Search

The ectoparasitic nematode Xiphinema index transmits grapevine fanleaf virus (GFLV) during feeding on grapevine roots, causing fanleaf degeneration in the plant. Hence, resistance breeding is a key to develop novel rootstocks to overcome such threats. In past years, various grapevine species were screened, and a few candidates with partial resistance were identified. However, they were hardly sufficient for viticulture because of their many agronomical defects. To develop reliably resistant rootstocks applicable in viticulture, multiple Vitis spp. genotypes were analyzed using root inoculation with nematodes in glass vials as an early and easy evaluation test. Resistance levels were evaluated 35 days after inoculation based on nematode reproduction factors, focusing on juveniles and eggs. Infection of grapevines with GFLV was analyzed after inoculation with viruliferous X. index. With this fast screening system, putative candidates with resistances against X. index have been identified for future breeding programs. Particularly, genotypes with the genetic background of Vitis aestivalis and Vitis labrusca were found to be nematode-resistant.

Geographical distribution and diversity of current plant species have been strongly shaped by climatic oscillations during the Quaternary. Analysing the resulting divergence among species and differentiation within species is crucial to understand the evolution of taxa like the Vitis genus, which provides very useful genetic resources for grapevine improvement and might reveal original recolonization patterns due to growth habit and dispersal mode. Here, we studied the genetic structure in natural populations of three species from eastern North America: Vitis aestivalis, V. cinerea and V. riparia using different marker types. Vitis aestivalis and V. cinerea showed higher diversity than V. riparia. The two former species are less differentiated, confirming an earlier divergence of V. riparia. V. aestivalis and V. riparia exhibited different genetic groups on both sides of the Appalachian Mountains that could mirror different recolonization routes from southern refugia. Genetic structure was stronger in V. cinerea, for which two varieties (var. berlandieri and var. cinerea) are morphologically recognized. Our results confirm this distinction and suggest the existence of three other lineages within var. cinerea. These discontinuities appear linked to adaptation of var. berlandieri to dry and limy areas of Texas and partially to the Mississippi River Valley. Rapid range expansions from refugia upon climate warming are also suggested by the low linkage disequilibrium values observed. Furthermore, large variation for downy mildew resistance was observed in the three species. Our findings appeared consistent with the vegetation history of eastern North America.

Grapevines are frequently infected by multiple viruses. Our previous study showed that Norton grapevine (Vitis aestivalis) is resistant to grapevine vein clearing virus (GVCV), a DNA virus in the family Caulimoviridae. To study the reaction of Norton to RNA viruses, we transferred seven RNA viruses to Norton from Kishmish Vatkana (KV) (V. vinifera) via graft transmission. We profiled viral small RNAs (vsRNAs) of the seven viruses and compared viral titers in Norton and KV. Total vsRNAs of grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-2, GLRaV-3, grapevine virus A (GVA), and grapevine Pinot gris virus (GPGV) were significantly less abundant in Norton than in KV, but total vsRNAs of grapevine fleck virus (GFkV) were more abundant in Norton than in KV. Total vsRNAs of grapevine rupestris stem pitting-associated virus (GRSPaV) were not different between Norton and KV. Grafting direction of Norton to KV or KV to Norton did not affect the quantity of vsRNAs. The genome coverage of GLRaV-1, GLRaV-2, GLRaV-3, and GVA vsRNAs was lower in Norton than KV. The 21- and 22-nucleotide classes of vsRNAs were predominant for all seven viruses. Virus quantification by quantitative PCR indicated that GLRaV-1 was undetectable in Norton; GLRaV-2, GLRaV-3, and GVA were less abundant in Norton; and GFkV was more abundant in Norton than in KV. These results demonstrated that Norton grapevine suppresses GLRaV-1, GLRaV-2, GLRaV-3, and GVA but supports GFkV in comparison with KV. This study revealed new facets of complex molecular interactions between grapevines and multiple viruses.

Acidity and tannins are among the grape berry quality traits that influence wine quality. Despite advantageous environmental tolerances of Vitis aestivalis-derived 'Norton', its acidity and tannin concentrations often deviate from expectations set for V. vinifera. Identification of the genetic determinants of malic acid, tartaric acid, pH, and tannin can assist in the improvement of new hybrid cultivars. For this purpose, a 'Norton' and V. vinifera 'Cabernet Sauvignon' hybrid population containing 223 individuals was used to construct a linkage map containing 384 simple sequence repeat (SSR) and 2,084 genotyping-by-sequencing (GBS)-derived single nucleotide polymorphism (SNP) markers. The resulting map was 1,441.9 cM in length with an average inter-marker distance of 0.75 cM and spanned 19 linkage groups (LGs). Quantitative trait loci (QTLs) were detected for malic acid, tartaric acid, pH, and tannin. QTLs for malic acid (LG 8) and pH (LG 6) were observed across multiple years and explained approximately 17.7% and 18.5% of the phenotypic variation, respectively. Additionally, QTLs for tartaric acid were identified on linkage groups 1, 6, 7, 9, and 17 and tannin on LG 2 in single-year data. The QTLs for tartaric acid explained between 8.8−14.3% and tannin explained 24.7% of the phenotypic variation. The markers linked to these QTLs can be used to improve hybrid cultivar breeding through marker-assisted selection.

Table grapes are a valuable dietary product. Seedless grapes are in high demand among consumers. For this reason, the breeding of seedless varieties is one of the popular trends in modern viticulture, along with the production of environmentally friendly products. Downy mildew (Plasmopara viticola(Berk. & M.A. Curtis) Berl. & De Toni) is one of the most common fungal diseases of the grapevine. Most downy mildew resistant grape accessions belong to North American species likeVitis aestivalisMichx.,V. berlandieriPlanch.,V. cinerea(Engelm. ex A. Gray) Engelm. ex Millard,V. ripariaMichx.,V. rupestris Scheele, etc. The search for donors of resistance genes is an urgent task.Rpv3is one of the most significant resistance genes from a number of North American grape varieties. The aim of this work is to identify the downy mildew resistance geneRpv3in seedless grape varieties by means of DNA-marker analysis. The grape varieties with rudimentary development of seed in berries and with North American species in the pedigree were chosen as the object of the study. The varieties “Dunavski lazur” and “Seyve Villard 12-375” with reference alleles were used as the positive control, whileV. viniferaL. was used as the negative control. UDV305 and UDV737 DNA-markers were used in this study to identify the allelic type of theRpv3gene. The work was performed using the polymerase chain reaction. The reaction products were separated by capillary electrophoresis using the ABI Prism 3130 automatic genetic analyzer. Evaluation of the results was done using the GeneMapper and PeakScanner software. Functional alleles of the downy mildew resistance geneRpv3were revealed in grape varieties “Kishmish zaporozhskiy”, “Lady Patricia”, “Remaily seedless”, “Pamyati Smirnova” and “Shayan”.Rpv3299-279, one of the seven known haplotypes, was identified in all the varieties. The pedigree analysis of the studied varieties indicated that the parental forms – “Seyve Villard” and “Seibel” hybrids – are presumably the donors of the gene. Grape accessions with the identifiedRpv3gene can be used in seedless varieties breeding as donors of resistance to downy mildew.

Race-specific resistance loci, whether having qualitative or quantitative effects, present plant-breeding challenges for phenotypic selection and deciding which loci to select or stack with other resistance loci for improved durability. Previously, resistance to grapevine powdery mildew (GPM, caused by Erysiphe necator) was predicted to be conferred by at least three race-specific loci in the mapping family B37-28 × C56-11 segregating for GPM resistance from Vitis aestivalis. In this study, 9 years of vineyard GPM disease severity ratings plus a greenhouse and laboratory assays were genetically mapped, using a rhAmpSeq core genome marker platform with 2,000 local haplotype markers. A new qualitative resistance locus, named REN11, on the chromosome (Chr) 15 was found to be effective in nearly all (11 of 12) vineyard environments on leaves, rachis, berries, and most of the time (7 of 12) stems. REN11 was independently validated in a pseudo-testcross with the grandparent source of resistance, “Tamiami.” Five other loci significantly predicted GPM severity on leaves in only one or two environments, which could indicate race-specific resistance or their roles in different timepoints in epidemic progress. Loci on Chr 8 and 9 reproducibly predicted disease severity on stems but not on other tissues and had additive effects with REN11 on the stems. The rhAmpSeq local haplotype sequences published in this study for REN11 and Chr 8 and 9 stem quantitative trait locus (QTL) can be used directly for marker-assisted selection or converted to SNP assays. In screening for REN11 in a diversity panel of 20,651 vines representing the diversity of Vitis, this rhAmpSeq haplotype had a false positive rate of 0.034% or less. The effects of the other foliar resistance loci detected in this study seem too unstable for genetic improvement regardless of quantitative effect size, whether due to race specificity or other environmental variables.

Grapevines (Vitis spp.) host viruses belonging to 17 families. Virus-associated diseases are a constant challenge to grape production. Genetic resources for breeding virus-resistant grape cultivars are scarce. ‘Norton’ is a hybrid grape of North American Vitis aestivalis and is resistant to powdery mildew and downy mildew. In this study, we assessed resistance of ‘Norton’ to grapevine vein clearing virus (GVCV), which is prevalent in native, wild Vitaceae and in vineyards in the Midwest region of the U.S. We did not detect GVCV in ‘Norton’ as either the scion or the rootstock up to 3 years after it was grafted with a GVCV-infected ‘Chardonel’ grapevine. Upon sequencing of small RNAs, we were able to assemble the GVCV genome from virus small RNAs in GVCV-infected ‘Chardonel’ scion or rootstock, but not from grafted ‘Norton’ scion and rootstock. This study unveils a new trait of ‘Norton’ that can be used in breeding GVCV-resistant grape cultivars, and to investigate genetic mechanisms of ‘Norton’ resistance to GVCV.

Vitis aestivalis-derived ‘Norton’ is the official grape of the State of Missouri, grown in regions with high disease pressure and cold winter temperatures, where Vitis vinifera is not adapted. It reportedly offers an abundance of traits, including resistance to powdery and downy mildew as well as botrytis bunch rot, which can be used to naturally improve existing V. vinifera germplasm. To identify genetic determinants for resistance to downy mildew caused by Plasmopara viticola and botrytis bunch rot caused by Botrytis cinerea in V. aestivalis-derived ‘Norton’, a mapping population of 182 individuals was constructed from a cross between ‘Norton’ and V. vinifera ‘Cabernet Sauvignon’. A consensus genetic map was constructed with 411 simple sequence repeat (SSR) markers. In collaboration with VitisGen (http://www.vitisgen.org), approximately 43,320 single-nucleotide polymorphism (SNP) markers generated by genotyping-by-sequencing (GBS) were identified, and a consensus map of 3825 SNPs was developed. Of these, 1665 SNP and 407 SSR markers were clustered into 19 linkage groups, for a total of 2072 markers spanning a genetic distance of 2203.5 cM. In preparation for placing traits on this integrated high-resolution map, disease progression and resistance reaction in response to P. viticola and B. cinerea were evaluated in this population for 2 years. The quantitative trait loci (QTL) analysis indicated major resistance loci on linkage group 18 for downy mildew and linkage group 2 for botrytis bunch rot, respectively. The ultimate goal of this program is to use genetic markers to rapidly deploy favorable alleles and accelerate breeding cycles for new cultivar releases.

International audience; The composition of steroids and triterpenoids in the leaves of eight grapevine species was analyzed in order to assess phenotypic differences. Four wild species (Vitis aestivalis Michx., Vitis labrusca L., Vitis riparia Michx., and Vitis vinifera subsp. sylvestris (Gmelin) Hegi) and four domesticated (Vitis vinifera cultivars: Cabernet Sauvignon, Gamay, Marselan, and Merlot) were studied. Although the main profiles of steroids and triterpenoids were similar in all analyzed extracts, remarkable quantitative differences in the content of these compounds in Vitis spp. leaves were demonstrated by GC–MS/FID analysis. The analyzed Vitis plants differed in the level of sterols, i.e. cholesterol (1), campesterol (2), stigmasterol (3), clionasterol (4) (exclusively in V. vinifera subsp. sylvestris (Gmelin) Hegi), sitosterol (5), and their amount was generally higher in wild grapevines. The predominance of pentacyclic triterpenoids of ursane-, oleanane-, lupane- and friedooleanane (taraxerane)-type skeletons depended on the studied cultivar/variety. Taraxerol (7) may be considered as a biomarker compound of V. vinifera leaves. The obtained data supplement information about biochemical diversity of Vitis genus and despite small qualitative differences allow species discrimination considering phylogenetic relationships confirmed by HCPC analysis. Differences between wild and cultivated grapevines in steroid and triterpenoid profiles may be connected to the domestication process.

A nondestructive sampling method was developed for Lycorma delicatula egg masses based on fixed-radius plot (100 m2) in 2020. All trees >1.0 cm DBH (diameter at breast height, 1.37 m in height) on each plot were visually inspected from the ground 4 m from the tree with binoculars. Egg masses found on trees were separated into six within-tree positions (lower trunk, middle trunk, upper trunk, first branch, second branch, above second branch) and recorded by cardinal directions, whereas those laid on shrubs/vines and stones were recorded without such separation. In total, 146 trees were inventoried at 28 plots over seven study sites (four plots per site). Egg masses were found on 19 tree species plus summer grape (Vitis aestivalis) and stone. Of the 421 total egg masses recorded, 31.1% were on Norway maple (Acer platanoides), followed by tree-of-heaven (Ailanthus altissima; 14.7%), black birch (Betula lenta; 12.6%), tuliptree (Liriodendron tulipifera; 11.9%), and American beech (Fagus grandifolia; 10.2%). Egg mass density per tree was positively correlated with tree diameter, and egg mass density per plot was positively correlated with plot basal area. Egg mass density after conversion ranged from 600 to 3,930 eggs masses/ha with no significant difference among study sites. Cardinal direction had no effect; however, significantly more egg masses were found on the first branches and upper trunks than other within-tree positions. Overall, branches were better than trunks in predicting egg mass number for the tree. The role of distance and late season adult aggregation on oviposition substrate selection are discussed.

In 2017, the grape and wine industry had an overall economic impact of $13.1 billion within the state of Texas. The majority of grapes grown in Texas are produced within the Texas High Plains American Viticultural Area (AVA). However, vineyards within the Texas High Plains AVA are subject to late spring frosts which can potentially diminish fruit quality, and reduce crop production. To assist in planning and production efforts, Texas High Plains AVA grape growers require information regarding vine secondary bud growth and fruitfulness. Therefore, the objectives of this experiment were to compare the growth and fruitfulness of shoots grown from primary and secondary buds ofVitis viniferaL. ‘Grenache’ and ‘Cabernet Sauvignon’ vines grafted to 110R rootstocks. Vines were planted in an experimental vineyard in 2008. Each year over two consecutive growing seasons (2016 – 2017) vines were exposed to the following treatments: primary bud growth intact, and following bud break allowing primary bud shoot growth to reach 15.0 cm in length then removing primary bud shoots (forcing growth from secondary buds). Gas exchange, growth, fruitfulness, and fruit total soluble solid data were collected each year. Collected data followed similar trends each growing season. Hence, data from each growing season were pooled. Gas exchange data indicate leaves from primary shoots had lower photosynthetic rates, and stomatal conductance when compared to leaves grown on secondary shoots. In addition, ‘Grenache’ leaves had greater gas exchange when compared to ‘Cabernet Sauvignon’ leaves. Pruning weights, vine yield, cluster mass, and total soluble solids were greater for shoots grown from primary buds. ‘Cabernet Sauvignon’ vines had greater pruning weights, but ‘Grenache’ vines had greater crop load (Ravaz Index) and cluster mass. Yield and total soluble solids did not differ between grape cultivars, but the number of clusters from each vine, and berry mass varied with cultivar and bud treatment. In the late spring frost-prone Texas High Plains AVA, cultivar selection continues to be a critical factor for vineyard success. Results indicate decreased yields from all vines with shoot growth only from secondary buds. However, even though ‘Grenache’ and ‘Cabernet Sauvignon’ vines responded differently to bud treatments (‘Cabernet Sauvignon’ vines generally produced a greater number of smaller clusters when compared to ‘Grenache’ vines), for each cultivar overall yield was similar across all bud treatments. Therefore, Texas High Plains AVA and other grape producers now have additional information that may assist them when making critical vineyard management choices.

Soil properties, climatic conditions and cultivation techniques constitute significant variables, which affect the quality of the final product. In particular, soil data (soil texture, soil electrical conductivity etc.) and weather data (average temperature, humidity etc.) affect both crop quality data (sugar content, anthocyanins content, phenolic compounds concentrations etc.) and crop quantity data (crop yield, berry weight and size etc.). The aim of this study was to investigate the variations of the microclimatic areas that exist within the same vineyard and their effect on the qualitative and quantitative characteristics of the berry skins and seeds of the grapes. These microclimatic areas could be identified and classified as those which could produce grapes for PDO wines and those which could be used for the production of other types of wines. The overall results of this study indicated important differences between the grapes of different sub-zones from the perspective of their chemical analyses, namely with notable differences identified between the grapes in the anthocyanin concentration and mainly in the concentration of malvidin, acetyl and coumaric esters of malvidin. A significant variability was observed in the characters of the must and in berry mechanical properties. More specifically, higher weight of berries was observed in the lower part of the vineyard, based on its slope. In the north-eastern part of the vineyard, a higher concentration of polyphenolic compounds was recorded. The concentration of total anthocyanins was found to be positively correlated with the soil slope, while significant variability in the concentration of total anthocyanins was revealed.

Vitis aestivalis “Norton/Cynthiana” is a grape native to North America and utilized in the commercial wine industry. The purpose of this research was to determine the appropriate time of year and/or time after last freeze that will yield the most successful propagation rate for Vitis aestivalis. It was hypothesized that the highest rate of propagation would be in early summer. During a year-long study (2015-2016), forty cuttings were taken semi-monthly from a vineyard, treated with 0.1% IBA and placed in a plant growth room set to spring conditions. Daily temperatures were recorded every day as well. In a follow-up study, cuttings were taken weekly from early spring before vine budding until late fall (2017) and treated as previous. After six weeks, cuttings were evaluated for root production. In both studies, rooting success rates were the highest in the month of June at 10.0% - 27.5%, with rates less than 7.5% for all other sampling dates. It was determined that the best time to propagate Vitis aestivalis is in June, 10 - 12 weeks after the last temperature below 0°C or eight to ten weeks after the first budding.

A study, designed to gain some knowledge of viruses infecting native grapes in the southeastern United States, presently limited to a single paper (4), was initiated in spring of 2012. In the first phase of this investigation, 28 samples of muscadine (Vitis rotundifolia) and summer (V. aestivalis) grapes were collected from different locations in Mississippi (MS) and the Great Smoky Mountains National Park (GSMNP) and were analyzed for the presence of dsRNAs. A muscadine sample of cv. Burgaw (MS-07) from an experimental field in southern MS and a sample of summer grape from GSMNP (GSM-1) contained similar patterns of multiple dsRNA bands reminiscent of closterovirus infections. These dsRNAs were reverse transcribed and subjected to PCR with taxon-specific degenerate primers targeting HSP70h gene of closterovirids as described (5). DNA bands of ~600 bp, amplified from both samples, were cloned and sequenced. Pairwise comparisons showed that two viruses share 75% common nucleotides (nt) and 82% amino acids (aa) in the genome portion sequenced. Comparisons with available sequences in NCBI/GenBank revealed that these viruses are distinct isolates of Grapevine leafroll-associated virus 2 (GLRaV-2). GLRaV-2 is known to occur as divergent molecular variants characterized by different pathological effects on specific indicators ranging from leafroll to graft incompatibility (2). The GSM-1 isolate was most closely related to Red Globe isolate of GLRaV-2 (GLRaV-2RG; AF314061), reported to induce graft incompatibility (1), with 87% identical nt (95% aa). However, isolate MS-07 was most closely related (96% nt and 97% aa identity) to leafroll-inducing isolate 93/955 (GLRaV-2 93/955; NC_007448.1) (3). Virus-specific DIG labeled probe produced strong hybridization signals with nucleic acids extracted from MS07 and GSM-1 and blotted onto a positively charged membrane, thus confirming GLRaV-2 infections. No signal could be observed in negative controls. Finally, a set of GLRaV-2 specific primers (LR-2F: 5′TCGGCGTACATCCCAACTTAC3′ and LR-2R: 5′CTGAGTGAAACGCACTGATC3′), designed to amplify a 422-bp-long PCR product, was applied in one-step RT-PCR tests performed on total nucleic acid extracts from additional 65 samples (60 muscadines and five summer grapes). GLRaV-2 was found in an additional four samples of muscadines (cvs. Burgaw and Hunt and two samples of an unknown cultivar) collected in MS and in one sample of summer grape collected 200 m away from the original source in GSMNP. As further ascertained, all GLRaV-2 isolates from muscadines belonged to “93/955 subgroup,” whereas the additional isolate from summer grape shared 98% identical nt with the isolate GSM-1. No specific symptoms could be associated with the presence of GLRaV-2 in summer grapes or muscadines. This is the first report of GLRaV-2 in muscadines and summer grapes in the United States. Furthermore, the occurrence of GLRaV-2 in summer grapes in a natural ecosystem and in muscadines in Mississippi where there is no sizable V. vinifera industry provides important clues on ecology and possible origin of this virus. References: (1) R. Alkowni et al. Virus Genes 43:102, 2011. (2) N. Bertazzon et al. Eur. J. Plant Pathol. 127:185, 2010. (3) B. Meng et al. Virus Genes 31:31, 2005. (4) S. Sabanadzovic et al. Virology 394:1, 2009. (5) T. Tian et al. Phytopathology 86:1167, 1996.

'Mavrodafni' (Vitis vinifera L.) is considered one of the oldest grapevine cultivars indigenous to the Greek vineyards, with western Peloponnese being its primary centre of cultivation. 'Renio' is considered to be either a biotype of 'Mavrodafni' or an altogether different cultivar. Both 'Mavrodafni' and 'Renio' can be found in the vineyards of the areas of cultivation, since 'Renio' is considered to be more productive compared to 'Mavrodafni' and, for this reason, it has gradually replaced 'Mavrodafni' from cultivation over the course of time. 'Mavrodafni' and 'Renio' contain appreciable amounts of quality characters of grape and must in terms of total polyphenol and total anthocyanins content in berry skins, depending on the different regions where they are cultivated and they would be worthy of further study and use for the production of different types of wines.

Vitis aestivalis is used in commercial wine production. Vegetative propagation of V. aestivalis has shown a low success rate. Although plant tissue culture has been a successful method to propagate many species, V. aestivalis has not yet been reliably grown as pure callus culture due to a fungal endophyte that exists within the plant. This study reports a viable protocol for obtaining fungus-free tissue culture callus from V. aestivalis. Explant tissue was chosen from healthy, actively growing plants grown in a growth room and in a vineyard. Tissues were sterilized with a combination of isopropanol, bleach, and chlorine dioxide gas and plated onto media containing chlorothalonil. The results from this study suggest that in order to obtain endophyte-free callus tissue, vine explants are to be taken from plants grown in a growth chamber simulating springtime conditions, sterilized in a combination of alcohol, bleach, and chlorine dioxide, and plated on selection media containing an antifungal agent, such as chlorothalonil. This technique could potentially be used with plants that have associated endophytes or other contamination problems to establish callus tissue for research and/or commercial propagation efforts.

Botrytis bunch rot, caused by Botrytis cinerea, is one of the most destructive diseases of grapes (Vitis vinifera L.). A phenotyping assay was designed under laboratory conditions to analyze grape-B. cinerea interactions. A conidial suspension of concentration 1 × 105 conidia/ml was prepared and used to inoculate berries from two different grape varieties: V. aestivalis-derived ‘Norton’, a North American hybrid, and V. vinifera ‘Cabernet Sauvignon’, a European grape. The differences in the infection reaction between these two cultivars were visible 10 days after inoculation. Berries from Norton had a low average disease incidence (7.5 %) and disease severity (3.7 %). In contrast, berries from Cabernet Sauvignon were completely susceptible, exhibiting an average disease incidence and severity greater than 90 %. This phenotyping assay can be further applied to evaluate disease progression in a mapping population, developed by crossing V. aestivalis-derived ‘Norton’ and V. vinifera ‘Cabernet Sauvignon’.

The first microsatellite-based linkage map for Vitis aestivalis was constructed using 183 progeny from the crosses of V. aestivalis-derived “Norton” and V. vinifera “Cabernet Sauvignon”. A total of 1157 simple sequence repeat (SSR) markers were tested, 859 were amplified via PCR and 413 were polymorphic for at least one parent. The map for Norton consisted of 376 markers and covered 1496.6 centimorgan (cM) on 19 chromosomes. The consensus map consisted of 411 markers on 19 linkage groups with a total distance of 1678.6 cM. Although isozyme and SSR marker analyses in 1993 and 2009 provided preliminary evidence that Norton and Cynthiana grapes are genetically identical, only five banding patterns and four microsatellite loci were reported. This study characterized the relationship between these two cultivars using 185 microsatellites spanning 19 linkage groups for a genome-wide analysis. Four accessions of Norton and three accessions of Cynthiana were used; capillary electrophoresis results revealed Norton and Cynthiana to be identical at all selected loci.

The Vitis aestivalis -derived ‘Norton’ is one of the very few commercial red grape varieties that can be grown in regions with high disease pressure and cold temperatures in winter and spring where V. vinifera is difficult to grow. This study began with the objectives of generating interspecific hybrids of Norton and V. vinifera (Cabernet Sauvignon, Pinot Noir, Syrah, and Merlot) in order to combine the disease resistance and cold hardiness characters of V. aestivalis with the excellent wine quality of V. vinifera . Norton grapes were also crossed with the Vitis interspecific hybrid ‘Vignoles’ for the same reason. The true hybrids obtained from all of the crosses were identified using microsatellite markers. A high percentage of hybrids (70–92%) were obtained in all crosses except Norton × Merlot (17%). Results demonstrate the reliability of SSR markers for Norton-based interspecific hybrid identification.

Impact of canopy management practices were assessed on canopy architecture, yield, and fruit composition of Norton grapes. Combinations of shoot thinning (ST), shoot positioning (SP), and leaf removal (LR) were imposed. The highest total soluble solids and lowest acidity were recorded either in LR or its combination with ST+SP treatments. Malic acid and potassium concentrations were highest on control, ST, SP, ST+SP vines. Canopy characteristics measured by point quadrat analysis differed significantly between treatments with more leaf layer number and less percent gap in control vines and in vines without LR treatments. These same treatments also recorded highest percent interior leaves and clusters.

Non-expressor of pathogenesis-related genes 1 (NPR1) plays a significant role in the defense responses of plants to pathogens by regulating the expression of defense-related genes. In the present study, we isolated two NPR1 genes from Vitis aestivalis cv. Norton and Vitis vinifera cv. Cabernet Sauvignon, which were referred to as VaNPR1.1 and VvNPR1. 1-CS, respectively. They encode a protein of 584 amino acids with a predicted molecular weight of 64.8 kDa and a theoretical isoelectric point (pI) of 5.74. The predicted amino acid sequences of VaNPR1.1 and VvNPR1.1-CS differ by only one amino acid. Over-expression of VaNPR1.1 gene in Arabidopsis npr1-1 mutant plants restores the transcriptional expression of AtPR-1 gene, though not to the full scale. This result demonstrated that a grapevine VaNPR1.1 possesses a similar function to the Arabidopsis NPR1 in the regulation of defense-related genes. Over-expression of VaNPR1.1 in transgenic Arabidopsis plant increased tolerance to salinity, but had no effect on the drought tolerance. We conclude that VaNPR1.1 is a functional ortholog of AtNPR1 and also involved in grapevine's response to the salt stress.

Post-budbreak freeze events on 7–8 Apr 2007 were followed by the development of aerial roots on winegrapes later in the spring and continuing through the summer months. Rainfall and relative humidity were much higher than average during the months of May, June, and July following the freeze events. Aerial rooting of grapes has not been previously reported in Oklahoma; therefore, quantitative counts of aerial rooting were performed to determine if there was a relationship between aerial root formation and subsequent vine productivity. Aerial root production varied by scion cultivar and the effect of rootstock was unclear. Only Petit Verdot produced significantly more roots on a rootstock than not. It appears that the formation of aerial roots on grapevines in situ is a complex interaction of freeze injury and subsequent environmental conditions to produce roots. Aerial rooting was likely a sign of injury, but the number of aerial roots produced did not necessarily represent the degree of injury. Few or no roots may be produced when injury or damage is slight, more with moderate injury or damage, and few again when significant injury or damage is sustained.

Three wine grapes, Norton ( Vitis aestivalis ), Cabernet Franc clone1, and Cabernet Franc clone313 ( Vitis vinifera ), collected from a Virginia vineyard were evaluated and compared for their antioxidant properties and phenolic profile. All grape extracts exerted remarkable antioxidant activities. Their oxygen radical absorbance capacity (ORAC) values were not significantly different from one another, ranging from 22.9 to 26.7 μmol TE/g of fresh weight. The Cabernet Franc clone1 had the strongest 1,1-diphenyl-2-picrylhydrazyl (DPPH ) radicals scavenging activity (8.8 μmol TE/g) compared to the Norton or Cabernet Franc clone313 grape extracts (7.9 μmol TE/g and 5.4 μmol TE/g, respectively). The Norton grape contained significantly higher total phenolic, anthocyanin, and flavonoid content than the Cabernet Franc grapes ( p