Search

Background There has been an exponential increase in the demand for transcatheter aortic valve replacement (TAVR). Our goal was to examine trends in TAVR capacity and wait-times across Canada. Methods All TAVR cases were identified from April 1, 2014, to March 31, 2017. Wait-time was defined as the duration in days from the initial referral to the TAVR procedure. TAVR capacity was defined as the number of TAVR procedures per million population/province/fiscal year. We performed multivariable multilevel Cox proportional hazards modelling of the time to TAVR as the dependant variable and the effect of provinces as random effects. We quantified the variation in wait-times among provinces using the median hazard ratio. Results We identified a total of 4906 TAVR procedures across 9 provinces. Despite a year over year increase in overall capacity, there was a greater than 3-fold difference in capacity between provinces. Crude median wait-times increased over time in all provinces, with marked variation from 71.5 days in Newfoundland to 190.5 and 203 days in Manitoba and Alberta, respectively. This suggests increasing demand outpaced the growth in capacity. We found a median hazard ratio of 1.62, indicating that in half of the possible pairwise comparisons, the time to TAVR for identical patients was at least 62% longer between different provinces. Conclusion We found substantial geographic inequity in TAVR access. This calls for policy makers, clinicians, and administrators across Canada to address this inequity through revaluation of provincial funding mechanisms, as well as implementation of efficient care pathways.

Background Acute kidney injury (AKI) complicating primary percutaneous coronary intervention (PCI) is an independent predictor of short- and long-term outcomes in patients presenting with ST-elevation myocardial infarction (STEMI). Prior studies suggest a lower incidence of AKI in patients undergoing PCI through radial artery compared to femoral artery access; however, no randomized clinical trials have specifically investigated this question in patients presenting with STEMI. Methods To determine whether radial access (RA) is associated with a reduced frequency of AKI following primary PCI, we performed a substudy of the SAFARI-STEMI trial. The SAFARI-STEMI trial was an open-label, multicenter trial, which randomized patients presenting with STEMI to RA or femoral access (FA), between July 2011 and December 2018. The primary outcome of this post hoc analysis was the incidence of AKI, defined as an absolute (>0.5 mg/dL) or relative (>25%) increase in serum creatinine from baseline. Results In total 2,285 (99.3%) of the patients enrolled in SAFARI-STEMI were included in the analysis—1,132 RA and 1,153 FA. AKI occurred in 243 (21.5%) RA patients and 226 (19.6%) FA patients (RR: 0.91, 95% CI: 0.78-1.07, P = .27). An absolute increase in serum creatinine >0.5 mg/dL was seen in 49 (4.3%) radial and 52 (4.5%) femoral patients (RR: 1.04, 95% CI: 0.71-1.53, P = .83). AKI was lower in both groups when the KDIGO definition was applied (RA 11.9% vs FA 10.8%; RR: 0.90, 95% CI: 0.72-1.13, P = .38). Conclusions Among STEMI patients enrolled in the SAFARI-STEMI trial, there was no association between catheterization access site and AKI, irrespective of the definition applied. These results challenge the independent association between catheterization access site and AKI noted in prior investigations.

BACKGROUND The standard of care for patients with aortic stenosis has evolved significantly in recent years with transcatheter aortic valve implantation (TAVR) shown to be a safe alternative to surgical aortic valve replacement (SAVR). Concerns remain as to the durability of TAVR valves and factors that may affect that durability. The objective of this study was to look at valve performance using echocardiography to assess for early structural valve deterioration. METHODS AND RESULTS All patients undergoing successful TAVR implantation between 2010 and 2018 were included in the study. Standard follow-up echocardiograms were performed before the procedure in addition to immediately post procedure and at: 6 weeks, 6 months, 1 year, and every year subsequently. Structural valve deterioration or failure was defined as a mean aortic valve gradient of >20mmHg after implantation. Using this approach, we divided patients into 2 groups: no evidence of valve deterioration versus any evidence of valve deterioration by ECHO. A total of 406 patients were included with balloon expandable (n=335) and self-expandable valves (n=57). Valve deterioration defined as a mean gradient >20mmHg was observed in 82 patients at any point during follow-up. Risk factors associated with valve deterioration were increased BMI (p=0.004), previous prosthetic valve (p=0.0001), older age (p=0.02), and female sex (p=0.02). Valves that developed mean gradients over 20mmHg were more likely to have had higher pre-TAVR gradients (p=0.007). Failure rates were low early after procedure (8% of patients). The relative failure rate increased to 24% of patients by year three. In patients showing gradients >20mmHg gradients appears to gradually increase as shown in the figure below. Even though there is variance in the initial year among valves (p=0.53), at two years and every year subsequently, there is no significant difference in valve gradient between self-expanding and balloon-expanding valves. CONCLUSION Our data demonstrates that TAVR valves provide a significant reduction in mean gradient across the aortic valve after deployment. Using follow-up echocardiography, we were able to demonstrate that some patients develop increasing mean gradients over time with up to 24% of patients by 3-year follow-up having some early structural valve deterioration. We identified several factors that were associated with higher gradients at follow-up and may warrant closer follow-up.

BACKGROUND Transcatheter aortic valve replacement (TAVR) has become an established treatment for patients suffering with aortic stenosis. However, there remains some uncertainty on the risk factors associated with TAVR and conduction disturbances requiring permanent pacemaker insertion (PPI) following the procedure. The aim of this study was to identify risk factors for post-TAVR pacemaker need and examine the effect of PPI on long-term outcomes. METHODS AND RESULTS A retrospective study was performed on all consecutive patients who underwent TAVR at the Saint John Regional Hospital between 2010-2018, excluding those with an existing pacemaker. Risk factors capable of independently predicting post-procedure PPI were identified using two-tailed t-test, χ-square test, and hierarchical logistic regression model. Kaplan-Meier survival analysis was performed to compare all-cause mortality between patients who did or did not receive a pacemaker. A total of 377 patients with no previous pacemaker were included in the study. A total of 42 (11.1%) required PPI post-TAVR and were compared to patients who did not. Univariate analysis suggested that larger valves (>29cm) (p=0.05), renal insufficiency (p=0.03), and ECG abnormalities (p 200ms (p=0.0003), and heart rate CONCLUSION Our study illustrates that permanent pacemaker use in TAVR remains high (>10%) and identifies several ECG abnormalities as the most robust predictors of pacemaker need post-TAVR, in particular RBBB. However, our limited study suggests that post-TAVR pacemaker insertion is not associated with all-cause mortality after discharge. As TAVR becomes a treatment option for lower surgical risk patients, considerations for the need for post-procedural pacemaker insertion may affect clinical decision making and warrant screening for conduction abnormalities in patients undergoing TAVR.

Importance Among patients with ST-segment elevation myocardial infarction (STEMI) referred for primary percutaneous coronary intervention (PCI), a survival benefit associated with radial access compared with femoral access remains controversial. Objective To assess whether there is a survival benefit when radial access is used instead of femoral access among patients with STEMI referred for primary PCI. Design, Setting, and Participants This multicenter, open-label, randomized clinical trial was conducted at 5 PCI centers in Canada. In total, 2292 patients with STEMI referred for primary PCI were enrolled between July 2011 and December 2018, with a 30-day follow-up. The primary analyses were conducted based on the intention-to-treat population. Interventions Patients were randomized to radial access (n = 1136) or to femoral access (n = 1156) for PCI. Main Outcomes and Measures Initially, the primary outcome was bleeding, but this outcome was modified to 30-day all-cause mortality following the recommendation of the granting agency. Secondary outcomes included recurrent myocardial infarction, stroke, and Thrombolysis in Myocardial Infarction–defined major or minor bleeding. Results Among the 2292 patients enrolled, the mean (SD) age of the patients randomized to radial access was 61.6 (12.3) years and to femoral access was 62.0 (12.1) years, with 883 male patients in the radial access and 901 male patients in the femoral access group. The trial was stopped early following a futility analysis. Primary PCI was performed in 1082 of 1136 patients (95.2%) in the radial access group and 1109 of 1156 patients (95.9%) in the femoral access group. Bivalirudin was administered to 1001 patients (88.1%) in the radial access group and to 1068 patients (92.4%) in the femoral access group, whereas glycoprotein IIb/IIIa inhibitors were administered in only 69 patients (6.1%) in the radial access group and 68 patients (5.9%) in the femoral access group. A vascular closure device was used in 789 patients (68.3%) in the femoral group. The primary outcome, 30-day all-cause mortality, occurred in 17 patients (1.5%) assigned to radial access and in 15 patients (1.3%) assigned to femoral access (relative risk [RR], 1.15; 95% CI, 0.58-2.30;P = .69). There were no significant differences between patients assigned to radial and femoral access in the rates of reinfarction (1.8% vs 1.6%; RR, 1.07; 95% CI, 0.57-2.00;P = .83), stroke (1.0% vs 0.4%; RR, 2.24; 95% CI, 0.78-6.42;P = .12), and bleeding (1.4% vs 2.0%; RR, 0.71; 95% CI, 0.38-1.33;P = .28). Conclusions and Relevance No significant differences were found for survival or other clinical end points at 30 days after the use of radial access vs femoral access in patients with STEMI referred for primary PCI. However, small absolute differences in end points cannot be definitively refuted given the premature termination of the trial. Trial Registration ClinicalTrials.gov identifier:NCT01398254

Cardiovascular disease encompasses coronary artery disease and valvular heart disease, and the prevalence of both increases with age. Over the past decade, the landscape of interventional cardiology has evolved to encompass a new set of percutaneous procedures outside the coronary tree, including transcatheter aortic valve implantation, transcatheter mitral valve repair, and left atrial appendage occlusion. These interventions have sparked a new discipline within interventional cardiology referred to as structural heart disease (SHD) intervention. The access to and numbers of such procedures performed in Canada is currently unknown. This "first of its kind" survey of structural interventions provides insight into the landscape of SHD intervention in Canada and the challenges faced by cardiologists to deliver this important care.

Studies were performed in Hep3B hepatocytes to better elucidate the mechanisms regulating circulating levels of human group-specific component (Gc). We measured changes in Gc messenger RNA (mRNA) synthesis and levels of secreted protein resulting from treatment of hepatocytes with cytokines and hormones known to influence synthesis of other proteins of hepatic origin. We particularly focused on compounds known to be prototypic stimulants during the acute phase response. Interleukin-6 (IL-6) and dexamethasone were shown to increase Gc mRNA approximately twofold while transforming growth factor beta (TGF beta) decreased Gc mRNA in a dose-dependent fashion by up to fivefold. The effects on secreted Gc protein levels were similar. These results indicate that Gc protein appears to be regulated differently than the other members of this gene family, albumin and alpha-fetoprotein (AFP), which are negative acute phase reactants. In addition, these contrasting effects on Gc synthesis of IL-6 and dexamethasone and of TGF beta suggest that high basal levels of Gc synthesis may be maintained during the acute phase response.

s S9 followed by Erie St. Clair LHIN at 20.4%, while STEMI patients in the Toronto Central LHIN hospitals had the lowest percentage of fibrinolysis therapy at 0.5%. CONCLUSION: The analysis identified variation in the use of fibrinolysis therapy across Ontario hospitals. Specific quality improvement strategies will be deployed to ensure that CCN continues to monitor the use of fibrinolysis therapy across Ontario, recognizing that this remains a key treatment strategy for STEMI patients who may not have immediate access to primary PCI due to geography or other reasons. 016 METHOD OF PRESENTATION TO HEALTHCARE SYSTEM SIGNIFICANTLY AFFECTS TIMES TO TREATMENT OF STEMI PATIENTS: NEW BRUNSWICK EXPERIENCE AS White, A Hassan, V Paddock, S Lutchmedial Saint John, New Brunswick BACKGROUND: Having Emergency Medical Services (EMS) involved in the management of STEMI patients prior to their arrival to the emergency room (ER) has been shown to improve time to treatment goals as compared to patients who are walk-ins to the ER. We report the New Brunswick experience with these two modes of presentation and their effects on time to treatment in STEMI patients. METHODS/RESULTS: All patients with a confirmed diagnosis of STEMI who received thrombolysis and possessed data regarding mode of presentation in the New Brunswick Heart Centre STEMI database between December 31, 2010 and June 29, 2013 were included. A total of 643 patients met the inclusion criteria. Patients presented directly to ER (walk-in) in 51.3% of cases (n1⁄4330), while 48.7% (n1⁄4313) of patients presented via EMS. Table 1 summarizes door to EKG (D2EKG), EKG to needle (EKG2N) and door to needle (D2N) times in minutes for both walk-in ad EMS patients. Shorter D2EKG and D2N times were noted among EMS patients. Furthermore, presentation via EMS as compared to walk-in was associated with significantly higher rates of D2EKG within the guidelines recommended goal of 10 min. (67.1% vs. 44.8%; p value

Studies were performed in Hep3B hepatocytes to better elucidate the mechanisms regulating circulating levels of human group-specific component (Gc). We measured changes in Gc messenger RNA (mRNA) synthesis and levels of secreted protein resulting from treatment of hepatocytes with cytokines and hormones known to influence synthesis of other proteins of hepatic origin. We particularly focused on compounds known to be prototypic stimulants during the acute phase response. Interleukin-6 (IL-6) and dexamethasone were shown to increase Gc mRNA approximately twofold while transforming growth factor beta (TGF beta) decreased Gc mRNA in a dose-dependent fashion by up to fivefold. The effects on secreted Gc protein levels were similar. These results indicate that Gc protein appears to be regulated differently than the other members of this gene family, albumin and alpha-fetoprotein (AFP), which are negative acute phase reactants. In addition, these contrasting effects on Gc synthesis of IL-6 and dexamethasone and of TGF beta suggest that high basal levels of Gc synthesis may be maintained during the acute phase response.

We have utilized enzyme-linked immunosorbent assay (ELISA) to quantitate PCR-amplified DNA. This method was used to measure mRNA for the vitamin D-binding protein (Gc), beta-actin and the transferrin receptor (TR) gene in the Hep3B cell line. Total RNA from Hep3B cells was reverse transcribed to obtain cDNA, which was amplified in the presence of digoxigenin-dUTP by PCR. The PCR products were then hybridized in liquid phase to a biotinylated, nested capture probe for the respective sequences. The hybridized products were bound to a streptavidin-coated ELISA plate and were detected by an alkaline-phosphatase-conjugated antibody to digoxigenin. ELISA standard curves for Gc and control genes, beta-actin and TR, were obtained after PCR amplification of serial dilutions of Hep3B total RNA. As an external standard, an ELISA standard curve for Gc was obtained after PCR amplification of serial dilutions of a full-length Gc cDNA insert obtained from a recombinant plasmid. Thus, we were able to develop a non-isotopic quantitation assay for PCR-amplified DNA that is highly sensitive and has the specificity of hybridization-based methods.

Publisher Summary Colony hybridization has been carried out using several types of supports. Nylon membranes are the most durable with regard to resistance to damage and repetitive use but are also the most expensive and require many steps similar to those required for nitrocellulose. Nylon membranes from different manufacturers require different treatments and the instructions of the manufacturer must be followed closely for optimal results. In comparison to other hybridization supports, several steps—such as baking in a vacuum oven, prehybridization, and some probe purification steps—can be eliminated by using the labeling procedure described in the chapter. Signals for a perfect match are about l0 to 20 times stronger than those for a singlebase internal mismatch.

A displacement synthesis procedure was used to construct symmetrical recombinant cDNAs. A double-stranded cDNA containing a hairpin loop was extended by the addition of a homopolymer to the 3′ end. This was followed by displacement, or “third strand” synthesis that was primed by an oligonucleotide hybridized to the homopolymer. Ideally, the product should be a DNA containing an inverted repeat with twofold rotational symmetry about nonsymmetrical sequences representing the hairpin loop in the original double-stranded cDNA. Duck globin cDNAs were synthesized by the displacement mode of construction and cloned in pBR322. An α-globin recombinant, pDGPα-2, was isolated and sequenced. This recombinant was found to have two 3′ half regions (mRNA sequence sense) inverted about a nonsymmetrical 5′ half region and an adjacent oligo(dGṡdC) homopolymer. The sequence arrangement indicates that the cDNA folded back on itself, forming a large loop, to prime synthesis of a second strand. We propose that the internal oligo(dGṡ dC) arose through dynamic shifts in cDNA intrastrand structure during the course of synthesis.

We have examined a cDNA displacement synthesis procedure in which the extent of precursor incorporation and the unusual kinetics of displacement synthesis suggest a unique replicative form of DNA and the occurrence of multiple rounds of displacement synthesis, leading to amplification of mRNA sequences. Globin double-stranded DNA containing a hairpin loop was extended by the addition of a homopolymer to the 3′ end. This was followed by displacement synthesis with the Klenow fragment of DNA polymerase I that was primed by an oligonucleotide hybridized to the homopolymer. Thus, the hairpin cDNA was copied to form an open duplex with an inverted repetition of globin sequences. These molecules can then serve as templates for additional synthesis which would be primed from oligomers bound the homopolymer. Globin cDNA sequences appear to be amplified 10-fold or more by this procedure. Globin cDNA obtained by displacement synthesis was similar in size to the original template. However, displaced molecules associate to the extent that they are not readily resolved by electrophoresis or sedimentation under nondenaturing conditions. Restriction endonuclease digests of 32 P-labeled displaced strands gave fragment patterns similar to rabbit globin cDNA hairpin molecules. S 1 nuclease studies demonstrated that displaced complexes and replication intermediates are partially single stranded, which might account for their aggregation properties.

The nucleotide sequences of species I RNA coded for by bacteriophages T2 and T6 have been analyzed using 32-P-labeled material from T2 and T6-infected cultures of Escherichia coli. The T1 and pancreatic ribonuclease digestion products were partially analyzed and the results were compared with nucleotide sequences from T4 species I RNA to obtain a minimum estimate of the number of nucleotide sequence differences among the three species I RNAs. Analysis of fragments obtained by digestion with epsilon-carboxymethyl-lysine-41-pancreatic ribonuclease and with E. coli Q13 S30 crude extract was also performed to provide some additional confirmation for the nucleotide sequences that were derived for the T2 and T6 species I RNAs. T2 species I RNA was found to be different at three positions in the nucleotide sequence, and unlike T4 species I RNA, contained in addition the modified nucleotide, psi, in a region where the proposed secondary structure is identical to the TpsiC-loop of a tRNA. T6 species I RNA was found to contain nucleotide differences from the T4 species I RNA sequence at four positions. The U at position 119 in the sequence appears to be modified to psi only to a small extent. While a biological function for species I RNA is unknown, the fact that there is over 97% homology in the sequences suggests strong evolutionary pressures to retain the nucleotide sequence in the T-even genomes.

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as a template for in vitro synthesis of 32P-labeled RNA and deoxysubstituted RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. In addition, the 3' nearest neighbor was determined for several fragments resulting from digestion with T1 ribonuclease. The utility of the deoxysubstitution technique was demonstrated by the ease with which the sequences of pyrimidine-rich fragments could be determined. Many sequences thus determined were long enough to fit uniquely with the alpha- or beta-globin amino acid sequences. The positions of these fits were found to be clustered, leading us to believe that only certain regions of the complementary DNA are transcribed by Escherichia coli RNA polymerase. Other unique characteristics of RNA synthesis from a complementary DNA template include a high yield of free poly(A) and the fact that one must use low rather than high salt buffers to obtain transcripts of high molecular weight.

Rabbit alpha globin gene copies have been made, using reverse transcriptase and DNA polymerase I, and cloned in bacterial plasmids. Plasmid pHb72 has been shown to contain the alpha gene sequence by restriction enzyme analysis and nucleotide sequencing studies, and therefore has been approved for propagation under P2 plus EK1 conditions by the National REcombinant DNA Committee.

Double-stranded ovalbumin DNA was amplified and purified by the cloning of bacterial transformants. The double-stranded DNA was synthesized from a complete complementary DNA transcript of ovalbumin mRNA using Escherichia coli DNA polymerase I and the self-priming ability of the initial transcript. After S. nuclease treatment, poly(dA) was added to the 3‘ termini with terminal deoxynucleotidyltransferase and the ovalbumin gene was hybridized to a linear plasmid DNA, pMB9, containing 3‘-poly(dT) termini. This hybrid molecule was used to transform the E. coli strain X1849. The cloned transformants contained from 30 to 53% of the complete ovalbumin DNA as determined by hybridization with full length cDNA. The length of the inserts was confirmed by treatment of the isolated plasmids with the restriction enzyme Hha I. Separation of the fragments by agarose gel electrophoresis showed that the amount of inserted DNA in clones tested varied from 680 to 1090 base pairs.

This study examined the effect of two widely used iron treatments on methyldopa absorption, metabolism, and blood pressure control. A 500 mg tablet of methyldopa (2.37 mmol) was taken with and without ferrous sulfate (325 mg) by 12 normal subjects in a randomized crossover trial. When ferrous sulfate was taken with methyldopa there was a decrease in the proportion of methyldopa excreted as "free" methyldopa (49.5% +/- 12.4% vs 21.1% +/- 4.77%; p less than 0.01), a significant increase in the proportion excreted as methyldopa sulfate (37.8% +/- 12.3% vs 65.8% +/- 10.5%; p less than 0.01), and a decrease in the percentage of methyldopa absorbed (29.1% +/- 12.5% vs 7.88% +/- 4.14%; p less than 0.01). These factors resulted in an 88% reduction in the quantity of "free" methyldopa excreted. To determine if an iron preparation without sulfate produced the same effect, the study was repeated with ferrous gluconate (600 mg) with similar results. The clinical consequences of the methyldopa-ferrous sulfate interaction was determined in five hypertensive subjects receiving chronic methyldopa therapy. The subjects took ferrous sulfate for 2 weeks. There was an increase in both systolic and diastolic blood pressure in four patients and a decrease in blood pressure in all patients after ferrous sulfate was discontinued. The increases in blood pressure were substantial in three of the patients.

A 169-nucleotide region from the rabbit beta globin gene has been sequenced by analysis of complementary DNA's cloned in bacterial plasmids. Comparison of these sequences with those established for this gene by other techniques provides evidence of a high degree of fidelity and allows the unambiguous establishment that these plasmids do not contain harmful sequences.

Publisher Summary This chapter presents immunochemical and physical–chemical evidence for the presence of thymosin alpha1-peptide in dialyzable leukocyte extracts (DLE). In a study described in the chapter, the collective results obtained from immunologic and physical–chemical evaluations of the E-receptor regeneration promoting activity present in human DLE indicate that it is partly because of the presence of thymosin α1 peptide in DLE. There are, however, additional components in DLE that express a similar activity but do not seen to be intact thymosin α1. Included here might be thymic humoral factor, which has a pi of 5.7 and could be responsible for the activity found in the β region when DLE Sephadex G-25 Fraction IV was fractionated by IEP in a 2.5 to 10 gradient.The documentation of the presence of a variety of T-lymphocyte maturation or differentiation factors in DLE explains why DLE may have nonspecific beneficial effects when it is employed as an immunotherapeutic agent.

Complementary DNA transcribed in vitro from purified rabbit globin messenger RNA and made double-stranded has been inserted into E. coli plasmid pSC 101 by the poly-dT/poly-dA “tailing” and annealing technique. E. coli transformants given by this DNA preparation have been shown to contain globin sequences by the hybridization of globin RNA to DNA from clones grown and lysed in situ on nitrocellulose filters. Some measure of the amount and identity of inserted globin sequences has been determined by fingerprinting fragments of 32p-labeled globin RNA hybridized to the purified plasmid chimeras.

Nucleotide sequence data for the duck alpha D globin gene indicate an extremely short 3′ untranslated region of only 49 nucleotides. Evolutionarily conserved sequences defined short regions of potential functional significance. Comparisons among sequences for duck and chicken alpha globins indicate that this region has importance in the regulation of globin gene expression.

Publisher Summary This chapter discusses the form(s) of transfer factor (TF) that are released by viable leukocytes from tuberculin responsive human donors when their leukocytes are incubated with PPD in vitro . Data obtained from studying this antigen-liberated (or released) has provided further insight into the roles of TF–H5, TF–H7, and dephosphorylated TF–H5 in the induction of antigen specific responsiveness. The chapter concludes that when immune lymphocytes are incubated with specific antigen they release only dephosphorylated TF–H5. Dephosphorylated TP–H5 is apparently derived from the cell surface (or secreted after it is derived from TF–H5) and also is apparently released nonspecifically by lymphocytes incubated for prolonged periods at 37°C as part of a normal turnover process of cellular membrane constituents. It is speculated, however, that cell-free supernatants derived from lymphocytes merely incubated at 37°C for 4 h without specific antigen added would contain a family of TFs representing the range of antigen sensitivities found in the donor.

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32 P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T 1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants.

Double-stranded ovalbumin DNA was amplified and purified by the cloning of bacterial transformants. The double-stranded DNA was synthesized from a complete complementary DNA transcript of ovalbumin mRNA using Escherichia coli DNA polymerase I and the self-priming ability of the initial transcript. After S. nuclease treatment, poly(dA) was added to the 3' termini with terminal deoxynucleotidyltransferase and the ovalbumin gene was hybridized to a linear plasmid DNA, pMB9, containing 3'-poly(dT) termini. This hybrid molecule was used to transform the E. coli strain X1849. The cloned transformants contained from 30 to 53% of the complete ovalbumin DNA as determined by hybridization with full length cDNA. The length of the inserts was confirmed by treatment of the isolated plasmids with the restriction enzyme Hha I. Separation of the fragments by agarose gel electrophoresis showed that the amount of inserted DNA in clones tested varied from 680 to 1090 base pairs.

Bovine transfer factor (TF)--active in initiating specific responsiveness in human thymus-derived (T) lymphocytes to purified protein derivative from Mycobacterium tuberculosis (PPD) in vitro--was partially purified from the dialyzable portion of medium from immune lymph node cells (DLNE). Its physiochemical properties and structure were determined by methods previously employed to characterize human PPD-specific TF isolated from dialyzable leukocyte extracts (DLE). Bovine TF had a molecular weight (MW) of 1100-3000, was destroyed by heating at 56 or 80 degrees C for 30 min, was soluble in water but not in phenol or ether, and could be precipitated with ethanol. Bovine TF activity eluted as a single peak after high-pressure reverse-phase liquid chromatography (HPLC); the active moiety contained at least one free co-planar cis-diol group, as shown by boronate affinity chromatography. Additional structural features were deduced by evaluating TF activity after incubation with various endonucleases, exonucleases, and peptidases, a phosphatase, and a protease. The combined results indicate that bovine TF specific for PPD is an oligoribonucleopeptide. A simplest case molecular model was constructed on the basis of the data obtained. A comparative evaluation of the physicochemical properties and structural features of bovine TF and human TF specific for PPD indicated striking similarities and some differences.

In studies of the effects of changes in mRNA structure and sequence on the initiation of protein synthesis, we used a generally applicable approach to transcribe reconstructed genes for duck alpha A globin by the bacteriophage SP6 RNA polymerase promoter in a pGEM-2 plasmid vector. The genes were reconstructed such that the first nucleotide to be transcribed, the 5' adenosine, was placed directly adjacent to the SP6 promoter sequence. The 3' ends of the genes were constructed such that cleavage with Ssp 1 endonuclease yielded a template that directed the synthesis of mRNA terminating in a poly A tail containing 56 adenosines and a single 3' uridine. Special conditions using a Mn++ buffer were developed to enable the SP6 RNA polymerase to initiate at the 5' adenosine and synthesize the A-start transcription product. The mRNA could be capped and was subsequently used as an effective template for in vitro translation and synthesis of duck alpha A globin.

Human transfer factors (TF) active in specifically inducing responsiveness in human thymus-derived (T) lymphocytes previously nonresponsive to purified protein derivative from Myobacterium tuberculosis (PPD) or to Coccidioides immites (Cocci) in vitro were isolated from the dialyzable portion of extracts of immune leukocytes (DLE). Each TF segregated into two active fractions after high-pressure reverse-phase liquid chromatography (HPLC), suggesting the presence of two TF components in DLE for each antigen specificity. Determination of the structures of both TF components specific for PPD was accomplished by evaluating their activity after incubation with various endonucleases, exonucleases, phosphatases, peptidases and a protease. The results indicated that both PPD-specific TF components are oligoribonucleopeptides but that they are structurally distinct. Simplest-case molecular models were constructed on the basis of the data obtained.

We have examined alternative approaches to existing methods for synthesizing complementary DNA suitable for molecular cloning. One model of construction is presented in which ribonucleotides are added to the 3′ end of complementary DNA prior to synthesis of the second DNA strand. The hairpin structure at one end of the molecule is then opened by treatment with RNaase or alkali. This method would eliminate the normal requirement for single-strand specific nucleases and thus shows promise as a means for preserving the 5′ end sequences of mRNA in recombinant complementary DNA studies. Another technique for constructing complementary DNA is proposed in which no cleavage step is required. Instead, a hairpin, double-stranded DNA is extended with a homopolymer at the 3′ end, and displacement or “third-strand” synthesis by the Klenow fragment of DNA polymerase I is primed by an oligonucleotide hybridized to the homopolymer. The end result should be an inverted repeat with two-fold rotational symmetry. The mRNA 5′ end sequences represent the center of symmetry. Cloned, symmetrical DNA should facilitate subsequent nucleotide sequence analysis. Furthermore, the symmetrical molecule may serve as an intermediate in continued DNA synthesis provided the homopolymer chain is sufficiently longer than the primer, thus leading to mRNA sequence amplification in vitro . Alternative options with attendant advantages and disadvantages are given at each stage in the construction schemes. These strategies, along with established procedures, offer a repertoire from which researchers may select in order to fill their specific needs.

Complementary DNA, transcribed in vitro from purified rabbit globin messenger RNA and made double-stranded, has been inserted into Escherichia coli plasmids pSC101 and pMB9 by the poly(dT)/poly(dA) "tailing" and annealing technique. E. coli transformants given by this DNA preparation have been shown to contain globin sequences by the hybridization of globin RNA to DNA from clones grown and lysed in situ on nitrocellulose filters. An estimate of the amount of inserted globin sequences has been provided by fingerprint analysis of globin mRNA sequences hybridized to the purified plasmid chimeras. Inserted sequences so far subjected to detailed analysis have been ascribed to the rabbit beta globin chain. The susceptibility of inserted beta globin, sequences to the restriction endonuclease EcoRI confirms the existence of a site already found through previous nucleotide sequence analysis.

The nucleotide sequences of species I RNA coded for by bacteriophages T2 and T6 have been analyzed using 32-P-labeled material from T2 and T6-infected cultures of Escherichia coli. The T1 and pancreatic ribonuclease digestion products were partially analyzed and the results were compared with nucleotide sequences from T4 species I RNA to obtain a minimum estimate of the number of nucleotide sequence differences among the three species I RNAs. Analysis of fragments obtained by digestion with epsilon-carboxymethyl-lysine-41-pancreatic ribonuclease and with E. coli Q13 S30 crude extract was also performed to provide some additional confirmation for the nucleotide sequences that were derived for the T2 and T6 species I RNAs. T2 species I RNA was found to be different at three positions in the nucleotide sequence, and unlike T4 species I RNA, contained in addition the modified nucleotide, psi, in a region where the proposed secondary structure is identical to the TpsiC-loop of a tRNA. T6 species I RNA was found to contain nucleotide differences from the T4 species I RNA sequence at four positions. The U at position 119 in the sequence appears to be modified to psi only to a small extent. While a biological function for species I RNA is unknown, the fact that there is over 97% homology in the sequences suggests strong evolutionary pressures to retain the nucleotide sequence in the T-even genomes.

Publisher Summary The dialyzable leukocyte extracts (DLE) prepared from burros immunized with either Mycobacterium tuberculosis (PPD–S) or Coccidioides immitis (spherulin) antigen can transfer antigen-specific cell-mediated immunity (CMI) to previously nonresponsive human lymphocytes in vitro. The results of experiments described in this chapter indicate that when Burros are immunized with either Mycobacterium tuberculosis antigen or Coccidioides immitis antigen, DLE subsequently prepared from their PBL contains TF activity, which is active in inducing antigen-specific responsiveness in previously nonimmune human lymphocytes. Burro TF activity easily can be detected using the LMI assay, the in vitro assay for human TF activity. Characterization of Burro TP specific for PPD–S indicates that it has physical–chemical properties similar to those of human TF derived from DLE.

Deoxynucleotides have been incorporated into RNA synthesized in vitro by RNA polymerase with either double-stranded or single-stranded DNA as a template. By use of this technique to block or promote cleavage at a particular phosphodiester bond, a variety of specific cleavages may be obtained with the available ribonucleases and deoxyribonuclease I. These methods should greatly increase the ease and rapidity of nucleotide sequence determinations.

We have isolated two allelic duck-genomic DNA fragments containing beta-type globin genes. The beta- and epsilon-globin genes are 1800 bp apart in both fragments, have second introns of 1100 and 1200 bp, respectively, and small first introns. We have also determined approx. 550 nucleotides of the sequence on the 5' side of the beta-globin gene. Comparison with the chicken beta-globin gene suggests sequences of possible significance to gene expression.

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as a template for in vitro synthesis of 32P-labeled RNA and deoxysubstituted RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. In addition, the 3' nearest neighbor was determined for several fragments resulting from digestion with T1 ribonuclease. The utility of the deoxysubstitution technique was demonstrated by the ease with which the sequences of pyrimidine-rich fragments could be determined. Many sequences thus determined were long enough to fit uniquely with the alpha- or beta-globin amino acid sequences. The positions of these fits were found to be clustered, leading us to believe that only certain regions of the complementary DNA are transcribed by Escherichia coli RNA polymerase. Other unique characteristics of RNA synthesis from a complementary DNA template include a high yield of free poly(A) and the fact that one must use low rather than high salt buffers to obtain transcripts of high molecular weight.

The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N. (1972) J. Mol. Biol. 71, 547-556). The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH. Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate. The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA. The molecule is specifically cleaved by an E. coli nuclease into three segments by cleavage at a double-stranded region in the molecule. The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J. (1975) J. Biol. Chem. 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution. The position of a mutation within species I RNA has been determined. This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present.

Nucleotide sequence analysis of a recombinant cDNA for a duck alpha-globin gene indicates a gene with novel features and evolutionary history. The duck alpha-globin double-stranded cDNA, treated with S1 nuclease and tailed with poly(dC), was inserted into the PstI restriction endonuclease site of pBR322 tailed with poly(dG). Nucleotide sequence analysis of the resulting recombinant cDNA indicates that it contains the translated region and all of the 3′ untranslated region for an alpha-globin gene. The sequence was determined by procedures designed especially for rapid analysis of pBR322 (PstI site) recombinant cDNAs. This duck globin has sequences related to the chicken alpha-A globin in some regions but in other regions it is more closely related to another alpha globin found in anemic chickens.

Nucleotide sequence analysis and restriction endonuclease mapping have been used to characterize a cDNA copy of immunoglobulin MOPC 21 Kappa mRNA clones in the bacterial plasmid pMB9. Three regions of the inserted cDNA of plasmid pL21-1 have been sequenced and match the known protein sequence at amino acid residues 1-24, 128-138 and 171-179. With these sequences to provide absolute correlations between the restriction map and the structural gene sequence it has been possible to exactly deduce the positions of all 11 of the insert restriction sites mapped within the structural gene. The pL21-1 insert contains the complete variable and constant regions as well as parts of the 3' untranslated and polypeptide leader coding sequences.