Search

Lignocellulosic biomass is a high potential feedstock to produce biofuels and value-added products contributing to sustainable bioeconomy. Nevertheless, biomass recalcitrance reduces the yield of processing routes, and therefore, characterization of structural and chemical factors contributing to this resistance must be carried out by robust but rapid and economical analytical techniques. In this work, the recalcitrance of eight lignocellulosic biomass samples: agave bagasse (AB), banana peel (BP), corn cob (CB), barley straw (BS), orange peel (OP), pineapple peel (PP), sugarcane bagasse (SB) and sawdust (SW), was performed infrared spectroscopy and thermogravimetric analysis. The classification of chemical and thermal behavior was based on principal components analysis (PCA) by similarity to four reference materials, cotton fiber (CF), lignin (LG), citrus pectin (CP) and potato starch (PS). The results indicate a clear trend of recalcitrance in four well-defined groups (GPI–GPIV): GPII or lignin-like biomasses (LG and AB) were assessed as the most recalcitrant biomass type (devolatilization temperature: ~ 150 °C, remaining weights > 30wt%), followed by GPI or cellulosic-like biomass (CF, SW and SB), which contain high amounts of cellulose that increase its recalcitrance to thermal degradation (devolatilization temperature: 200–380 °C, remaining weights

Enhancing the productivity of biomass, carbohydrates, proteins, and lipids in microalgae cultures is an essential task to justify the feasibility of using biofuels as energetic alternatives to fossil fuels. Diverse strategies can be used to get a biologically plausible optimization of the microalgae culture such as using indigenous microalgae added with other microorganisms such as fungi or bacteria, analyzing the effect of culture broth composition and reaction experimental conditions. A wastewater isolated co-culture microalgae-yeast (CCMY) was evaluated as potential biomass and lipids-efficient producer. The Box-Behnken experimental design and the response surface methodology yield to identify the best attainable composition of inorganic nutrient variables in culture media: sodium nitrate (NaNO3), potassium phosphate (K2HPO4), and ferrous sulfate (FeSO4). The results of the experimental design revealed that the NaNO3, K2HPO4, and FeSO4 were three factors significantly influencing the biochemical content. The detected optimal conditions correspond to a highest biomass production of 1.68 g L−1; the carbohydrate content was 16.75%, for proteins 37.11%, and the maximum lipid content was 27.77%. These values were about two times higher than the results obtained with the original version of the culture broth (BBM). The complexity of inorganic salts effect on the biomass and lipid accumulation motivates the proposal of a quartic order mathematical model which characterizes the productivity of microalgae-yeast co-culture as function of the inorganic micronutrient contents.

Biodiesel production from the transesterification of triglycerides produces crude glycerol as a by-product with a percentage of glycerol typically 20-80% (w/w) depending on the specific conditions of the transesterification process. This crude glycerol requires further purification in order to achieve commercial value and to increase the profitability of biodiesel production. For this reason, the main objective of this work was to obtain glycerol with a purity greater than 90% (w/w) starting from water-free crude glycerine as obtained from the IPN-GBD-1000® transesterification process and treating it via single-step neutralization according to green chemistry principles. For this purpose, sulphuric (H2SO4) and citric (C6H8O7) acids were evaluated as neutralizers by adding dilute acid solutions to crude glycerine under mild conditions. The physicochemical characterization of both crude and purified glycerol was carried out by means of infrared spectroscopy (FTIR), 1H and 13C nuclear magnetic resonance (NMR) and thermogravimetric analysis (TGA). The results indicated that the neutralization method herein developed allowed the obtaining of glycerol with purities of 98.5% and 84.37% (w/w) and treatment efficiencies of 98.5% and 46.7% for sulphuric and citric acid treatments, respectively. In addition, the environmental viability of the sulphuric acid process was evaluated through the calculation of green metrics such as environmental factor, water factor and mass intensity, through which significant environmental advantages were confirmed. The one-step neutralization process reported herein generates zero waste when sulphuric acid is used; it also decreases the water consumption 17-fold and reduces 3-fold the use of raw materials per mass unit of purified glycerol compared to the conventional acidification-neutralization process.

Improving the competitiveness of biodiesel production by microalgae cultures requires the application of several strategies to obtain a high content of lipids, rapid biomass growth and a capacity to adapt to different kinds of environment, with the aim of using non-renewable nutrient sources. Therefore, the use of an individual indigenous microalgae strain or a consortium from natural or anthropogenic sites is now considered an alternative for biofuel production. This study examined the temporal behaviour of secondary metabolites produced by a native microalgae and yeast consortium isolated from wastewater, which was characterized by a genetic identification method based on the MiSeq system. The predominant species in the consortium was Scenedesmus obliquus, representing 68% of the organisms. In addition, the consortium contained a number of yeast species, including Candida pimensis (43%), Arthroderma vanbreuseghemii (23%), Diaporthe aspalathi/Diaporthe meridionalis (25%) and Hericium americanum (3%). This indigenous co-culture of microalgae and yeast showed biomass productivity of 0.06 g l−1 day−1, with a content of 30% (w/w) carbohydrates, 4% (w/w) proteins and 55% (w/w) lipids. Transesterification of the extracted lipids produced fatty acid methyl esters (FAMEs), which were analysed by gas chromatography (GC). The FAMEs included methyl pentadecanoate (1.90%), cis-10-pentanedecanoic acid methyl ester (1.36%), methyl palmitate (2.64%), methyl palmitoleate (21.36%), methyl oleate (64.95%), methyl linolenate (3.83%) and methyl linolelaidate (3.95%). This composition was relevant for biodiesel production based on the co-culture of indigenous microalgae and yeast consortia.

A Sulfobetaine-based Branched Geminal Zwitterionic Liquid (SBGZL) and another one based on hydroxysultaine (HBGZL), were synthesized and their performance was evaluated in the enhancement of the oil recovery (EOR) when they are injected through flooding water into carbonate reservoirs. SBGZL obtained 39.4% and 215.5% more recovery factor for light- and heavy-oil, respectively, than obtained by a synthetic brine used as a reference; conversely, HBGZL obtained 37.5% and 44.7%, respectively. Density-Functional-Theory calculations of interaction energies reveal that both the SBGZL and HBGZL molecules adsorb on the carbonate surfaces stronger than an asphaltene molecule, implying that the good EOR performance of the zwitterionic liquids is due to the induced wettability change of the firstly-oil-wet carbonate surfaces. Keywords: Enhanced oil recovery, Density Functional Theory, Sulfobetaine-based zwitterionic geminal liquid, Supramolecular chemistry

Jatropha curcas L. (JCL) commercial plantations in Mexico, one of the most important JCL origin centers, have failed due to a variety of biological, political and technical factors affecting their productivity. This study explores feasible sites of JCL cultivation as a potential source for biodiesel production in Mexico, given agroclimatic and agroecological considerations. We propose a GIS-based approach for estimating suitable and available lands to grow JCL by integrating an Analytical Hierarchy Process (AHP) in the ArcGIS software. Spatial analysis combined multiple data, different evaluation criteria, three land availability classes (high, medium and low potential) and took into account ecological, ethical, and political restrictions, and considering two scenarios with different restriction levels. Suitability and availability maps were generated using agroclimatic information (climatic, land use/soil, and climate change and extreme weather events risk) together with other socioeconomic factors. Approximately 15.3% of Mexican territory is available for JCL production yielding a biodiesel production of 9.683 Mm3/year. Amelioration of the available land is necessary to improve land selection. GIS-based analysis represents a first approach to establish a successful biodiesel project that avoids, competition with food or feed production, maintains biodiversity conservation, and promotes biofuel supply chain development. This procedure would also be applicable to other energy crops such as oil palm and Ricinus communis.

The in-situ or direct transesterification from non-edible Jatropha curcas L. (Jatropha) seeds is a suitable alternative to produce fatty acid methyl esters (FAME) in one-step. The FAME production was investigated in presence of homogeneous (NaOH) or heterogeneous (Na2ZrO3) catalysts. Parameters, such as catalyst concentration (between 1 and 10 wt%), reaction time, temperature and methanol/oil molar ratio were analysed. The maximum heterogeneous direct transesterification of FAME yield was 99.9% using 5 wt% of Na2ZrO3 at 65 °C and 8 h. Results showed that no solvent for oil extraction is required. The resulting FAME shows good purity and composition. Moreover, no water is required to purify the FAME. Compositional analysis of FAME indicated that linoleic (C18:2), oleic (C18:1) and palmitic (C16:0) methyl esters were the major components. In addition, the reusability of the catalyst was also investigated. The basic heterogeneous catalyst exhibited stability in the direct transesterification reactions with yields of >72.5% during five cycles. Finally, Green Metrics values were proposed as parameters to evaluate the FAME obtained in one-pot from seeds directly. The heterogeneous direct transesterification process resulted 55% greener as compared to conventional transesterification and 39.4% greener than homogenous direct transesterification. Heterogeneous direct transesterification is a promising alternative for more clean, efficient, scalable and cost-effective FAME production that has the potential to developing new technologies.

Three geminal zwitterionic compounds are synthesized pursuing five parameters of green chemistry: atomic economy, environmental factor, mass intensity, mass reaction efficiency, and carbon efficiency; and evaluated as corrosion inhibitors for carbon steel (AISI–1018). The zwitterions are produced with variable length from amines (i.e., hydrocarbon chains), achieving mass reaction efficiencies higher than 80%, without the generation of wastes. The molecular structures are characterized using infrared spectroscopy and nuclear magnetic resonance. AISI–1018 steel coupons (blank corrosion) are used to test the corrosion inhibition of the geminal compounds at different concentrations (10, 25, 50, 75, and 100 ppm) in 1.0 M NaCl saturated with CO2 (pH = 3.5 and 70 °C). Electrochemical characterization is conducted using the open circuit potential (OCP) method, and polarization curves (±320 mV vs OCP) to determine the optimum concentrations in which the inhibitors decrease the corrosion rate of the steel. The corr...

The production of biofuels from renewable biomass resources is an attractive way to mitigate CO2 emissions and alleviate the shortage of fossil fuels. A novel green one-pot synthesis of biodiesel from Ricinus communis seeds by basic heterogeneous catalysis is reported in this work. The direct transesterification (one-step process) of the seeds with methanol in the presence of homogeneous (HCl and NaOH) or heterogeneous (Na2ZrO3) catalysts was evaluated. Additionally, the comparison of the conventional (two-step process) transesterification against the direct transesterification reaction was analysed. The conventional transesterification of Ricinus communis oil with acidic (HCl/CH3OH, 5% v/v) and basic (NaOH/CH3OH, 5% w/w) homogeneous catalysts showed conversions of the fatty acid methyl esters (FAME) > 97% at 6 h and 3 h, respectively. Moreover, direct transesterification was carried out using a basic Na2ZrO3 catalyst. The maximum FAME yield was 99.99% at 4 h of reaction time and 5 wt % catalyst. Finally, Green Metrics Parameters of biodiesel showed that heterogeneous direct transesterification resulted in a seven times greener synthesis compared to conventional process. This novel heterogeneous one-step process is almost ten times less hazardous than the conventional process and five times less harmful than the homogeneous one-step reaction. No n-hexane is required for oil extraction. Thus, methanol as a reactant and as a solvent increased the greenness of the heterogeneous process, and the resulting biodiesel shows good purity and composition. In addition, no water is required to purify the biodiesel. According to these results, heterogeneous direct transesterification is a promising alternative for more sustainable, cleaner and efficient biodiesel production that is crucial to developing new technologies (by chemo-selectivity).

An electro-precipitation method is proposed for the treatment of synthetic (2654.4 mg L−1 total Cr, pH 3.9) and real tanning effluents (2775 mg L−1 total Cr, pH 4.0) containing elevated concentrations of Cr(III). Aluminum and copper anodes are thermodynamically (Pourbaix-type diagrams) and electrochemically evaluated in the synthetic electrolyte, as potential candidates to generate the chromium precipitation. Copper is selected due to better dissolution properties and avoiding passivation. The choice of copper anode is effective in both solutions, generating Cu+2 species which displace the chromium species from Cr(III), and obtaining chromium recoveries >99% for these cases. The total Cr concentration is decreased down to 0.12 mg L−1 in the real wastewater. Visual inspection of the treated synthetic solution and FTIR analysis reveal that a chromium hydroxide is formed as insoluble compound after the treatment, while cupric sulfate remains in the supernatant. A similar result is obtained for the real effluent, but other impurities and compounds different than chromium or copper are present in the precipitate. Although these species are not identified due to their complexity, they could be related to the nature of the tanning process, being derived from hide, surfactants, fixers and dyes. X-ray diffraction conducted for the sludge electro-generated from the treatment of the real tanning effluent support the FTIR and electrochemical evaluations, and this technique enables to identify that a very hydrated chromium hydroxide is formed after the treatment. The drying of this insoluble compound produces a distinctive hexagonal crystal of Cr(OH)3·3H2O, and dehydrated phases of chromium oxides (e.g. Cr2O3). These findings suggest that the electro-precipitation method herein proposed is efficacious to decrease the total chromium concentration below the maximum permissible limits (0.5 mg L−1).

Herein, the synthesis of three zwitterionic compounds (GZC-8, GZC-12, and GZC-18) derived from β-amino acids was carried out in good yield (>97%) through an ecofriendly, zero-waste synthesis procedure, starting from alkylamines (octylamine, dodecylamine, octadecylamine) and acrylic acid, under solventless conditions at ambient pressure and temperature. These compounds were characterized by Fourier transform infrared, two-dimensional nuclear magnetic resonance, electrospray ionization mass spectrometry, and elemental analyses and then evaluated as potential corrosion inhibitors for CO2 acidic environments characteristic of enhanced oil recovery (EOR) processes of the petroleum industry through electrochemical techniques such as open circuit potential (OCP), lineal polarization resistance (LRP), electrochemical impedance spectroscopy (EIS) at different immersion times, and potentiodynamic polarization after 24 h of immersion. From experimental measurements, inhibition efficiencies of 60, 89, and 90% were ob...

We prepared geminal zwitterionic liquids with the capability to obtain the chemical active species from laboratory to scalable production with pure or raw materials. Hence, a green-inspired and efficient process for their synthesis was developed. A performance test at reservoir conditions was conducted and it was found that the synthesized chemicals increase the oil recovery factor in an enhanced oil recovery process with properties as antiscale agents.

A low-cost NaFeTiO4/Fe2O3–FeTiO3 catalyst is synthesized using a solid-state method for biodiesel production using Jatropha curcas L. oil (JCO). X-Ray Diffraction (XRD) and Scanning Electron Microscopy (SEM) confirm the successful synthesis of this material. A Box-Behnken design (BBD) was used to perform a multivariate statistical optimization screening the following factors: methanol: oil molar ratio (6:1 to 16:1), catalyst load (0.15–15 wt%), and stirring rate (125–700 RPM); while maintaining the reaction time and temperature at 1 h and 65 °C, respectively. The triglyceride conversion into methyl esters is measured using Fourier Transform Infrared Spectroscopy (FT-IR) and used as a response variable. The maximum conversion of 93.24% is obtained using the following optimized reaction conditions: 12.47:1 MeOH: oil molar ratio, 13.80 wt% catalyst, and 590 RPM. It is found from the statistical analysis that catalyst load is the most relevant factor affecting the transesterification reaction, which otherwise, the biodiesel production does not occur when used at the lowest limit (0.15 wt%). The fatty acid methyl ester (FAME) composition obtained from Jatropha curcas L. oil is determined using Proton Nuclear Magnetic Resonance 1H-NMR and Gas Chromatography (GC).

Microalgae have emerged as renewable and sustainable candidates for biorefineries since they can generate bioproducts and bioenergy through the removal of contaminants contained in wastewater. In the present study, a native microalgae consortium (NMC) is isolated from a wastewater treatment plant, and used to remove 100 mgL−1 Cr(III). The native microalgae consortium is enriched in a photobioreactor with the following conditions: Bold’s Basal Medium (BBM), pH 8, room temperature and 20 µmolm−2s−1 light intensity. The molecular characterization reveals the presence of the following species: Tetradesmus sp., Scenedesmus sp and Ascomycota sp. The development of microalgae is evaluated through the production of biomass, pH, protein, lipid and carbohydrate, while the consortium presents the potential to obtain biofuels. The ability of the consortium to absorb two different sources of Cr (III) was determined using real tannery wastewater and synthetic water prepared with Cr2(SO4)3. The adsorption efficiency of the microalgae is analyzed using adsorption isotherms of Langmuir model, indicating 99% adsorption efficiency of 100 mgL−1 Cr(III). FT-IR and SEM analyses enable to identify the presence of Cr(III) in the native microalgae consortium. The promising features of this NMC underpin the idea of establishing a sustainable biorefinery to generate different bioproducts, in order to achieve a resource-efficient biomass use for a circular bioeconomy.

A new class of branched geminal zwitterionic liquids (BGZLs) betaine base with a long alkyl chains with either 8 (BGZL-ZW8) or 12 (BGZL-ZW12) carbons was synthesized and characterized by nuclear magnetic resonance (NMR) and Fourier transform infrared (FTIR) spectroscopic techniques. The BGZLs molecules presents functionality as viscosity reducer and wettability modifier with application in enhanced oil recovery (EOR) processes with good oil recovery factors (ORF). The above is demonstrated by performing spontaneous imbibition tests on embedded limestone cores with light and heavy crude oils in Amott cells at high temperature (90 °C) and different concentrations of BGZLs in presence of connate water with high salinity and hardness (36,275 ppm as NaCl and 6700 ppm hardness as CaCO3). The rheological behavior of BGZLs was also determined as viscosity reducers in heavy crude oil at concentrations of 2000, 1000 and 500 ppm at temperatures of 25 and 40 °C, in the range of 36.11% to 25 °C and 43.31% to 40 °C. To explain the mechanism through BGZLs act as viscosity reducers, we realized theoretical studies using the density functional theory (DFT), also as wettability modifiers taking BGZL-ZW8 and BGZL-ZW12 behavior, observed in the experimental part. The interaction energies show that BGZLs can disaggregate asphaltene (Asph) dimmer (Asph:Asph) by the formation of supramolecular sandwich complex (Asph:BGZL:Asph) among BGZLs and Asph:Asph, modifying the properties of crude oil such as viscosity, is possible to support the fact of the BGZLs can desorbs Asph molecules of the rock surface, modifying the calcite surface (Cs) wettability of oil-wet to water-wet. The results of this research show that it is feasible the use of zwitterionic liquids as viscosity and wettability modifier in EOR process.

The dynamic modeling of an adiabatic hydrocracking reactor was carried out by using the continuous lumping approach. Vacuum gas oil with 30.6°API and normal boiling temperature range from ~ 285 °C to about 329 °C was used as feedstock. Kinetic model parameters were derived from experimental information at three different reactor temperatures: 360, 370, and 380 °C; 1–3 h − 1 LSHV; 356 m 3 /m 3 hydrogen-to-oil ratio, and reactor pressure of 5.3 MPa. Thermal correlations were chosen to be reliable and dependent on reactivity index. The simulations allowed predicting the dynamic behavior of the reactor regarding temperature and cumulative weight fraction profiles. At the reaction conditions of simulations an increase of almost 10 °C was observed in the bed regarding inlet temperature while the reactor position of such maximum was moved to outlet reactor as time-on-stream increased.

In recent years, many studies have been published on the hydrotreating of non-edible vegetable oils, however, a limited number of them deal with the hydroprocessing of their corresponding fatty acid methyl esters for the productions of renewable fuels. In this study is outlined the production of renewable fuels from castor bean seeds (Ricinus communis L.) in two stages, the first one is to obtain the respective castor oil methyl esters by reactive extraction and the second one is to apply the hydrotreating process to these methyl esters by using a commercial NiMo/γ-Al2O3 catalyst in an isothermal batch reactor. A method was used to characterize the feedstock and the hydrotreating products from their TGA data by applying a proposed correlation equation for converting thermogravimetric measurements into simulated distillation results. Then, these estimated simulated distillation curves were used to obtain finally their characterization by composition based on real components. A chemical reaction network of four lumps along with its lumped kinetic model representing the hydrotreating of castor oil methyl esters was obtained from experiments conducted in a batch reactor operating under isothermal conditions at 395, 410, and 425 °C, 50 barg, and with reaction times from 2 to 4 h, and it was found that at severe operating conditions the yield and product selectivity of kerosene fraction increases, therefore, in order to obtain a higher production of renewable diesel fraction in this reaction system, the hydrotreating reaction time and temperature must be moderate.

Microbial consortia are isolated and enriched in discontinuous reactors under anaerobic conditions using different stoichiometric ratios of acetate (substrate): Cr(III) concentration: reactors A (0.5:1), B (1:1) and C (2:1). The inoculum is stemmed from a tannery effluent with the aim of tolerating and eliminating high concentrations of Cr(III) (2760 mg L−1). The Cr(III) removal process is performed in two stages for each reactor. Stage I is an abiotic process involving the reaction between acetate and Cr(III) forming the complex C r H 2 O x C H 3 C O O y 3 - y , which on its turn precipitates as C r 2 O 3 ( s ) in the first five days, thus, decreasing the metal concentration by 24, 42 and 61 % for reactors A, B and C respectively. FT-IR analysis, SEM-EDX, biomass and extracellular polymeric substances (EPS) indicate that the native bacteria enriched in the reactors eliminate Cr (III) during the biotic stage via bioadsorption and bioaccumulation mechanisms. Reactor C achieved the lowest Cr(III) concentration around 600 mg L-1 (78 % removal). The occurrence of these mechanisms was due to the nature of the inoculum since the bacteria were well adapted to the presence of high Cr(III) concentrations, whereby they did not require optimal growth conditions unlike a pure strain. The isolated strains were molecularly identified by amplification and sequencing of the 16 s rRNA gene using universal oligos 63 F (5’CAGGCCTAACACATGCAAGTC3′) and 1542R (5′AAGGAGGTGATCCAGCCGCA3′), finding a 99.06 % of similarity to Lactobacillus diolivorans (strain JCM 12183 accession number LC311745.1), and 99.88 % similarity to Lactobacillus brevis (strain C23 accession number MN880215.1). SEM-EDX enables to identify that the consortia are mainly composed of bacilli undergoing pleomorphism, due to the complex formations between functional groups in the cell wall and Cr(III).

The environmental impact of biodiesel production from waste cooking oil has been previously evaluated through life cycle assessment and, in all cases, it presents a lower ecological burden compared to first and third-generation biodiesel. However, production-use studies are scarce, particularly in the case of biodiesel consumption for power generation, at large and reduced scale. Thus, there is high uncertainty as to the combined contribution of the production process and exhaust emissions to the overall environmental footprint of biodiesel. This work performs a comparative analysis of the environmental impacts associated with the production and use of B25 biodiesel blend and ultra-low sulphur diesel in a power generator of 33 kW, at 100% of rated load and using life cycle methodology to characterise the derived impacts, based on primary data for process and use stages. The results of the modelling showed that B25 outperforms ultra-low sulphur diesel in all categories. Major impact reductions were found for abiotic depletion, potential for human toxicity, eutrophication potential, acidification potential, and global warming potential categories with 39.48%, 39.44%, 39.24%, 38.73%, and 35.77% respectively. Experimental measurement of exhaust emissions showed an increase in CO (52%) and a decrease in NOx (41.54%) for B25, compared to ultra-low sulphur diesel. The overall results indicate that the use of biodiesel blends in power generators could offer important environmental benefits from a life cycle perspective. However, a careful evaluation of engine specifications must be carried out when higher biodiesel blends are used, in order to maximise these benefits.

This study presents a statistical optimization conducted with operating variables affecting the biodiesel production using calcium oxide (CaO, industrial grade) as heterogeneous catalyst, and waste cooking oil as triglyceride source. The experiments are carried out in a commercial Robinson-Mahoney reactor (600 cm3) using a fixed catalytic basket to analyze the advantages (e.g. optimal contact between phases, facile catalyst recovery, heat transfer) and challenges of this design upon the establishing of a bench-scale transesterification process. As a pretreatment, the catalyst was calcined at 700 °C for 2 h. A Box-Behnken design (BBD) is used to account for the catalyst dosage (3,6 and 9 wt%), particle size (1.18, 1.41 and 2 mm) and the methanol-oil molar ratio (6, 9 and 12), at fixed temperature of 60 °C, stirring of 700 rpm and reaction time of 2 h. Reaction conversions greater than 98.5% w/w of triglycerides into methyl esters were achieved for the optimized conditions estimated through the BBD at 8.75% w/w catalyst dosage, 2 mm of particle size and 8.72:1 of methanol-oil molar ratio.

Due to expensive culture realizations and low lipid yields, microalgae-based biodiesel production still lacks economic viability at an industrial-scale. Optimization of lipids and fatty acid methyl esters (FAMEs) distribution is a necessary condition to get sustainable microalgae biodiesel production. Nutritional sources (nitrogen, phosphorous, carbon and iron) influence the lipid accumulation and biomass production yield. The aim of this study is to get high-quality biodiesel by a microalgae-yeast co-culture based on the selection of culture media micronutrients’ distribution. A response surface-based combination of NaNO3, K2HPO4 and FeSO4*7H2O nutrients increases biomass and lipids accumulations. The obtained highest biomass and lipids contents are 1.68 gL−1 and 27.77%, respectively. Under the selected optimized micronutrients’ composition, high-saturated fatty acids are obtained if high ratio of N/P (6:1 and 11:1) and unsaturated fatty acid under N/P ratio of (9:1) are considered. These results suggest microalgae-yeast co-culturing under controlled N/P ratio in the culture medium produce desirable lipids distributions, yielding better biodiesel quality and equilibrium between biomass and lipids accumulation. The selected micronutrient combination (with the selected N/P ratio) leads to augment the lipids content which is transformed into biodiesel. Biodiesel quality (determined by cetane number, iodine value, cloud point, oxidation stability, viscosity), is evaluated considering microalgae lipids and FAMEs produced by transesterification process. Fourier transform infrared (FTIR) corroborates the lipids distribution, which can be used to produce high quality biodiesel. Gas chromatography (GC) verifies the production of desirable methyl esters (C16 and C18).

A detailed experimental study has been conducted with the aim to examine the corrosion effects on a common C-steel electrode in H2SO4, in the absence and presence of CaSO4-scale formation. The redox alterations are examined using electrochemical techniques, while the morphology and composition of the electrode surface were analyzed by scanning electron microscopy/energy dispersive X-Ray spectroscopy (SEM/EDS) and glow-discharge optical emission spectroscopy (GD-OES). The corrosion process in Ca+2-solution involves both the formation of a corrosion layer and CaSO4-scales over C-steel surface, as confirmed by SEM-EDS analysis. The impedance results reveal that the accumulation of CaSO4-scales does not modify the corrosion mechanism if compared against its absence. The interaction between Ca+2 and SO42− does not generate a sufficient protective coating of CaSO4 along with the corrosion products at early stages of the growing scale, whereby there is a more important corrosion in the presence than in the absence of Ca+2. After approximately 7.4 h, the stabilization of the scale formation provides a more compact and protective film, which increases the corrosion resistance if compared against the pure corrosive solution. Nevertheless, the films formed in both media gradually corrode with time due to the accumulation of ions producing more porous and less protective films regardless of the presence of the scale. These findings provide a new approach to account for mineral-scaling using electrochemical techniques, and open the possibility to link the growth crystals with the spontaneous electrochemical process.

In this experimental study is investigated the performance of a new class of zwitterionic liquids (ZL) as multifunctional agents with asphaltene inhibition-dispersion activity as well as rock wettability and relative permeability modification properties to increase oil recovery factor. Asphaltenes isolated from two crude oil samples (light and heavy) and a crude oil sediment were used to evaluate the inhibition-dispersion performance of ZL, whereas two different rock samples were used to carry out the core flooding tests in order to evaluate the influence of the porous media properties on the performance of the ZL product in recovery factor enhancement. Results demonstrated that ZL can be used to control aggregation and deposition of asphaltenes as well as to modify rock wettability in order to increase the oil recovery factor. Finally, in order to explain how the chemical product enhances oil recovery, a mechanism involving oil production and rock wettability alteration is discussed.

Herein is presented a new methodology to determine the static adsorption of a zwitterionic surfactant on limestone in three different aqueous media [high-performance liquid chromatography (HPLC) water, seawater, and connate water] with the use of HPLC at room temperature and 70 °C. The results showed that, in both HPLC water and seawater, the surfactant adsorption followed a monolayer Langmuir tendency. In contrast, for connate water, the surfactant presented a new adsorption profile, characterized by two regions: (i) At surfactant concentrations below 1500 mg L(-1), an increase of adsorption is observed as the amount of divalent cations increases in the aqueous media. (ii) At surfactant concentrations above 1500 mg L(-1), the adsorption decreases because the equilibrium, monomer ⇆ micelle ⇆ vesicle, is shifted to the formation of vesicles, giving as a result a decrease in the concentration of monomers, thus reducing the interaction between the surfactant and the rock, and therefore, lower adsorption values were obtained. The behavior of the surfactant adsorption under different concentrations of divalent cations was well-described by the use of a new modified Langmuir model: (dΓ/dt)ads = k(ads)c(Γ∞ - Γ) - k(cmc)(c - c(cmc))(n)ΓH(c - c(cmc)). It was also observed that, as the temperature increases, the adsorption is reduced because of the exothermic nature of the adsorption processes.

The aim of the research presented herein was to develop novel multifunctional stabilizers of asphaltenes ( Asph ) for the control of fouling in different stages of petroleum industry. Novel stabilizers were obtained from the reaction between poly iso butenyl succinic anhydride ( PIBSA ), 2-(2-aminoethylamino)ethanol ( AEAE ) and an R-substituted aldehyde, resulting in three 2-R-(poly iso butylenesuccinimidyl)oxazolidines as prototypes of multifunctional Asph stabilizers, where R is –H ( P1 ), –C 5 H 11 ( P2 ) or – ortho (OH)C 6 H 4 ( P3 ). Compounds P1 - 3 were characterized by FTIR, 1 H, 13 C and 2D NMR spectroscopies, and assessed in four different types of evaluations: (i) Asph dispersion by UV–vis, (ii) displacement of Asph onset precipitation, at ambient conditions, (iii) inhibition of electric field induced deposition of Asph , and (iv) displacement of Asph onset precipitation, at reservoir conditions. All the latter individual efficiencies were included in a multifunctional development factor (MDF) resulted in 0.626 for P1 , 0.326 for P2 , and 0.679 for P3 , where the higher value corresponded to the highest efficiency. For comparison purposes, two commercial stabilizers of Asph were also evaluated, resulting in MDF of 0.012 and 0.162, being P1 - 3 clearly better multifunctional chemicals. Best novel prototype was selected for industrial evaluation by taking into account technical and economic criteria, thus P1 compound was chosen as active component of DAIM chemical and was successfully assessed at industrial scale in a production well of Petroleos Mexicanos (PEMEX) to control Asph fouling. The continuous injection of DAIM produced important benefits to the oil well productivity, such as the decrease of the frequency of cleaning operations from 11 to 4 in a one-year evaluation period and the reduction of production rate decay from −1.48 to −0.032 m 3 /day, ca. 46 times less in comparison when the well was operated without Asph stabilizer.

A new class of bis -di-organotin (IV) compounds were synthesized in good yields ( ca. 80%) by a one-step five molecules reaction in which intervene two molecular equivalents of leucine, one of 5,5′-methylene- bis -salicylaldehyde and either two of di- n -butyltin (IV) or diphenyltin (IV) oxides, that independently provided two bis -di-organotin derivatives. The structures of these two compounds were established by 1 H, 13 C and 119 Sn NMR, as well as by IR and elemental analysis. In both cases the 119 Sn chemical shifts are characteristic of pentacoordinated atoms in solution of non-coordinating solvent (CDCl 3 ). Once characterized, the novel compounds were tested as corrosion inhibitors at 25, 50 and 100 mg L −1 on mild steel surfaces in sour brine by linear polarization resistance and potentiodynamic curves. These experiments prove that these derivatives present top efficiencies of 54% and 68% for butyl and phenyl moieties, respectively. In addition, these two compounds were tested in vitro against Bacillus subtilis (Gram-positive, strain ATCC 6633), Escherichia coli (Gram-negative, strain DH5) and Pseudomonas fluorescens strains to assess their bactericidal activities, being more effective for the E. coli strain, at concentrations as low as 25 mg L −1 . Moreover, in order to correlate different activities and ascertain homologous action mechanisms, the two derivatives were tested for their asphaltene inhibition/dispersion activity. The results suggest that the presence of the four n -butyl moieties provide the needed amphiphillic balance to obtain better efficiencies in the tested activities.

Petroleum asphaltenes represent the most polar and heavy molecular fraction of crude oil; hence, it comprises a very complex and problematic mixture of molecules that tend to assemble in particles of micrometric size. These particles are difficult to be maintained as flocculations by the interaction with normal dispersants at low concentration values. Additionally, once these flocculations are formed, they can be destabilized, leading to deposition onto metallic and mineral surfaces. In this line, two phthalocyanines, tin (SnPc) and silicon (SiPc), were molecularly engineered, prepared, characterized, and assessed as stabilizers for petroleum asphaltenes. The stabilizing behavior of SnPc and SiPc was experimentally and theoretically determined through two contributions: (i) the inhibitive effect, related to the stabilization of already formed asphaltenes flocculations under the application of an electric field, and (ii) the dispersive effect, directly related to the ability of the molecules to prevent fur...

The solventless microwave-assisted synthesis of aldehydes (1a, 2b–h) and morpholine (3) in 1 : 2 (aldehyde : morpholine) ratio yielded eight 4,4′-dimorpholyl-methanes (4a–4h), which were thoroughly characterized through FT-IR, 1H, 13C and 2D NMR, confirming structures of type 4. The described compounds are dimorpholino-methane (4a), 2-(dimorpholinomethyl)-phenol (4b), 4-bromo-2-(dimorpholinomethyl)-phenol (4c), 2,4-di-tert-butyl-6-(dimorpholinomethyl)-phenol (4d), 4,4′-(pyridin-2-ylmethylene)-dimorpholine (4e), 4,4′-((4-iso-propylphenyl)methylene)-dimorpholine (4f), 4,4′-(naphthalen-1-ylmethylene)-dimorpholine (4g) and 4,4′-(pyren-1-ylmethylene)-dimorpholine (4h). Additionally, single crystal X-ray diffraction analysis for 4b, 4c, 4d and 4e derivatives was accomplished showing interesting geometrical features. The obtained 4,4′-dimorpholyl-methanes were subjected for two biological tests, (i) acute toxicity, related to Photobacterium phosphoreum (Vibrio fischeri), and (ii) biocidal activities, determined for B. subtilis, E. coli and Ps. fluorescence strains. The results show that 4a–h compounds have varying degrees of toxicity, classified as 4a, 4b, 4c, 4e and 4f as slightly to moderately toxic agents, 4g and 4h as highly toxic chemicals, and 4d as an extremely toxic compound. Besides, the biocidal activities, which is controlled mainly by the substituent directly bonded to the methinic bridge (named C5, which originally is the carbon atom of the aldehyde functionality), have shown varying degrees of inhibitory effects on the growth of selected strains, depending on the chemical structure of 4a–h. A QSAR study was developed, and quantum-chemical parameters of 4a–h were obtained with the DFT approach at the B3LYP/6-311G(d) level of theory in the gas phase. Hence ten molecular descriptors were determined, being EHOMO, ELUMO, GAP, C5 Mulliken atomic charge (ACMulliken), C5 atomic charge of NBO (ACNBO), dipolar moment (μ), molecular hydrophobicity as log P, molecular volume (Vol), electrostatic potential (ESP) and δ13C(C5), all of them being typical determinants of biological activities in other, different or related, molecular systems. A linear combination from three to six molecular descriptors was chosen as a multivariate model to achieve correlations in order to relate them to their acute toxicity and understand the obtained trend. Three sets of descriptors accomplished the statistical goal, and through an identity analysis the conserved descriptors in these three series are log P, the ESP and the δ13C(C5), which seemed to be the tracking variables in the system. To a lesser extent, the frontier orbitals and their relations (HOMO, LUMO and GAP) are also present within the correlations. The phenol-bearing structures (4b, 4c and 4d, derived from salicylidenes) are best tuned within these variables since the substitution in the phenol fragment both governs the toxicity and the biocidal potency. Finally, we can guarantee that the best candidates in this series are 4a, 4b and 4c, because diminished toxicity and preserved biocidal potency were obtained at the same time. A more hydrophobic substitution (4d) extremely increases the Vibrio fischeri toxicity, ruling out its application. Through the full analysis presented in this piece of work it can be stated that selected prototypes could be used in industrial facilities, particularly in the petroleum industry, as a new generation of ecological chemical products.

The synthesis of novel di-n-butyl [bis (alkyl-aminopropionic acid)]tin (IV) (alkyl = octyl, dodecyl, octadecyl) 2a-2c is reported. The complexes were characterized by 1H, 13C, 119Sn NMR, IR, MS and elemental analyses. For compound 2a the 119Sn NMR showed the presence of five signals suggesting the existence of a mixture of five hexa–coordinated species in equilibrium, two trans (I, II) and three cis (III, IV, V). In contrast, the compounds 2b and 2c present only unique hexa–coordinated specie.