. Moore, D.J. Moore, M.N. Mora-Rodriguez, R. Moreira, P.I. Morel, E. Morelli, M.B. Moreno, S. Morgan, M.J. Moris, A. Moriyasu, Y. Morrison, J.L. Morrison, L.A. Morselli, E. Moscat, J. Moseley, P.L. Mostowy, S. Motori, E. Mottet, D. Mottram, J.C. Moussa, C.E.-H. Mpakou, V.E. Mukhtar, H. Levy, J.M.M. Muller, S. Muñoz-Moreno, R. Muñoz-Pinedo, C. Münz, C. Murphy, M.E. Murray, J.T. Murthy, A. Mysorekar, I.U. Nabi, I.R. Nabissi, M. Nader, G.A. Nagahara, Y. Nagai, Y. Nagata, K. Nagelkerke, A. Nagy, P. Naidu, S.R. Nair, S. Nakano, H. Nakatogawa, H. Nanjundan, M. Napolitano, G. Naqvi, N.I. Nardacci, R. Narendra, D.P. Narita, M. Nascimbeni, A.C. Natarajan, R. Navegantes, L.C. Nawrocki, S.T. Nazarko, T.Y. Nazarko, V.Y. Neill, T. Neri, L.M. Netea, M.G. Netea-Maier, R.T. Neves, B.M. Ney, P.A. Nezis, I.P. Nguyen, H.T.T. Nguyen, H.P. Nicot, A.-S. Nilsen, H. Nilsson, P. Nishimura, M. Nishino, I. Niso-Santano, M. Niu, H. Nixon, R.A. Njar, V.C.O. Noda, T. Noegel, A.A. Nolte, E.M. Norberg, E. Norga, K.K. Noureini, S.K. Notomi, S. Notterpek, L. Nowikovsky, K. Nukina, N. Nürnberger, T. O'donnell, V.B. O'donovan, T. O'dwyer, P.J. Oehme, I. Oeste, C.L. Ogawa, M. Ogretmen, B. Ogura, Y. Oh, Y.J. Ohmuraya, M. Ohshima, T. Ojha, R. Okamoto, K. Okazaki, T. Oliver, F.J. Ollinger, K. Olsson, S. Orban, D.P. Ordonez, P. Orhon, I. Orosz, L. O'rourke, E.J. Orozco, H. Ortega, A.L. Ortona, E. Osellame, L.D. Oshima, J. Oshima, S. Osiewacz, H.D. Otomo, T. Otsu, K. Ou, J.-H.J. Outeiro, T.F. Ouyang, D.-Y. Ouyang, H. Overholtzer, M. Ozbun, M.A. Ozdinler, P.H. Ozpolat, B. Pacelli, C. Paganetti, P. Page, G. Pages, G. Pagnini, U. Pajak, B. Pak, S.C. Pakos-Zebrucka, K. Pakpour, N. Palková, Z. Palladino, F. Pallauf, K. Pallet, N. Palmieri, M. Paludan, S.R. Palumbo, C. Palumbo, S. Pampliega, O. Pan, H. Pan, W. Panaretakis, T. Pandey, A. Pantazopoulou, A. Papackova, Z. Papademetrio, D.L. Papassideri, I. Papini, A. Parajuli, N. Pardo, J. Parekh, V.V. Parenti, G. Park, J.-I. Park, J. Park, O.K. Parker, R. Parlato, R. Parys, J.B. Parzych, K.R. Pasquet, J.-M. Pasquier, B. Pasumarthi, K.B.S. Patterson, C. Pattingre, S. Pattison, S. Pause, A. Pavenstädt, H. Pavone, F. Pedrozo, Z. Peña, F.J. Peñalva, M.A. Pende, M. Peng, J. Penna, F. Penninger, J.M. Pensalfini, A. Pepe, S. Pereira, G.J.S. Pereira, P.C. de la Cruz, V.P. Pérez-Pérez, M.E. Pérez-Rodríguez, D. Pérez-Sala, D. Perier, C. Perl, A. Perlmutter, D.H. Perrotta, I. Pervaiz, S. Pesonen, M. Pessin, J.E. Peters, G.J. Petersen, M. Petrache, I. Petrof, B.J. Petrovski, G. Phang, J.M. Piacentini, M. Pierdominici, M. Pierre, P. Pierrefite-Carle, V. Pietrocola, F. Pimentel-Muiños, F.X. Pinar, M. Pineda, B. Pinkas-Kramarski, R. Pinti, M. Pinton, P. Piperdi, B. Piret, J.M. Platanias, L.C. Platta, H.W. Plowey, E.D. Pöggeler, S. Poirot, M. Polčic, P. Poletti, A. Poon, A.H. Popelka, H. Popova, B. Poprawa, I. Poulose, S.M. Poulton, J. Powers, S.K. Powers, T. Pozuelo-Rubio, M. Prak, K. Prange, R. Prescott, M. Priault, M. Prince, S. Proia, R.L. Proikas-Cezanne, T. Prokisch, H. Promponas, V.J. Przyklenk, K. Puertollano, R. Pugazhenthi, S. Puglielli, L. Pujol, A. Puyal, J. Pyeon, D. Qi, X. Qian, W.-B. Qin, Z.-H. Qiu, Y. Qu, Z. Quadrilatero, J. Quinn, F. Raben, N. Rabinowich, H. Radogna, F. Ragusa, M.J. Rahmani, M. Raina, K. Ramanadham, S. Ramesh, R. Rami, A. Randall-Demllo, S. Randow, F. Rao, H. Rao, V.A. Rasmussen, B.B. Rasse, T.M. Ratovitski, E.A. Rautou, P.-E. Ray, S.K. Razani, B. Reed, B.H. Reggiori, F. Rehm, M. Reichert, A.S. Rein, T. Reiner, D.J. Reits, E. Ren, J. Ren, X. Renna, M. Reusch, J.E.B. Revuelta, J.L. Reyes, L. Rezaie, A.R. Richards, R.I. Richardson, R. Richetta, C. Riehle, M.A. Rihn, B.H. Rikihisa, Y. Riley, B.E. Rimbach, G. Rippo, M.R. Ritis, K. Rizzi, F. Rizzo, E. Roach, P.J. Robbins, J. Roberge, M. Roca, G. Roccheri, M.C. Rocha, S. Rodrigues, C.M.P. Rodríguez, C.I. de Cordoba, S.R. Rodriguez-Muela, N. Roelofs, J. Rogov, V.V. Rohn, T.T. Rohrer, B. Romanelli, D. Romani, L. Romano, P.S. Roncero, M.I.G. Rosa, J.L. Rosello, A. Rosen, K.V. Rosenstiel, P. Rost-Roszkowska, M. Roth, K.A. Roué, G. Rouis, M. Rouschop, K.M. Ruan, D.T. Ruano, D. Rubinsztein, D.C. Rucker, E.B., III Rudich, A. Rudolf, E. Rudolf, R. Ruegg, M.A. Ruiz-Roldan, C. Ruparelia, A.A. Rusmini, P. Russ, D.W. Russo, G.L. Russo, G. Russo, R. Rusten, T.E. Ryabovol, V. Ryan, K.M. Ryter, S.W. Sabatini, D.M. Sacher, M. Sachse, C. Sack, M.N. Sadoshima, J. Saftig, P. Sagi-Eisenberg, R. Sahni, S. Saikumar, P. Saito, T. Saitoh, T. Sakakura, K. Sakoh-Nakatogawa, M. Sakuraba, Y. Salazar-Roa, M. Salomoni, P. Saluja, A.K. Salvaterra, P.M. Salvioli, R. Samali, A. Sanchez, A.M.J. Sánchez-Alcázar, J.A. Sanchez-Prieto, R. Sandri, M. Sanjuan, M.A. Santaguida, S. Santambrogio, L. Santoni, G. Dos Santos, C.N. Saran, S. Sardiello, M. Sargent, G. Sarkar, P. Sarkar, S. Sarrias, M.R. Sarwal, M.M. Sasakawa, C. Sasaki, M. Sass, M. Sato, K. Sato, M. Satriano, J. Savaraj, N. Saveljeva, S. Schaefer, L. Schaible, U.E. Scharl, M. Schatzl, H.M. Schekman, R. Scheper, W. Schiavi, A. Schipper, H.M. Schmeisser, H. Schmidt, J. Schmitz, I. Schneider, B.E. Schneider, E.M. Schneider, J.L. Schon, E.A. Schönenberger, M.J. Schönthal, A.H. Schorderet, D.F. Schröder, B. Schuck, S. Schulze, R.J. Schwarten, M. Schwarz, T.L. Sciarretta, S. Scotto, K. Scovassi, A.I. Screaton, R.A. Screen, M. Seca, H. Sedej, S. Segatori, L. Segev, N. Seglen, P.O. Seguí-Simarro, J.M. Segura-Aguilar, J. Seiliez, I. Seki, E. Sell, C. Semenkovich, C.F. Semenza, G.L. Sen, U. Serra, A.L. Serrano-Puebla, A. Sesaki, H. Setoguchi, T. Settembre, C. Shacka, J.J. Shajahan-Haq, A.N. Shapiro, I.M. Sharma, S. She, H. Shen, C.-K.J. Shen, C.-C. Shen, H.-M. Shen, S. Shen, W. Sheng, R. Sheng, X. Sheng, Z.-H. Shepherd, T.G. Shi, J. Shi, Q. Shi, Q. Shi, Y. Shibutani, S. Shibuya, K. Shidoji, Y. Shieh, J.-J. Shih, C.-M. Shimada, Y. Shimizu, S. Shin, D.W. Shinohara, M.L. Shintani, M. Shintani, T. Shioi, T. Shirabe, K. Shiri-Sverdlov, R. Shirihai, O. Shore, G.C. Shu, C.-W. Shukla, D. Sibirny, A.A. Sica, V. Sigurdson, C.J. Sigurdsson, E.M. Sijwali, P.S. Sikorska, B. Silveira, W.A. Silvente-Poirot, S. Silverman, G.A. Simak, J. Simmet, T. Simon, A.K. Simon, H.-U. Simone, C. Simons, M. Simonsen, A. Singh, R. Singh, S.V. Singh, S.K. Sinha, D. Sinha, S. Sinicrope, F.A. Sirko, A. Sirohi, K. Sishi, B.J.N. Sittler, A. Siu, P.M. Sivridis, E. Skwarska, A. Slack, R. Slaninová, I. Slavov, N. Smaili, S.S. Smalley, K.S.M. Smith, D.R. Soenen, S.J. Soleimanpour, S.A. Solhaug, A. Somasundaram, K. Son, J.H. Sonawane, A. Song, C. Song, F. Song, H.K. Song, J.-X. Song, W. Soo, K.Y. Sood, A.K. Soong, T.W. Soontornniyomkij, V. Sorice, M. Sotgia, F. Soto-Pantoja, D.R. Sotthibundhu, A. Sousa, M.J. Spaink, H.P. Span, P.N. Spang, A. Sparks, J.D. Speck, P.G. Spector, S.A. Spies, C.D. Springer, W. Clair, D.S. Stacchiotti, A. Staels, B. Stang, M.T. Starczynowski, D.T. Starokadomskyy, P. Steegborn, C. Steele, J.W. Stefanis, L. Steffan, J. Stellrecht, C.M. Stenmark, H. Stepkowski, T.M. Stern, S.T. Stevens, C. Stockwell, B.R. Stoka, V. Storchova, Z. Stork, B. Stratoulias, V. Stravopodis, D.J. Strnad, P. Strohecker, A.M. Ström, A.-L. Stromhaug, P. Stulik, J. Su, Y.-X. Su, Z. Subauste, C.S. Subramaniam, S. Sue, C.M. Suh, S.W. Sui, X. Sukseree, S. Sulzer, D. Sun, F.-L. Sun, J. Sun, J. Sun, S.-Y. Sun, Y. Sun, Y. Sun, Y. Sundaramoorthy, V. Sung, J. Suzuki, H. Suzuki, K. Suzuki, N. Suzuki, T. Suzuki, Y.J. Swanson, M.S. Swanton, C. Swärd, K. Swarup, G. Sweeney, S.T. Sylvester, P.W. Szatmari, Z. Szegezdi, E. Szlosarek, P.W. Taegtmeyer, H. Tafani, M. Taillebourg, E. Tait, S.W.G. Takacs-Vellai, K. Takahashi, Y. Takáts, S. Takemura, G. Takigawa, N. Talbot, N.J. Tamagno, E. Tamburini, J. Tan, C.-P. Tan, L. Tan, M.L. Tan, M. Tan, Y.-J. Tanaka, K. Tanaka, M. Tang, D. Tang, D. Tang, G. Tanida, I. Tanji, K. Tannous, B.A. Tapia, J.A. Tasset-Cuevas, I. Tatar, M. Tavassoly, I. Tavernarakis, N. Taylor, A. Taylor, G.S. Taylor, G.A. Taylor, J.P. Taylor, M.J. Tchetina, E.V. Tee, A.R. Teixeira-Clerc, F. Telang, S. Tencomnao, T. Teng, B.-B. Teng, R.-J. Terro, F. Tettamanti, G. Theiss, A.L. Theron, A.E. Thomas, K.J. Thomé, M.P. Thomes, P.G. Thorburn, A. Thorner, J. Thum, T. Thumm, M. Thurston, T.L.M. Tian, L. Till, A. Ting, J.P.-Y. Ting, J.P.Y. Titorenko, V.I. Toker, L. Toldo, S. Tooze, S.A. Topisirovic, I. Torgersen, M.L. Torosantucci, L. Torriglia, A. Torrisi, M.R. Tournier, C. Towns, R. Trajkovic, V. Travassos, L.H. Triola, G. Tripathi, D.N. Trisciuoglio, D. Troncoso, R. Trougakos, I.P. Truttmann, A.C. Tsai, K.-J. Tschan, M.P. Tseng, Y.-H. Tsukuba, T. Tsung, A. Tsvetkov, A.S. Tu, S. Tuan, H.-Y. Tucci, M. Tumbarello, D.A. Turk, B. Turk, V. Turner, R.F.B. Tveita, A.A. Tyagi, S.C. Ubukata, M. Uchiyama, Y. Udelnow, A. Ueno, T. Umekawa, M. Umemiya-Shirafuji, R. Underwood, B.R. Ungermann, C. Ureshino, R.P. Ushioda, R. Uversky, V.N. Uzcátegui, N.L. Vaccari, T. Vaccaro, M.I. Váchová, L. Vakifahmetoglu-Norberg, H. Valdor, R. Valente, E.M. Vallette, F. Valverde, A.M. Van den Berghe, G. Van Den Bosch, L. van den Brink, G.R. van der Goot, F.G. van der Klei, I.J. van der Laan, L.J.W. van Doorn, W.G. van Egmond, M. van Golen, K.L. Van Kaer, L. Campagne, M.L. Vandenabeele, P. Vandenberghe, W. Vanhorebeek, I. Varela-Nieto, I. Vasconcelos, M.H. Vasko, R. Vavvas, D.G. Vega-Naredo, I. Velasco, G. Velentzas, A.D. Velentzas, P.D. Vellai, T. Vellenga, E. Vendelbo, M.H. Venkatachalam, K. Ventura, N. Ventura, S. Veras, P.S.T. Verdier, M. Vertessy, B.G. Viale, A. Vidal, M. Vieira, H.L.A. Vierstra, R.D. Vigneswaran, N. Vij, N. Vila, M. Villar, M. Villar, V.H. Villarroya, J. Vindis, C. Viola, G. Viscomi, M.T. Vitale, G. Vogl, D.T. Voitsekhovskaja, O.V. von Haefen, C. von Schwarzenberg, K. Voth, D.E. Vouret-Craviari, V. Vuori, K. Vyas, J.M. Waeber, C. Walker, C.L. Walker, M.J. Walter, J. Wan, L. Wan, X. Wang, B. Wang, C. Wang, C.-Y. Wang, C. Wang, C. Wang, C. Wang, D. Wang, F. Wang, F. Wang, G. Wang, H.-J. Wang, H. Wang, H.-G. Wang, H. Wang, H.-D. Wang, J. Wang, J. Wang, M. Wang, M.-Q. Wang, P.-Y. Wang, P. Wang, R.C. Wang, S. Wang, T.-F. Wang, X. Wang, X.-J. Wang, X.-W. Wang, X. Wang, X. Wang, Y. Wang, Y. Wang, Y. Wang, Y.-J. Wang, Y. Wang, Y. Wang, Y.T. Wang, Y. Wang, Z.-N. Wappner, P. Ward, C. Ward, D.M.V. Warnes, G. Watada, H. Watanabe, Y. Watase, K. Weaver, T.E. Weekes, C.D. Wei, J. Weide, T. Weihl, C.C. Weindl, G. Weis, S.N. Wen, L. Wen, X. Wen, Y. Westermann, B. Weyand, C.M. White, A.R. White, E. Whitton, J.L. Whitworth, A.J. Wiels, J. Wild, F. Wildenberg, M.E. Wileman, T. Wilkinson, D.S. Wilkinson, S. Willbold, D. Williams, C. Williams, K. Williamson, P.R. Winklhofer, K.F. Witkin, S.S. Wohlgemuth, S.E. Wollert, T. Wolvetang, E.J. Wong, E. Wong, G.W. Wong, R.W. Wong, V.K.W. Woodcock, E.A. Wright, K.L. Wu, C. Wu, D. Wu, G.S. Wu, J. Wu, J. Wu, M. Wu, M. Wu, S. Wu, W.K.K. Wu, Y. Wu, Z. Xavier, C.P.R. Xavier, R.J. Xia, G.-X. Xia, T. Xia, W. Xia, Y. Xiao, H. Xiao, J. Xiao, S. Xiao, W. Xie, C.-M. Xie, Z. Xie, Z. Xilouri, M. Xiong, Y. Xu, C. Xu, C. Xu, F. Xu, H. Xu, H. Xu, J. Xu, J. Xu, J. Xu, L. Xu, X. Xu, Y. Xu, Y. Xu, Z.-X. Xu, Z. Xue, Y. Yamada, T. Yamamoto, A. Yamanaka, K. Yamashina, S. Yamashiro, S. Yan, B. Yan, B. Yan, X. Yan, Z. Yanagi, Y. Yang, D.-S. Yang, J.-M. Yang, L. Yang, M. Yang, P.-M. Yang, P. Yang, Q. Yang, W. Yang, W.Y. Yang, X. Yang, Y. Yang, Y. Yang, Z. Yang, Z. Yao, M.-C. Yao, P.J. Yao, X. Yao, Z. Yao, Z. Yasui, L.S. Ye, M. Yedvobnick, B. Yeganeh, B. Yeh, E.S. Yeyati, P.L. Yi, F. Yi, L. Yin, X.-M. Yip, C.K. Yoo, Y.-M. Yoo, Y.H. Yoon, S.-Y. Yoshida, K.-I. Yoshimori, T. Young, K.H. Yu, H. Yu, J.J. Yu, J.-T. Yu, J. Yu, L. Yu, W.H. Yu, X.-F. Yu, Z. Yuan, J. Yuan, Z.-M. Yue, B.Y.J.T. Yue, J. Yue, Z. Zacks, D.N. Zacksenhaus, E. Zaffaroni, N. Zaglia, T. Zakeri, Z. Zecchini, V. Zeng, J. Zeng, M. Zeng, Q. Zervos, A.S. Zhang, D.D. Zhang, F. Zhang, G. Zhang, G.-C. Zhang, H. Zhang, H. Zhang, H. Zhang, J. Zhang, J. Zhang, J. Zhang, J.-P. Zhang, L. Zhang, L. Zhang, L. Zhang, M.-Y. Zhang, X. Zhang, X.D. Zhang, Y. Zhang, Y. Zhang, Y. Zhang, Y. Zhang, Y. Zhao, M. Zhao, W.-L. Zhao, X. Zhao, Y.G. Zhao, Y. Zhao, Y. Zhao, Y.-X. Zhao, Z. Zhao, Z.J. Zheng, D. Zheng, X.-L. Zheng, X. Zhivotovsky, B. Zhong, Q. Zhou, G.-Z. Zhou, G. Zhou, H. Zhou, S.-F. Zhou, X.-J. Zhu, H. Zhu, H. Zhu, W.-G. Zhu, W. Zhu, X.-F. Zhu, Y. Zhuang, S.-M. Zhuang, X. Ziparo, E. Zois, C.E. Zoladek, T. Zong, W.-X. Zorzano, A. Zughaier, S.M.

Published
2016

39. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition)

Author

Klionsky, D.J. Abdelmohsen, K. Abe, A. Abedin, M.J. Abeliovich, H. Arozena, A.A. Adachi, H. Adams, C.M. Adams, P.D. Adeli, K. Adhihetty, P.J. Adler, S.G. Agam, G. Agarwal, R. Aghi, M.K. Agnello, M. Agostinis, P. Aguilar, P.V. Aguirre-Ghiso, J. Airoldi, E.M. Ait-Si-Ali, S. Akematsu, T. Akporiaye, E.T. Al-Rubeai, M. Albaiceta, G.M. Albanese, C. Albani, D. Albert, M.L. Aldudo, J. Algül, H. Alirezaei, M. Alloza, I. Almasan, A. Almonte-Beceril, M. Alnemri, E.S. Alonso, C. Altan-Bonnet, N. Altieri, D.C. Alvarez, S. Alvarez-Erviti, L. Alves, S. Amadoro, G. Amano, A. Amantini, C. Ambrosio, S. Amelio, I. Amer, A.O. Amessou, M. Amon, A. An, Z. Anania, F.A. Andersen, S.U. Andley, U.P. Andreadi, C.K. Andrieu-Abadie, N. Anel, A. Ann, D.K. Anoopkumar-Dukie, S. Antonioli, M. Aoki, H. Apostolova, N. Aquila, S. Aquilano, K. Araki, K. Arama, E. Aranda, A. Araya, J. Arcaro, A. Arias, E. Arimoto, H. Ariosa, A.R. Armstrong, J.L. Arnould, T. Arsov, I. Asanuma, K. Askanas, V. Asselin, E. Atarashi, R. Atherton, S.S. Atkin, J.D. Attardi, L.D. Auberger, P. Auburger, G. Aurelian, L. Autelli, R. Avagliano, L. Avantaggiati, M.L. Avrahami, L. Azad, N. Awale, S. Bachetti, T. Backer, J.M. Bae, D.-H. Bae, J.-S. Bae, O.-N. Bae, S.H. Baehrecke, E.H. Baek, S.-H. Baghdiguian, S. Bagniewska-Zadworna, A. Bai, H. Bai, J. Bai, X.-Y. Bailly, Y. Balaji, K.N. Balduini, W. Ballabio, A. Balzan, R. Banerjee, R. Bánhegyi, G. Bao, H. Barbeau, B. Barrachina, M.D. Barreiro, E. Bartel, B. Bartolomé, A. Bassham, D.C. Bassi, M.T. Bast, R.C., Jr. Basu, A. Batista, M.T. Batoko, H. Battino, M. Bauckman, K. Baumgarner, B.L. Bayer, K.U. Beale, R. Beaulieu, J.-F. Beck, G.R., Jr. Becker, C. Beckham, J.D. Bédard, P.-A. Bednarski, P.J. Begley, T.J. Behl, C. Behrends, C. Behrens, G.M.N. Behrns, K.E. Bejarano, E. Belaid, A. Belleudi, F. Bénard, G. Berchem, G. Bergamaschi, D. Bergami, M. Berkhout, B. Berliocchi, L. Bernard, A. Bernard, M. Bernassola, F. Bertolotti, A. Bess, A.S. Besteiro, S. Bettuzzi, S. Bhalla, S. Bhattacharyya, S. Bhutia, S.K. Biagosch, C. Bianchi, M.W. Biard-Piechaczyk, M. Billes, V. Bincoletto, C. Bingol, B. Bird, S.W. Bitoun, M. Bjedov, I. Blackstone, C. Blanc, L. Blanco, G.A. Blomhoff, H.K. Boada-Romero, E. Böckler, S. Boes, M. Boesze-Battaglia, K. Boise, L.H. Bolino, A. Boman, A. Bonaldo, P. Bordi, M. Bosch, J. Botana, L.M. Botti, J. Bou, G. Bouché, M. Bouchecareilh, M. Boucher, M.-J. Boulton, M.E. Bouret, S.G. Boya, P. Boyer-Guittaut, M. Bozhkov, P.V. Brady, N. Braga, V.M.M. Brancolini, C. Braus, G.H. Bravo-San-Pedro, J.M. Brennan, L.A. Bresnick, E.H. Brest, P. Bridges, D. Bringer, M.-A. Brini, M. Brito, G.C. Brodin, B. Brookes, P.S. Brown, E.J. Brown, K. Broxmeyer, H.E. Bruhat, A. Brum, P.C. Brumell, J.H. Brunetti-Pierri, N. Bryson-Richardson, R.J. Buch, S. Buchan, A.M. Budak, H. Bulavin, D.V. Bultman, S.J. Bultynck, G. Bumbasirevic, V. Burelle, Y. Burke, R.E. Burmeister, M. Bütikofer, P. Caberlotto, L. Cadwell, K. Cahova, M. Cai, D. Cai, J. Cai, Q. Calatayud, S. Camougrand, N. Campanella, M. Campbell, G.R. Campbell, M. Campello, S. Candau, R. Caniggia, I. Cantoni, L. Cao, L. Caplan, A.B. Caraglia, M. Cardinali, C. Cardoso, S.M. Carew, J.S. Carleton, L.A. Carlin, C.R. Carloni, S. Carlsson, S.R. Carmona-Gutierrez, D. Carneiro, L.A.M. Carnevali, O. Carra, S. Carrier, A. Carroll, B. Casas, C. Casas, J. Cassinelli, G. Castets, P. Castro-Obregon, S. Cavallini, G. Ceccherini, I. Cecconi, F. Cederbaum, A.I. Ceña, V. Cenci, S. Cerella, C. Cervia, D. Cetrullo, S. Chaachouay, H. Chae, H.-J. Chagin, A.S. Chai, C.-Y. Chakrabarti, G. Chamilos, G. Chan, E.Y.W. Chan, M.T.V. Chandra, D. Chandra, P. Chang, C.-P. Chang, R.C.-C. Chang, T.Y. Chatham, J.C. Chatterjee, S. Chauhan, S. Che, Y. Cheetham, M.E. Cheluvappa, R. Chen, C.-J. Chen, G. Chen, G.-C. Chen, G. Chen, H. Chen, J.W. Chen, J.-K. Chen, M. Chen, M. Chen, P. Chen, Q. Chen, Q. Chen, S.-D. Chen, S. Chen, S.S.-L. Chen, W. Chen, W.-J. Chen, W.Q. Chen, W. Chen, X. Chen, Y.-H. Chen, Y.-G. Chen, Y. Chen, Y. Chen, Y. Chen, Y.-J. Chen, Y.-Q. Chen, Y. Chen, Z. Chen, Z. Cheng, A. Cheng, C.H.K. Cheng, H. Cheong, H. Cherry, S. Chesney, J. Cheung, C.H.A. Chevet, E. Chi, H.C. Chi, S.-G. Chiacchiera, F. Chiang, H.-L. Chiarelli, R. Chiariello, M. Chieppa, M. Chin, L.-S. Chiong, M. Chiu, G.N.C. Cho, D.-H. Cho, S.-G. Cho, W.C. Cho, Y.-Y. Cho, Y.-S. Choi, A.M.K. Choi, E.-J. Choi, E.-K. Choi, J. Choi, M.E. Choi, S.-I. Chou, T.-F. Chouaib, S. Choubey, D. Choubey, V. Chow, K.-C. Chowdhury, K. Chu, C.T. Chuang, T.-H. Chun, T. Chung, H. Chung, T. Chung, Y.-L. Chwae, Y.-J. Cianfanelli, V. Ciarcia, R. Ciechomska, I.A. Ciriolo, M.R. Cirone, M. Claerhout, S. Clague, M.J. Clària, J. Clarke, P.G.H. Clarke, R. Clementi, E. Cleyrat, C. Cnop, M. Coccia, E.M. Cocco, T. Codogno, P. Coers, J. Cohen, E.E.W. Colecchia, D. Coletto, L. Coll, N.S. Colucci-Guyon, E. Comincini, S. Condello, M. Cook, K.L. Coombs, G.H. Cooper, C.D. Cooper, J.M. Coppens, I. Corasaniti, M.T. Corazzari, M. Corbalan, R. Corcelle-Termeau, E. Cordero, M.D. Corral-Ramos, C. Corti, O. Cossarizza, A. Costelli, P. Costes, S. Cotman, S.L. Coto-Montes, A. Cottet, S. Couve, E. Covey, L.R. Cowart, L.A. Cox, J.S. Coxon, F.P. Coyne, C.B. Cragg, M.S. Craven, R.J. Crepaldi, T. Crespo, J.L. Criollo, A. Crippa, V. Cruz, M.T. Cuervo, A.M. Cuezva, J.M. Cui, T. Cutillas, P.R. Czaja, M.J. Czyzyk-Krzeska, M.F. Dagda, R.K. Dahmen, U. Dai, C. Dai, W. Dai, Y. Dalby, K.N. Valle, L.D. Dalmasso, G. D'amelio, M. Damme, M. Darfeuille-Michaud, A. Dargemont, C. Darley-Usmar, V.M. Dasarathy, S. Dasgupta, B. Dash, S. Dass, C.R. Davey, H.M. Davids, L.M. Dávila, D. Davis, R.J. Dawson, T.M. Dawson, V.L. Daza, P. de Belleroche, J. de Figueiredo, P. de Figueiredo, R.C.B.Q. de la Fuente, J. De Martino, L. De Matteis, A. De Meyer, G.R.Y. De Milito, A. De Santi, M. de Souza, W. De Tata, V. De Zio, D. Debnath, J. Dechant, R. Decuypere, J.-P. Deegan, S. Dehay, B. Del Bello, B. Del Re, D.P. Delage-Mourroux, R. Delbridge, L.M.D. Deldicque, L. Delorme-Axford, E. Deng, Y. Dengjel, J. Denizot, M. Dent, P. Der, C.J. Deretic, V. Derrien, B. Deutsch, E. Devarenne, T.P. Devenish, R.J. Di Bartolomeo, S. Di Daniele, N. Di Domenico, F. Di Nardo, A. Di Paola, S. Di Pietro, A. Di Renzo, L. Di Antonio, A. Díaz-Araya, G. Díaz-Laviada, I. Diaz-Meco, M.T. Diaz-Nido, J. Dickey, C.A. Dickson, R.C. Diederich, M. Digard, P. Dikic, I. Dinesh-Kumar, S.P. Ding, C. Ding, W.-X. Ding, Z. Dini, L. Distler, J.H.W. Diwan, A. Djavaheri-Mergny, M. Dmytruk, K. Dobson, R.C.J. Doetsch, V. Dokladny, K. Dokudovskaya, S. Donadelli, M. Dong, X.C. Dong, X. Dong, Z. Donohue, T.M., Jr. Donohue-Jr, T.M. Doran, K.S. D'orazi, G. Dorn, G.W., II Dosenko, V. Dridi, S. Drucker, L. Du, J. Du, L.-L. Du, L. du Toit, A. Dua, P. Duan, L. Duann, P. Dubey, V.K. Duchen, M.R. Duchosal, M.A. Duez, H. Dugail, I. Dumit, V.I. Duncan, M.C. Dunlop, E.A. Dunn, W.A., Jr. Dupont, N. Dupuis, L. Durán, R.V. Durcan, T.M. Duvezin-Caubet, S. Duvvuri, U. Eapen, V. Ebrahimi-Fakhari, D. Echard, A. Eckhart, L. Edelstein, C.L. Edinger, A.L. Eichinger, L. Eisenberg, T. Eisenberg-Lerner, A. Eissa, N.T. El-Deiry, W.S. El-Khoury, V. Elazar, Z. Eldar-Finkelman, H. Elliott, C.J.H. Emanuele, E. Emmenegger, U. Engedal, N. Engelbrecht, A.-M. Engelender, S. Enserink, J.M. Erdmann, R. Erenpreisa, J. Eri, R. Eriksen, J.L. Erman, A. Escalante, R. Eskelinen, E.-L. Espert, L. Esteban-Martínez, L. Evans, T.J. Fabri, M. Fabrias, G. Fabrizi, C. Facchiano, A. Færgeman, N.J. Faggioni, A. Fairlie, W.D. Fan, C. Fan, D. Fan, J. Fang, S. Fanto, M. Fanzani, A. Farkas, T. Faure, M. Favier, F.B. Fearnhead, H. Federici, M. Fei, E. Felizardo, T.C. Feng, H. Feng, Y. Feng, Y. Ferguson, T.A. Fernández, Á.F. Fernandez-Barrena, M.G. Fernandez-Checa, J.C. Fernández-López, A. Fernandez-Zapico, M.E. Feron, O. Ferraro, E. Ferreira-Halder, C.V. Fesus, L. Feuer, R. Fiesel, F.C. Filippi-Chiela, E.C. Filomeni, G. Fimia, G.M. Fingert, J.H. Finkbeiner, S. Finkel, T. Fiorito, F. Fisher, P.B. Flajolet, M. Flamigni, F. Florey, O. Florio, S. Floto, R.A. Folini, M. Follo, C. Fon, E.A. Fornai, F. Fortunato, F. Fraldi, A. Franco, R. Francois, A. François, A. Frankel, L.B. Fraser, I.D.C. Frey, N. Freyssenet, D.G. Frezza, C. Friedman, S.L. Frigo, D.E. Fu, D. Fuentes, J.M. Fueyo, J. Fujitani, Y. Fujiwara, Y. Fujiya, M. Fukuda, M. Fulda, S. Fusco, C. Gabryel, B. Gaestel, M. Gailly, P. Gajewska, M. Galadari, S. Galili, G. Galindo, I. Galindo, M.F. Galliciotti, G. Galluzzi, L. Galluzzi, L. Galy, V. Gammoh, N. Gandy, S. Ganesan, A.K. Ganesan, S. Ganley, I.G. Gannagé, M. Gao, F.-B. Gao, F. Gao, J.-X. Nannig, L.G. Véscovi, E.G. Garcia-Macía, M. Garcia-Ruiz, C. Garg, A.D. Garg, P.K. Gargini, R. Gassen, N.C. Gatica, D. Gatti, E. Gavard, J. Gavathiotis, E. Ge, L. Ge, P. Ge, S. Gean, P.-W. Gelmetti, V. Genazzani, A.A. Geng, J. Genschik, P. Gerner, L. Gestwicki, J.E. Gewirtz, D.A. Ghavami, S. Ghigo, E. Ghosh, D. Giammarioli, A.M. Giampieri, F. Giampietri, C. Giatromanolaki, A. Gibbings, D.J. Gibellini, L. Gibson, S.B. Ginet, V. Giordano, A. Giorgini, F. Giovannetti, E. Girardin, S.E. Gispert, S. Giuliano, S. Gladson, C.L. Glavic, A. Gleave, M. Godefroy, N. Gogal, R.M., Jr. Gokulan, K. Goldman, G.H. Goletti, D. Goligorsky, M.S. Gomes, A.V. Gomes, L.C. Gomez, H. Gomez-Manzano, C. Gómez-Sánchez, R. Gonçalves, D.A.P. Goncu, E. Gong, Q. Gongora, C. Gonzalez, C.B. Gonzalez-Alegre, P. Gonzalez-Cabo, P. González-Polo, R.A. Goping, I.S. Gorbea, C. Gorbunov, N.V. Goring, D.R. Gorman, A.M. Gorski, S.M. Goruppi, S. Goto-Yamada, S. Gotor, C. Gottlieb, R.A. Gozes, I. Gozuacik, D. Graba, Y. Graef, M. Granato, G.E. Grant, G.D. Grant, S. Gravina, G.L. Green, D.R. Greenhough, A. Greenwood, M.T. Grimaldi, B. Gros, F. Grose, C. Groulx, J.-F. Gruber, F. Grumati, P. Grune, T. Guan, J.-L. Guan, K.-L. Guerra, B. Guillen, C. Gulshan, K. Gunst, J. Guo, C. Guo, L. Guo, M. Guo, W. Guo, X.-G. Gust, A.A. Gustafsson, Å.B. Gutierrez, E. Gutierrez, M.G. Gwak, H.-S. Haas, A. Haber, J.E. Hadano, S. Hagedorn, M. Hahn, D.R. Halayko, A.J. Hamacher-Brady, A. Hamada, K. Hamai, A. Hamann, A. Hamasaki, M. Hamer, I. Hamid, Q. Hammond, E.M. Han, F. Han, W. Handa, J.T. Hanover, J.A. Hansen, M. Harada, M. Harhaji-Trajkovic, L. Harper, J.W. Harrath, A.H. Harris, A.L. Harris, J. Hasler, U. Hasselblatt, P. Hasui, K. Hawley, R.G. Hawley, T.S. He, C. He, C.Y. He, F. He, G. He, R.-R. He, X.-H. He, Y.-W. He, Y.-Y. Heath, J.K. Hébert, M.-J. Heinzen, R.A. Helgason, G.V. Hensel, M. Henske, E.P. Her, C. Herman, P.K. Hernández, A. Hernandez, C. Hernández-Tiedra, S. Hetz, C. Hiesinger, P.R. Higaki, K. Hilfiker, S. Hill, B.G. Hill, J.A. Hill, W.D. Hino, K. Hofius, D. Hofman, P. Höglinger, G.U. Höhfeld, J. Holz, M.K. Hong, Y. Hood, D.A. Hoozemans, J.J.M. Hoppe, T. Hsu, C. Hsu, C.-Y. Hsu, L.-C. Hu, D. Hu, G. Hu, H.-M. Hu, H. Hu, M.C. Hu, Y.-C. Hu, Z.-W. Hua, F. Hua, Y. Huang, C. Huang, H.-L. Huang, K.-H. Huang, K.-Y. Huang, S. Huang, S. Huang, W.-P. Huang, Y.-R. Huang, Y. Huang, Y. Huber, T.B. Huebbe, P. Huh, W.-K. Hulmi, J.J. Hur, G.M. Hurley, J.H. Husak, Z. Hussain, S.N.A. Hussain, S. Hwang, J.J. Hwang, S. Hwang, T.I.S. Ichihara, A. Imai, Y. Imbriano, C. Inomata, M. Into, T. Iovane, V. Iovanna, J.L. Iozzo, R.V. Ip, N.Y. Irazoqui, J.E. Iribarren, P. Isaka, Y. Isakovic, A.J. Ischiropoulos, H. Isenberg, J.S. Ishaq, M. Ishida, H. Ishii, I. Ishmael, J.E. Isidoro, C. Isobe, K.-I. Isono, E. Issazadeh-Navikas, S. Itahana, K. Itakura, E. Ivanov, A.I. Iyer, A.K.V. Izquierdo, J.M. Izumi, Y. Izzo, V. Jäättelä, M. Jaber, N. Jackson, D.J. Jackson, W.T. Jacob, T.G. Jacques, T.S. Jagannath, C. Jain, A. Jana, N.R. Jang, B.K. Jani, A. Janji, B. Jannig, P.R. Jansson, P.J. Jean, S. Jendrach, M. Jeon, J.-H. Jessen, N. Jeung, E.-B. Jia, K. Jia, L. Jiang, H. Jiang, H. Jiang, L. Jiang, T. Jiang, X. Jiang, X. Jiang, Y. Jiang, Y. Jiménez, A. Jin, C. Jin, H. Jin, L. Jin, M. Jin, S. Jinwal, U.K. Jo, E.-K. Johansen, T. Johnson, D.E. Johnson, G.V.W. Johnson, J.D. Jonasch, E. Jones, C. Joosten, L.A.B. Jordan, J. Joseph, A.-M. Joseph, B. Joubert, A.M. Ju, D. Ju, J. Juan, H.-F. Juenemann, K. Juhász, G. Jung, H.S. Jung, J.U. Jung, Y.-K. Jungbluth, H. Justice, M.J. Jutten, B. Kaakoush, N.O. Kaarniranta, K. Kaasik, A. Kabuta, T. Kaeffer, B. Kågedal, K. Kahana, A. Kajimura, S. Kakhlon, O. Kalia, M. Kalvakolanu, D.V. Kamada, Y. Kambas, K. Kaminskyy, V.O. Kampinga, H.H. Kandouz, M. Kang, C. Kang, R. Kang, T.-C. Kanki, T. Kanneganti, T.-D. Kanno, H. Kanthasamy, A.G. Kantorow, M. Kaparakis-Liaskos, M. Kapuy, O. Karantza, V. Karim, M.R. Karmakar, P. Kaser, A. Kaushik, S. Kawula, T. Kaynar, A.M. Ke, P.-Y. Ke, Z.-J. Kehrl, J.H. Keller, K.E. Kemper, J.K. Kenworthy, A.K. Kepp, O. Kern, A. Kesari, S. Kessel, D. Ketteler, R. Kettelhut, I.C. Khambu, B. Khan, M.M. Khandelwal, V.K.M. Khare, S. Kiang, J.G. Kiger, A.A. Kihara, A. Kim, A.L. Kim, C.H. Kim, D.R. Kim, D.-H. Kim, E.K. Kim, H.Y. Kim, H.-R. Kim, J.-S. Kim, J.H. Kim, J.C. Kim, J.H. Kim, K.W. Kim, M.D. Kim, M.-M. Kim, P.K. Kim, S.W. Kim, S.-Y. Kim, Y.-S. Kim, Y. Kimchi, A. Kimmelman, A.C. Kimura, T. King, J.S. Kirkegaard, K. Kirkin, V. Kirshenbaum, L.A. Kishi, S. Kitajima, Y. Kitamoto, K. Kitaoka, Y. Kitazato, K. Kley, R.A. Klimecki, W.T. Klinkenberg, M. Klucken, J. Knævelsrud, H. Knecht, E. Knuppertz, L. Ko, J.-L. Kobayashi, S. Koch, J.C. Koechlin-Ramonatxo, C. Koenig, U. Koh, Y.H. Köhler, K. Kohlwein, S.D. Koike, M. Komatsu, M. Kominami, E. Kong, D. Kong, H.J. Konstantakou, E.G. Kopp, B.T. Korcsmaros, T. Korhonen, L. Korolchuk, V.I. Koshkina, N.V. Kou, Y. Koukourakis, M.I. Koumenis, C. Kovács, A.L. Kovács, T. Kovacs, W.J. Koya, D. Kraft, C. Krainc, D. Kramer, H. Kravic-Stevovic, T. Krek, W. Kretz-Remy, C. Krick, R. Krishnamurthy, M. Kriston-Vizi, J. Kroemer, G. Kruer, M.C. Kruger, R. Ktistakis, N.T. Kuchitsu, K. Kuhn, C. Kumar, A.P. Kumar, A. Kumar, A. Kumar, D. Kumar, D. Kumar, R. Kumar, S. Kundu, M. Kung, H.-J. Kuno, A. Kuo, S.-H. Kuret, J. Kurz, T. Kwok, T. Kwon, T.K. Kwon, Y.T. Kyrmizi, I. La Spada, A.R. Lafont, F. Lahm, T. Lakkaraju, A. Lam, T. Lamark, T. Lancel, S. Landowski, T.H. Lane, D.J.R. Lane, J.D. Lanzi, C. Lapaquette, P. Lapierre, L.R. Laporte, J. Laukkarinen, J. Laurie, G.W. Lavandero, S. Lavie, L. Lavoie, M.J. Law, B.Y.K. Law, H.K.-W. Law, K.B. Layfield, R. Lazo, P.A. Le Cam, L. Le Roch, K.G. Le Stunff, H. Leardkamolkarn, V. Lecuit, M. Lee, B.-H. Lee, C.-H. Lee, E.F. Lee, G.M. Lee, H.-J. Lee, H. Lee, J.K. Lee, J. Lee, J.-H. Lee, J.H. Lee, M. Lee, M.-S. Lee, P.J. Lee, S.W. Lee, S.-J. Lee, S.-J. Lee, S.Y. Lee, S.H. Lee, S.S. Lee, S.-J. Lee, S. Lee, Y.-R. Lee, Y.J. Lee, Y.H. Leeuwenburgh, C. Lefort, S. Legouis, R. Lei, J. Lei, Q.-Y. Leib, D.A. Leibowitz, G. Lekli, I. Lemaire, S.D. Lemasters, J.J. Lemberg, M.K. Lemoine, A. Leng, S. Lenz, G. Lenzi, P. Lerman, L.O. Barbato, D.L. Leu, J.I.J. Leung, H.Y. Levine, B. Lewis, P.A. Lezoualch, F. Li, C. Li, F. Li, F.-J. Li, J. Li, K. Li, L. Li, M. Li, Q. Li, R. Li, S. Li, W. Li, X. Li, Y. Lian, J. Liang, C. Liang, Q. Liao, Y. Liberal, J. Liberski, P.P. Lie, P. Lieberman, A.P. Lim, H.J. Lim, K.-L. Lim, K. Lima, R.T. Lin, C.-S. Lin, C.-F. Lin, F. Lin, F. Lin, F.-C. Lin, K. Lin, K.-H. Lin, P.-H. Lin, T. Lin, W.-W. Lin, Y.-S. Lin, Y. Linden, R. Lindholm, D. Lindqvist, L.M. Lingor, P. Linkermann, A. Liotta, L.A. Lipinski, M.M. Lira, V.A. Lisanti, M.P. Liton, P.B. Liu, B. Liu, C. Liu, C.-F. Liu, F. Liu, H.-J. Liu, J. Liu, J.-J. Liu, J.-L. Liu, K. Liu, L. Liu, L. Liu, Q. Liu, R.-Y. Liu, S. Liu, S. Liu, W. Liu, X.-D. Liu, X. Liu, X.-H. Liu, X. Liu, X. Liu, X. Liu, Y. Liu, Y. Liu, Z. Liu, Z. Liuzzi, J.P. Lizard, G. Ljujic, M. Lodhi, I.J. Logue, S.E. Lokeshwar, B.L. Long, Y.C. Lonial, S. Loos, B. López-Otín, C. López-Vicario, C. Lorente, M. Lorenzi, P.L. Lõrincz, P. Los, M. Lotze, M.T. Lovat, P.E. Lu, B. Lu, B. Lu, J. Lu, Q. Lu, S.-M. Lu, S. Lu, Y. Luciano, F. Luckhart, S. Lucocq, J.M. Ludovico, P. Lugea, A. Lukacs, N.W. Lum, J.J. Lund, A.H. Luo, H. Luo, J. Luo, S. Luparello, C. Lyons, T. Ma, J. Ma, Y. Ma, Y. Ma, Z. Machado, J. Machado-Santelli, G.M. Macian, F. MacIntosh, G.C. MacKeigan, J.P. Macleod, K.F. MacMicking, J.D. MacMillan-Crow, L.A. Madeo, F. Madesh, M. Madrigal-Matute, J. Maeda, A. Maeda, T. Maegawa, G. Maellaro, E. Maes, H. Magariños, M. Maiese, K. Maiti, T.K. Maiuri, L. Maiuri, M.C. Maki, C.G. Malli, R. Malorni, W. Maloyan, A. Mami-Chouaib, F. Man, N. Mancias, J.D. Mandelkow, E.-M. Mandell, M.A. Manfredi, A.A. Manié, S.N. Manzoni, C. Mao, K. Mao, Z. Mao, Z.-W. Marambaud, P. Marconi, A.M. Marelja, Z. Marfe, G. Margeta, M. Margittai, E. Mari, M. Mariani, F.V. Marin, C. Marinelli, S. Mariño, G. Markovic, I. Marquez, R. Martelli, A.M. Martens, S. Martin, K.R. Martin, S.J. Martin, S. Martin-Acebes, M.A. Martín-Sanz, P. Martinand-Mari, C. Martinet, W. Martinez, J. Martinez-Lopez, N. Martinez-Outschoorn, U. Martínez-Velázquez, M. Martinez-Vicente, M. Martins, W.K. Mashima, H. Mastrianni, J.A. Matarese, G. Matarrese, P. Mateo, R. Matoba, S. Matsumoto, N. Matsushita, T. Matsuura, A. Matsuzawa, T. Mattson, M.P. Matus, S. Maugeri, N. Mauvezin, C. Mayer, A. Maysinger, D. Mazzolini, G.D. McBrayer, M.K. McCall, K. McCormick, C. McInerney, G.M. McIver, S.C. McKenna, S. McMahon, J.J. McNeish, I.A. Mechta-Grigoriou, F. Medema, J.P. Medina, D.L. Megyeri, K. Mehrpour, M. Mehta, J.L. Mei, Y. Meier, U.-C. Meijer, A.J. Meléndez, A. Melino, G. Melino, S. de Melo, E.J.T. Mena, M.A. Meneghini, M.D. Menendez, J.A. Menezes, R. Meng, L. Meng, L.-H. Meng, S. Menghini, R. Menko, A.S. Menna-Barreto, R.F.S. Menon, M.B. Meraz-Ríos, M.A. Merla, G. Merlini, L. Merlot, A.M. Meryk, A. Meschini, S. Meyer, J.N. Mi, M.-T. Miao, C.-Y. Micale, L. Michaeli, S. Michiels, C. Migliaccio, A.R. Mihailidou, A.S. Mijaljica, D. Mikoshiba, K. Milan, E. Miller-Fleming, L. Mills, G.B. Mills, I.G. Minakaki, G. Minassian, B.A. Ming, X.-F. Minibayeva, F. Minina, E.A. Mintern, J.D. Minucci, S. Miranda-Vizuete, A. Mitchell, C.H. Miyamoto, S. Miyazawa, K. Mizushima, N. Mnich, K. Mograbi, B. Mohseni, S. Moita, L.F. Molinari, M. Molinari, M. Møller, A.B. Mollereau, B. Mollinedo, F. Mongillo, M. Monick, M.M. Montagnaro, S. Montell, C. Moore, D.J. Moore, M.N. Mora-Rodriguez, R. Moreira, P.I. Morel, E. Morelli, M.B. Moreno, S. Morgan, M.J. Moris, A. Moriyasu, Y. Morrison, J.L. Morrison, L.A. Morselli, E. Moscat, J. Moseley, P.L. Mostowy, S. Motori, E. Mottet, D. Mottram, J.C. Moussa, C.E.-H. Mpakou, V.E. Mukhtar, H. Levy, J.M.M. Muller, S. Muñoz-Moreno, R. Muñoz-Pinedo, C. Münz, C. Murphy, M.E. Murray, J.T. Murthy, A. Mysorekar, I.U. Nabi, I.R. Nabissi, M. Nader, G.A. Nagahara, Y. Nagai, Y. Nagata, K. Nagelkerke, A. Nagy, P. Naidu, S.R. Nair, S. Nakano, H. Nakatogawa, H. Nanjundan, M. Napolitano, G. Naqvi, N.I. Nardacci, R. Narendra, D.P. Narita, M. Nascimbeni, A.C. Natarajan, R. Navegantes, L.C. Nawrocki, S.T. Nazarko, T.Y. Nazarko, V.Y. Neill, T. Neri, L.M. Netea, M.G. Netea-Maier, R.T. Neves, B.M. Ney, P.A. Nezis, I.P. Nguyen, H.T.T. Nguyen, H.P. Nicot, A.-S. Nilsen, H. Nilsson, P. Nishimura, M. Nishino, I. Niso-Santano, M. Niu, H. Nixon, R.A. Njar, V.C.O. Noda, T. Noegel, A.A. Nolte, E.M. Norberg, E. Norga, K.K. Noureini, S.K. Notomi, S. Notterpek, L. Nowikovsky, K. Nukina, N. Nürnberger, T. O'donnell, V.B. O'donovan, T. O'dwyer, P.J. Oehme, I. Oeste, C.L. Ogawa, M. Ogretmen, B. Ogura, Y. Oh, Y.J. Ohmuraya, M. Ohshima, T. Ojha, R. Okamoto, K. Okazaki, T. Oliver, F.J. Ollinger, K. Olsson, S. Orban, D.P. Ordonez, P. Orhon, I. Orosz, L. O'rourke, E.J. Orozco, H. Ortega, A.L. Ortona, E. Osellame, L.D. Oshima, J. Oshima, S. Osiewacz, H.D. Otomo, T. Otsu, K. Ou, J.-H.J. Outeiro, T.F. Ouyang, D.-Y. Ouyang, H. Overholtzer, M. Ozbun, M.A. Ozdinler, P.H. Ozpolat, B. Pacelli, C. Paganetti, P. Page, G. Pages, G. Pagnini, U. Pajak, B. Pak, S.C. Pakos-Zebrucka, K. Pakpour, N. Palková, Z. Palladino, F. Pallauf, K. Pallet, N. Palmieri, M. Paludan, S.R. Palumbo, C. Palumbo, S. Pampliega, O. Pan, H. Pan, W. Panaretakis, T. Pandey, A. Pantazopoulou, A. Papackova, Z. Papademetrio, D.L. Papassideri, I. Papini, A. Parajuli, N. Pardo, J. Parekh, V.V. Parenti, G. Park, J.-I. Park, J. Park, O.K. Parker, R. Parlato, R. Parys, J.B. Parzych, K.R. Pasquet, J.-M. Pasquier, B. Pasumarthi, K.B.S. Patterson, C. Pattingre, S. Pattison, S. Pause, A. Pavenstädt, H. Pavone, F. Pedrozo, Z. Peña, F.J. Peñalva, M.A. Pende, M. Peng, J. Penna, F. Penninger, J.M. Pensalfini, A. Pepe, S. Pereira, G.J.S. Pereira, P.C. de la Cruz, V.P. Pérez-Pérez, M.E. Pérez-Rodríguez, D. Pérez-Sala, D. Perier, C. Perl, A. Perlmutter, D.H. Perrotta, I. Pervaiz, S. Pesonen, M. Pessin, J.E. Peters, G.J. Petersen, M. Petrache, I. Petrof, B.J. Petrovski, G. Phang, J.M. Piacentini, M. Pierdominici, M. Pierre, P. Pierrefite-Carle, V. Pietrocola, F. Pimentel-Muiños, F.X. Pinar, M. Pineda, B. Pinkas-Kramarski, R. Pinti, M. Pinton, P. Piperdi, B. Piret, J.M. Platanias, L.C. Platta, H.W. Plowey, E.D. Pöggeler, S. Poirot, M. Polčic, P. Poletti, A. Poon, A.H. Popelka, H. Popova, B. Poprawa, I. Poulose, S.M. Poulton, J. Powers, S.K. Powers, T. Pozuelo-Rubio, M. Prak, K. Prange, R. Prescott, M. Priault, M. Prince, S. Proia, R.L. Proikas-Cezanne, T. Prokisch, H. Promponas, V.J. Przyklenk, K. Puertollano, R. Pugazhenthi, S. Puglielli, L. Pujol, A. Puyal, J. Pyeon, D. Qi, X. Qian, W.-B. Qin, Z.-H. Qiu, Y. Qu, Z. Quadrilatero, J. Quinn, F. Raben, N. Rabinowich, H. Radogna, F. Ragusa, M.J. Rahmani, M. Raina, K. Ramanadham, S. Ramesh, R. Rami, A. Randall-Demllo, S. Randow, F. Rao, H. Rao, V.A. Rasmussen, B.B. Rasse, T.M. Ratovitski, E.A. Rautou, P.-E. Ray, S.K. Razani, B. Reed, B.H. Reggiori, F. Rehm, M. Reichert, A.S. Rein, T. Reiner, D.J. Reits, E. Ren, J. Ren, X. Renna, M. Reusch, J.E.B. Revuelta, J.L. Reyes, L. Rezaie, A.R. Richards, R.I. Richardson, R. Richetta, C. Riehle, M.A. Rihn, B.H. Rikihisa, Y. Riley, B.E. Rimbach, G. Rippo, M.R. Ritis, K. Rizzi, F. Rizzo, E. Roach, P.J. Robbins, J. Roberge, M. Roca, G. Roccheri, M.C. Rocha, S. Rodrigues, C.M.P. Rodríguez, C.I. de Cordoba, S.R. Rodriguez-Muela, N. Roelofs, J. Rogov, V.V. Rohn, T.T. Rohrer, B. Romanelli, D. Romani, L. Romano, P.S. Roncero, M.I.G. Rosa, J.L. Rosello, A. Rosen, K.V. Rosenstiel, P. Rost-Roszkowska, M. Roth, K.A. Roué, G. Rouis, M. Rouschop, K.M. Ruan, D.T. Ruano, D. Rubinsztein, D.C. Rucker, E.B., III Rudich, A. Rudolf, E. Rudolf, R. Ruegg, M.A. Ruiz-Roldan, C. Ruparelia, A.A. Rusmini, P. Russ, D.W. Russo, G.L. Russo, G. Russo, R. Rusten, T.E. Ryabovol, V. Ryan, K.M. Ryter, S.W. Sabatini, D.M. Sacher, M. Sachse, C. Sack, M.N. Sadoshima, J. Saftig, P. Sagi-Eisenberg, R. Sahni, S. Saikumar, P. Saito, T. Saitoh, T. Sakakura, K. Sakoh-Nakatogawa, M. Sakuraba, Y. Salazar-Roa, M. Salomoni, P. Saluja, A.K. Salvaterra, P.M. Salvioli, R. Samali, A. Sanchez, A.M.J. Sánchez-Alcázar, J.A. Sanchez-Prieto, R. Sandri, M. Sanjuan, M.A. Santaguida, S. Santambrogio, L. Santoni, G. Dos Santos, C.N. Saran, S. Sardiello, M. Sargent, G. Sarkar, P. Sarkar, S. Sarrias, M.R. Sarwal, M.M. Sasakawa, C. Sasaki, M. Sass, M. Sato, K. Sato, M. Satriano, J. Savaraj, N. Saveljeva, S. Schaefer, L. Schaible, U.E. Scharl, M. Schatzl, H.M. Schekman, R. Scheper, W. Schiavi, A. Schipper, H.M. Schmeisser, H. Schmidt, J. Schmitz, I. Schneider, B.E. Schneider, E.M. Schneider, J.L. Schon, E.A. Schönenberger, M.J. Schönthal, A.H. Schorderet, D.F. Schröder, B. Schuck, S. Schulze, R.J. Schwarten, M. Schwarz, T.L. Sciarretta, S. Scotto, K. Scovassi, A.I. Screaton, R.A. Screen, M. Seca, H. Sedej, S. Segatori, L. Segev, N. Seglen, P.O. Seguí-Simarro, J.M. Segura-Aguilar, J. Seiliez, I. Seki, E. Sell, C. Semenkovich, C.F. Semenza, G.L. Sen, U. Serra, A.L. Serrano-Puebla, A. Sesaki, H. Setoguchi, T. Settembre, C. Shacka, J.J. Shajahan-Haq, A.N. Shapiro, I.M. Sharma, S. She, H. Shen, C.-K.J. Shen, C.-C. Shen, H.-M. Shen, S. Shen, W. Sheng, R. Sheng, X. Sheng, Z.-H. Shepherd, T.G. Shi, J. Shi, Q. Shi, Q. Shi, Y. Shibutani, S. Shibuya, K. Shidoji, Y. Shieh, J.-J. Shih, C.-M. Shimada, Y. Shimizu, S. Shin, D.W. Shinohara, M.L. Shintani, M. Shintani, T. Shioi, T. Shirabe, K. Shiri-Sverdlov, R. Shirihai, O. Shore, G.C. Shu, C.-W. Shukla, D. Sibirny, A.A. Sica, V. Sigurdson, C.J. Sigurdsson, E.M. Sijwali, P.S. Sikorska, B. Silveira, W.A. Silvente-Poirot, S. Silverman, G.A. Simak, J. Simmet, T. Simon, A.K. Simon, H.-U. Simone, C. Simons, M. Simonsen, A. Singh, R. Singh, S.V. Singh, S.K. Sinha, D. Sinha, S. Sinicrope, F.A. Sirko, A. Sirohi, K. Sishi, B.J.N. Sittler, A. Siu, P.M. Sivridis, E. Skwarska, A. Slack, R. Slaninová, I. Slavov, N. Smaili, S.S. Smalley, K.S.M. Smith, D.R. Soenen, S.J. Soleimanpour, S.A. Solhaug, A. Somasundaram, K. Son, J.H. Sonawane, A. Song, C. Song, F. Song, H.K. Song, J.-X. Song, W. Soo, K.Y. Sood, A.K. Soong, T.W. Soontornniyomkij, V. Sorice, M. Sotgia, F. Soto-Pantoja, D.R. Sotthibundhu, A. Sousa, M.J. Spaink, H.P. Span, P.N. Spang, A. Sparks, J.D. Speck, P.G. Spector, S.A. Spies, C.D. Springer, W. Clair, D.S. Stacchiotti, A. Staels, B. Stang, M.T. Starczynowski, D.T. Starokadomskyy, P. Steegborn, C. Steele, J.W. Stefanis, L. Steffan, J. Stellrecht, C.M. Stenmark, H. Stepkowski, T.M. Stern, S.T. Stevens, C. Stockwell, B.R. Stoka, V. Storchova, Z. Stork, B. Stratoulias, V. Stravopodis, D.J. Strnad, P. Strohecker, A.M. Ström, A.-L. Stromhaug, P. Stulik, J. Su, Y.-X. Su, Z. Subauste, C.S. Subramaniam, S. Sue, C.M. Suh, S.W. Sui, X. Sukseree, S. Sulzer, D. Sun, F.-L. Sun, J. Sun, J. Sun, S.-Y. Sun, Y. Sun, Y. Sun, Y. Sundaramoorthy, V. Sung, J. Suzuki, H. Suzuki, K. Suzuki, N. Suzuki, T. Suzuki, Y.J. Swanson, M.S. Swanton, C. Swärd, K. Swarup, G. Sweeney, S.T. Sylvester, P.W. Szatmari, Z. Szegezdi, E. Szlosarek, P.W. Taegtmeyer, H. Tafani, M. Taillebourg, E. Tait, S.W.G. Takacs-Vellai, K. Takahashi, Y. Takáts, S. Takemura, G. Takigawa, N. Talbot, N.J. Tamagno, E. Tamburini, J. Tan, C.-P. Tan, L. Tan, M.L. Tan, M. Tan, Y.-J. Tanaka, K. Tanaka, M. Tang, D. Tang, D. Tang, G. Tanida, I. Tanji, K. Tannous, B.A. Tapia, J.A. Tasset-Cuevas, I. Tatar, M. Tavassoly, I. Tavernarakis, N. Taylor, A. Taylor, G.S. Taylor, G.A. Taylor, J.P. Taylor, M.J. Tchetina, E.V. Tee, A.R. Teixeira-Clerc, F. Telang, S. Tencomnao, T. Teng, B.-B. Teng, R.-J. Terro, F. Tettamanti, G. Theiss, A.L. Theron, A.E. Thomas, K.J. Thomé, M.P. Thomes, P.G. Thorburn, A. Thorner, J. Thum, T. Thumm, M. Thurston, T.L.M. Tian, L. Till, A. Ting, J.P.-Y. Ting, J.P.Y. Titorenko, V.I. Toker, L. Toldo, S. Tooze, S.A. Topisirovic, I. Torgersen, M.L. Torosantucci, L. Torriglia, A. Torrisi, M.R. Tournier, C. Towns, R. Trajkovic, V. Travassos, L.H. Triola, G. Tripathi, D.N. Trisciuoglio, D. Troncoso, R. Trougakos, I.P. Truttmann, A.C. Tsai, K.-J. Tschan, M.P. Tseng, Y.-H. Tsukuba, T. Tsung, A. Tsvetkov, A.S. Tu, S. Tuan, H.-Y. Tucci, M. Tumbarello, D.A. Turk, B. Turk, V. Turner, R.F.B. Tveita, A.A. Tyagi, S.C. Ubukata, M. Uchiyama, Y. Udelnow, A. Ueno, T. Umekawa, M. Umemiya-Shirafuji, R. Underwood, B.R. Ungermann, C. Ureshino, R.P. Ushioda, R. Uversky, V.N. Uzcátegui, N.L. Vaccari, T. Vaccaro, M.I. Váchová, L. Vakifahmetoglu-Norberg, H. Valdor, R. Valente, E.M. Vallette, F. Valverde, A.M. Van den Berghe, G. Van Den Bosch, L. van den Brink, G.R. van der Goot, F.G. van der Klei, I.J. van der Laan, L.J.W. van Doorn, W.G. van Egmond, M. van Golen, K.L. Van Kaer, L. Campagne, M.L. Vandenabeele, P. Vandenberghe, W. Vanhorebeek, I. Varela-Nieto, I. Vasconcelos, M.H. Vasko, R. Vavvas, D.G. Vega-Naredo, I. Velasco, G. Velentzas, A.D. Velentzas, P.D. Vellai, T. Vellenga, E. Vendelbo, M.H. Venkatachalam, K. Ventura, N. Ventura, S. Veras, P.S.T. Verdier, M. Vertessy, B.G. Viale, A. Vidal, M. Vieira, H.L.A. Vierstra, R.D. Vigneswaran, N. Vij, N. Vila, M. Villar, M. Villar, V.H. Villarroya, J. Vindis, C. Viola, G. Viscomi, M.T. Vitale, G. Vogl, D.T. Voitsekhovskaja, O.V. von Haefen, C. von Schwarzenberg, K. Voth, D.E. Vouret-Craviari, V. Vuori, K. Vyas, J.M. Waeber, C. Walker, C.L. Walker, M.J. Walter, J. Wan, L. Wan, X. Wang, B. Wang, C. Wang, C.-Y. Wang, C. Wang, C. Wang, C. Wang, D. Wang, F. Wang, F. Wang, G. Wang, H.-J. Wang, H. Wang, H.-G. Wang, H. Wang, H.-D. Wang, J. Wang, J. Wang, M. Wang, M.-Q. Wang, P.-Y. Wang, P. Wang, R.C. Wang, S. Wang, T.-F. Wang, X. Wang, X.-J. Wang, X.-W. Wang, X. Wang, X. Wang, Y. Wang, Y. Wang, Y. Wang, Y.-J. Wang, Y. Wang, Y. Wang, Y.T. Wang, Y. Wang, Z.-N. Wappner, P. Ward, C. Ward, D.M.V. Warnes, G. Watada, H. Watanabe, Y. Watase, K. Weaver, T.E. Weekes, C.D. Wei, J. Weide, T. Weihl, C.C. Weindl, G. Weis, S.N. Wen, L. Wen, X. Wen, Y. Westermann, B. Weyand, C.M. White, A.R. White, E. Whitton, J.L. Whitworth, A.J. Wiels, J. Wild, F. Wildenberg, M.E. Wileman, T. Wilkinson, D.S. Wilkinson, S. Willbold, D. Williams, C. Williams, K. Williamson, P.R. Winklhofer, K.F. Witkin, S.S. Wohlgemuth, S.E. Wollert, T. Wolvetang, E.J. Wong, E. Wong, G.W. Wong, R.W. Wong, V.K.W. Woodcock, E.A. Wright, K.L. Wu, C. Wu, D. Wu, G.S. Wu, J. Wu, J. Wu, M. Wu, M. Wu, S. Wu, W.K.K. Wu, Y. Wu, Z. Xavier, C.P.R. Xavier, R.J. Xia, G.-X. Xia, T. Xia, W. Xia, Y. Xiao, H. Xiao, J. Xiao, S. Xiao, W. Xie, C.-M. Xie, Z. Xie, Z. Xilouri, M. Xiong, Y. Xu, C. Xu, C. Xu, F. Xu, H. Xu, H. Xu, J. Xu, J. Xu, J. Xu, L. Xu, X. Xu, Y. Xu, Y. Xu, Z.-X. Xu, Z. Xue, Y. Yamada, T. Yamamoto, A. Yamanaka, K. Yamashina, S. Yamashiro, S. Yan, B. Yan, B. Yan, X. Yan, Z. Yanagi, Y. Yang, D.-S. Yang, J.-M. Yang, L. Yang, M. Yang, P.-M. Yang, P. Yang, Q. Yang, W. Yang, W.Y. Yang, X. Yang, Y. Yang, Y. Yang, Z. Yang, Z. Yao, M.-C. Yao, P.J. Yao, X. Yao, Z. Yao, Z. Yasui, L.S. Ye, M. Yedvobnick, B. Yeganeh, B. Yeh, E.S. Yeyati, P.L. Yi, F. Yi, L. Yin, X.-M. Yip, C.K. Yoo, Y.-M. Yoo, Y.H. Yoon, S.-Y. Yoshida, K.-I. Yoshimori, T. Young, K.H. Yu, H. Yu, J.J. Yu, J.-T. Yu, J. Yu, L. Yu, W.H. Yu, X.-F. Yu, Z. Yuan, J. Yuan, Z.-M. Yue, B.Y.J.T. Yue, J. Yue, Z. Zacks, D.N. Zacksenhaus, E. Zaffaroni, N. Zaglia, T. Zakeri, Z. Zecchini, V. Zeng, J. Zeng, M. Zeng, Q. Zervos, A.S. Zhang, D.D. Zhang, F. Zhang, G. Zhang, G.-C. Zhang, H. Zhang, H. Zhang, H. Zhang, J. Zhang, J. Zhang, J. Zhang, J.-P. Zhang, L. Zhang, L. Zhang, L. Zhang, M.-Y. Zhang, X. Zhang, X.D. Zhang, Y. Zhang, Y. Zhang, Y. Zhang, Y. Zhang, Y. Zhao, M. Zhao, W.-L. Zhao, X. Zhao, Y.G. Zhao, Y. Zhao, Y. Zhao, Y.-X. Zhao, Z. Zhao, Z.J. Zheng, D. Zheng, X.-L. Zheng, X. Zhivotovsky, B. Zhong, Q. Zhou, G.-Z. Zhou, G. Zhou, H. Zhou, S.-F. Zhou, X.-J. Zhu, H. Zhu, H. Zhu, W.-G. Zhu, W. Zhu, X.-F. Zhu, Y. Zhuang, S.-M. Zhuang, X. Ziparo, E. Zois, C.E. Zoladek, T. Zong, W.-X. Zorzano, A. Zughaier, S.M.

Published
2016

40. Modelling generation mechanism of defects during permanent mould centrifugal casting process of TiAl alloy exhaust valve

Author

S. P. Wu, Y.Q. Su, W. Sheng, Jingjie Guo, and Hengzhi Fu

Subjects
Materials science, Computer simulation, Mechanical Engineering, Flow (psychology), Alloy, Metallurgy, Rotational speed, Mechanics, engineering.material, Condensed Matter::Mesoscopic Systems and Quantum Hall Effect, Condensed Matter Physics, Volume (thermodynamics), Mechanics of Materials, Free surface, Centrifugal casting (silversmithing), engineering, Condensed Matter::Strongly Correlated Electrons, General Materials Science, Porosity
Abstract

In this paper, the TiAl liquid filling process during vertical centrifugal casting into a permanent mould has been described analytically. A model has been established to simulate the forward filling and backward filling process, and two parameters were used to provide a quantitative description of the defect generation that is associated with the forward filling of the mould cavity. One of the parameters used was the forward filling cross-sectional area, and the other was the inclined angle of the free surface of forward filling flow. The cross-sectional area decreases, and the inclined angle increases when the rotational speed increases, the tendency of which becomes more obvious near the mould cavity entrance. The residual volume of the mould cavity after the forward filling is related to the volume of trapped pores. The filling process has also been investigated using numerical simulation. Based on the filling and solidification characteristic of a TiAl valve, the off-centre porosity distribut...

Published
2011
Full Text
View/download PDF

42. Enhanced antitumor activity by combining an adenovirus harboring ING4 with cisplatin for hepatocarcinoma cells

Author

Yufeng Xie, Jingcheng Miao, W Sheng, Jicheng Yang, and Jim Xiang

Subjects
Cancer Research, Carcinoma, Hepatocellular, Genetic Vectors, Mice, Nude, cisplatin, Antigens, CD34, Antineoplastic Agents, Apoptosis, Cell Cycle Proteins, Biology, Adenoviridae, Cell Line, ING4, Mice, chemistry.chemical_compound, Downregulation and upregulation, In vivo, Cell Line, Tumor, medicine, Animals, Humans, Molecular Biology, Cell Proliferation, Homeodomain Proteins, Cisplatin, Neovascularization, Pathologic, Cell growth, Tumor Suppressor Proteins, Genetic Therapy, Hep G2 Cells, enhanced antitumor activity, Xenograft Model Antitumor Assays, Molecular biology, In vitro, Gene Expression Regulation, Neoplastic, HEK293 Cells, chemistry, hepatocarcinoma, Cell culture, adenoviral vector, Molecular Medicine, Female, Original Article, Growth inhibition, Signal Transduction, medicine.drug
Abstract

The inhibitor of growth (ING) family proteins have been defined as candidate tumor suppressors. ING4 as a novel member of the ING family has potential tumor-suppressive effects. In this study, we explored the combined effect of adenovirus-mediated ING4 (Ad-ING4) gene transfer plus chemotherapy drug cisplatin (CDDP) on SMMC-7721 human hepatocarcinoma cells in vitro and in vivo, and its underlying mechanism. We demonstrated that Ad-ING4 plus CDDP induced synergistic growth inhibition, enhanced apoptosis, and had an additive effect on upregulation of Fas, Bax, Bak, cleaved Bid, cleaved caspase-8, caspase-9, caspase-3 and cleaved PARP, and on downregulation of Bcl-2 and Bcl-X(L) in SMMC-7721 hepatocarcinoma cells. Moreover, Ad-ING4 plus CDDP synergistically suppressed in vivo SMMC-7721 hepatocarcinoma subcutaneous (s.c.) xenografted tumor growth and reduced tumor vessel CD34 expression and microvessel density (MVD) in athymic nude mice. Most importantly, Ad-ING4 plus CDDP did not have overlapping toxicities in HL-7702 normal human liver cells and normal liver tissues of mice. The in vitro and in vivo enhanced antitumor effect elicited by Ad-ING4 plus CDDP was closely associated with the cooperative regulation of extrinsic and intrinsic apoptotic pathways and synergistic inhibition of tumor angiogenesis. Thus, our results indicate that Ad-ING4 plus CDDP is a potential combined treatment strategy for hepatocarcinoma.

Published
2010
Full Text
View/download PDF

43. Diffusion in Multi-Compositional PZ-PT-PZN Ceramics Prepared by Spark Plasma Sintering

Author

Y.J. Wu, Kazuyuki Kakegawa, J. Cai, J. W. Sheng, and J. Li

Subjects
Materials science, Chemical engineering, law, visual_art, Diffusion, visual_art.visual_art_medium, Spark plasma sintering, Calcination, Ceramic, Condensed Matter Physics, Electronic, Optical and Magnetic Materials, law.invention, Pyroelectricity
Abstract

Diffusion in multi-compositional 0.9PbZrO3−xPbTiO3-(0.1–x)Pb(Zn1/3Nb2/3)O3 (PZ-PT-PZN) ceramics prepared by spark plasma sintering was investigated through measuring the pyroelectric properties. The strong dependence of pyroelectric properties on composition x provides a useful method to investigate the diffusion between the different compositions. In addition to the post heat-treatment, the calcination conditions and the existence of Ti4 + were found to play very important roles on the diffusion. The diffusion decreases with increasing calcination temperature, while the presence of Ti4 + significantly increases the diffusion between the different compositions.

Published
2009
Full Text
View/download PDF

44. Microwave-assisted aqueous synthesis of ultralong ZnO nanowires: photoluminescence and photovoltaic performance for dye-sensitized solar cell

Author

Chunying Min, Xiaoping Shen, and W. Sheng

Subjects
Photoluminescence, Nanostructure, Chemistry, business.industry, Scanning electron microscope, Nanowire, Analytical chemistry, General Chemistry, law.invention, Dye-sensitized solar cell, law, Transmission electron microscopy, Solar cell, Optoelectronics, General Materials Science, High-resolution transmission electron microscopy, business
Abstract

Ultralong ZnO nanowires were successfully prepared on a large scale by a microwave-assisted aqueous route without using any surfactant or template at relatively low temperature of 120°C. The obtained nanowires were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM), and energy-dispersive X-ray spectrum (EDX). The growth mechanism and photoluminescence of the one-dimensional nanostructure, and photovoltaic performances for dye-sensitized solar cell (DSSC) of the nanowires were discussed in detail.

Published
2009
Full Text
View/download PDF

45. Interaction of linear waves with an array of infinitely long horizontal circular cylinders in a two-layer fluid of infinite depth

Author

B. Feng, Y.H. Zheng, Bj J. Wu, Yg G. You, and Sw W. Sheng

Subjects
Physics, Diffraction, Environmental Engineering, Ocean Engineering, Geometry, Mechanics, Cylinder (engine), law.invention, Physics::Fluid Dynamics, Scattering amplitude, law, Fluid–structure interaction, Reflection (physics), Boundary value problem, Multipole expansion, Boundary element method
Abstract

The linear water wave scattering and radiation by an array of infinitely long horizontal circular cylinders in a two-layer fluid of infinite depth is investigated by use of the multipole expansion method. The diffracted and radiated potentials are expressed as a linear combination of infinite multipoles placed at the centre of each cylinder with unknown coefficients to be determined by the cylinder boundary conditions. Analytical expressions for wave forces, hydrodynamic coefficients, reflection and transmission coefficients and energies are derived. Comparisons are made between the present analytical results and those obtained by the boundary element method, and some examples are presented to illustrate the hydrodynamic behavior of multiple horizontal circular cylinders in a two-layer fluid. It is found that for two submerged circular cylinders the influence of the fluid density ratio on internal-mode wave forces is more appreciable than surface-mode wave forces, and the periodic oscillations of hydrodynamic results occur with the increase of the distance between two cylinders; for four submerged circular cylinders the influence of adding two cylinders on the wave forces of the former cylinders is small in low and high wave frequencies, but the influence is appreciable in intermediate wave frequencies.

Published
2008
Full Text
View/download PDF

46. Inhibition of the rapid component of the delayed rectifier potassium current in ventricular myocytes by angiotensin II via the AT1receptor

Author

Yanfang Xu, Y H Wang, Fang Dong, Chen-Xia Shi, and J W Sheng

Subjects
Pharmacology, medicine.medical_specialty, Angiotensin II receptor type 1, biology, Chemistry, hERG, Angiotensin II, Losartan, Endocrinology, Internal medicine, Renin–angiotensin system, cardiovascular system, medicine, biology.protein, Myocyte, Repolarization, Patch clamp, hormones, hormone substitutes, and hormone antagonists, medicine.drug
Abstract

Background and purpose: There is increasing evidence that angiotensin II (Ang II) is associated with the occurrence of ventricular arrhythmias. However, little is known about the electrophysiological effects of Ang II on ventricular repolarization. The rapid component of the delayed rectifier K+ current (IKr) plays a critical role in cardiac repolarization. Hence, the aim of this study was to assess the effect of Ang II on IKr in guinea-pig ventricular myocytes. Experimental approach: The whole-cell patch-clamp technique was used to record IKr in native cardiocytes and in human embryonic kidney (HEK) 293 cells, co-transfected with human ether-a-go-go-related gene (hERG) encoding the α-subunit of IKr and the human Ang II type 1 (AT1) receptor gene. Key results: Ang II decreased the amplitude of IKr in a concentration-dependent manner with an IC50 of 8.9 nM. Action potential durations at 50% (APD50) and 90% (APD90) repolarization were prolonged 20% and 16%, respectively by Ang II (100 nM). Ang II-induced inhibition of the IKr was abolished by the AT1 receptor blocker, losartan (1 μM). Ang II decreased hERG current in HEK293 cells and significantly delayed channel activation, deactivation and recovery from inactivation. Moreover, PKC inhibitors, stausporine and Bis-1, significantly attenuated Ang II-induced inhibition of IKr. Conclusions and implications: Ang II produces an inhibitory effect on IKr/hERG currents via AT1 receptors linked to the PKC pathway in ventricular myocytes. This is a potential mechanism by which elevated levels of Ang II are involved in the occurrence of arrhythmias in cardiac hypertrophy and failure.

Published
2008
Full Text
View/download PDF

47. Building semiconductor nanostructures atom by atom

Author

Pawel Hawrylak, W. Sheng, Marek Korkusinski, Michał Zieliński, and Gerhard Klimeck

Subjects
Condensed Matter::Materials Science, Materials science, Tight binding, Condensed matter physics, Atomic orbital, General Engineering, Molecular orbital diagram, Molecular orbital theory, Molecular orbital, Electron configuration, Electronic structure, Antibonding molecular orbital
Abstract

We present an atomistic tight-binding approach to calculating the electronic structure of semiconductor nanostructures. We start by deriving the strain distribution in the structure using the valence force field model. The strain field is incorporated into the tight-binding electronic structure calculation carried out in the frame of the effective bond orbital model and the fully atomistic Sp(3)d(5)s* approach. We apply the method to a vertically coupled self-assembled double-dot molecule. Using the effective mass approach, we establish the existence of electronic bonding and antibonding molecular orbitals for electrons and holes, whose probability density is shared equally between the dots. In the atomistic calculation we recover the molecular character of electron orbitals, but find that structural and atomistic details of the sample modify the hole orbitals, leading to a strongly asymmetric distribution of the probability density between the dots.

Published
2008
Full Text
View/download PDF

48. Microstructure and high-temperature wear behavior of laser clad Ni–Ti–Si ternary metal silicide coatings

Author

W. Sheng, Dong Liu, and Huaming Wang

Subjects
Materials science, Abrasive, Delamination, Metallurgy, Surfaces and Interfaces, General Chemistry, Tribology, engineering.material, Condensed Matter Physics, Microstructure, Surfaces, Coatings and Films, Coating, Plating, Materials Chemistry, engineering, Ternary operation, Solid solution
Abstract

Ni–Ti–Si ternary metal silicide coatings were fabricated on AISI 304 stainless steel by laser cladding process. The coatings consisted of Ni 16 Ti 6 Si 7 primary dendrite and interdendritic Fe–Ni–based solid solution γ and exhibited excellent abrasive and adhesive wear resistance under high temperature metallic dry sliding wear conditions. The excellent wear properties were attributed to the high hardness and covalent dominant atomic bond of the metal silicide Ni 16 Ti 6 Si 7 . The dominant wear mechanism of the coating were delamination of the coating and material transfer from the mating surface.

Published
2008
Full Text
View/download PDF

49. Genotoxic Potential of Regenerated Silk Fibroin Films by Different Cross-Linking Mode

Author

Ai Hua Gong, Mingzhong Li, W Sheng, Yufeng Xie, Jing Cheng Miao, and Ji Cheng Yang

Subjects
Gel electrophoresis, Comet assay, Materials science, Tissue engineering, Mechanics of Materials, Mechanical Engineering, fungi, Polymer chemistry, Fibroin, Biomaterial, General Materials Science, Micronucleus, Nuclear chemistry
Abstract

Emerging studies have showed that silk fibroin might be as a naturally occurring degradable biomaterial for tissue engineering with unique mechanical properties, biocompatib ility and processability. To optimize the formation of the regenerated silk fibroin film, in thi s study, we examined the genotoxic potential of the regenerated silk fibroin films by differe nt cross-linking mode with micronucleus and the single cell gel electrophoresis (comet) assa y. The data showed that MNF in group PC and group SD showed significantly no differenc e with blank group (P>0.05), and no evident comet tails were observed. However, the resul t of EC group was significantly different from the control group(P

Published
2007
Full Text
View/download PDF

50. Preparation of Sericin Film and its Cytocompatibility

Author

Mingzhong Li, Shenzhou Lu, Yufeng Xie, Rui Juan Xie, and W Sheng

Subjects
Mechanical property, biology, Chemistry, Mechanical Engineering, fungi, technology, industry, and agriculture, macromolecular substances, biology.organism_classification, Sericin, Chemical engineering, Mechanics of Materials, Bombyx mori, General Materials Science, SILK SERICIN, Cytotoxicity
Abstract

Bombyx mori Sericin films were prepared with PEG-DE as cross linking agent. The main physical properties, structure characteristics, cytotoxicity and cell proliferation of sericin films were measured and analyzed. The result showed that sericin films prepared by cast method containing 30-40% of PEG-DE, showed good mechanical properties. PEG-DE caused the changes of the condensed structure of sericin films. The films prepared from sericin extracted both from silk-gland and cocoon shell showed good cytocompatibility. Silk sericin films with PEG-DE had no obvious cytotoxicity to cells.

Published
2007
Full Text
View/download PDF

Catalog

Books, media, physical & digital resources
See catalog results