Search

Background and Aims: Scrub typhus is an endemic disease in the fall season that occurs in a limited number of places known as the Tsutsugamushi Triangle. Peripheral neuropathy is a common complication of scrub typhus. Herein, we encountered several patients with ascending paralysis after scrub typhus infection, who were diagnosed with Guillain‐Barré syndrome (GBS). We aimed to investigate the clinical and laboratory characteristics of patients who developed GBS after scrub typhus. Methods: Patients were retrospectively recruited from six nationwide tertiary centers in South Korea from January 2017 to December 2021. Patients who had been clinically diagnosed with GBS and confirmed to have scrub typhus via laboratory examination and/or the presence of an eschar before the onset of acute limb paralysis were included. The GBS‐associated clinical and electrophysiological characteristics, outcomes, and scrub typhus‐associated features were collected. Results: Of the seven enrolled patients, six were female and one was male. The median time from scrub typhus infection to the onset of limb weakness was 6 (range: 2–14) days. All patients had eschar on their bodies. Four patients (57.1%) were admitted to the intensive care unit and received artificial ventilation for respiratory distress. At 6 months, the median GBS disability score was 2 (range, 1–4) points. Interpretation: Patients with scrub typhus‐associated GBS have a severe clinical presentation and require intensive treatment with additional immunotherapies. Therefore, GBS should be included in the differential diagnosis when peripheral neuropathies develop during scrub typhus treatment. Notably, scrub typhus is associated to GBS. [ABSTRACT FROM AUTHOR]

Objectives: To study the clinical profile and factors affecting the duration of hospital stay in scrub typhus patients. Materials and Methods: This retrospective study was conducted at a tertiary care hospital situated close to the forest and foothill areas of Tamil Nadu. Patients aged 18 years and above, and diagnosed with scrub typhus were included in the study. Demographics, comorbidities, clinical features of patients, duration of illness, time of antibiotic initiation, and biochemical parameters were recorded for analysis. Mann-Whitney U test and chi-square tests were used to assess the association between various parameters. P-value<0.05 was considered statistically significant. Results: Among 143 scrub typhus patients' records included, 65% (n=93) were from rural areas. All the patients survived and were discharged from the hospital. Fever (98.6%, n=141) and breathlessness (38.5%, n=55) were the most common presentations, along with thrombocytopenia (65.7%, n=94) and pneumonia (30.8%, n=44). Eighty-seven patients were hospitalized for <5 days. The initiation of antibiotics within 24 hours of admission was significantly associated with the duration of illness (X²=4.571, p=0.033), but not with the duration of hospitalization (X²=1.017, p=0.313). Breathlessness (p=0.000), loose stools (p=0.035), comorbid hypertension (p=0.021), and pneumonia (p=0.000) significantly influenced the length of hospitalization. Conclusion: In this study, the time of antibiotic initiation did not influence the clinical outcome in terms of the duration of hospitalization, however, comorbid hypertension and pneumonia did affect the duration of hospitalization significantly. More prospective studies need to be conducted for a generalizable result. [ABSTRACT FROM AUTHOR]

Research’s subject The research’s subject includes fundamental principles and procedures for taking preventive activities against infections. Although such a holistic solution is the domain of contemporary times, the legal solutions introduced during the current Covid pandemic were created on the basis of legislature and solutions first introduced over 100 years ago as a result of the typhus epidemic. The legislators of those times already noticed the necessity to take anti-epidemic, and preventive measures in order to neutralize the sources of infections, and cut down the spread route. The study presents solutions introduced during the typhus epidemic occurring on the Polish territories (Central Europe) in the years between 1918 and 1924. Archival epidemiological data along with taken steps and measures (including the establishment of special state institutions) are presented showing how the epidemic of those times provided the fundament for preventing epidemics on the Polish territory. Research’s aim The purpose of the research is to present, in a chronological manner, the formation of systemic solutions for combating the epidemic of typhus, which broke out in the resurgent Polish lands at the end of WWI. Material and method Presented data are based on documents and archival materials, which include registers of typhus patients from general hospitals between 1918 and1924, information from the Central Military Archives, information obtained from historical sources including medical journals of that period, as well as information from the national archives and the Central Statistical Office. These data were analyzed and presented. Results The manuscript presents data on incidence and mortality. It also consists of a step-by-step analysis of introduced preventive measures along with the problems that were caused by their enforcement, including social distrust and resistance. Conclusions Enacted institutions, including the Polish Institute of Hygiene, allowed for greater monitoring of public health. The typhus experience facilitated the development of hospital networks and provided medical care to society. What is more, because of an urgent need to educate medical staff, the training of doctors, nurses, and other medical professionals was launched in 1921 as the first in Europe, School of Hygiene. Additionally, due to the typhus epidemic, the fundaments for the State Sanitary Inspection (1954), which is functioning until this day, were laid down along with various sanitary acts.

Copyright of HiSTOReLo: Revista de Historia Regional y Local is the property of Universidad Nacional de Colombia, Centro Editorial Facultad de Ciencias Humanas y Economicas and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

An introduction is presented in which editor discusses various articles within the issue on topics including sociocultural aspects of the exanthematous typhus epidemic in Santiago of Chile in the 1930s; tropical anemia as hookworm disease and hygienic policies and intensity of smallpox epidemics.

During the nineteenth century, epidemic typhus was one of the main public health problems resulting from industrialisation and urbanisation processes in Europe. It became an illness intricately linked to poverty, famine, the labour crisis and residential overcrowding. In Spain, it reached a significant peak in the first decade of the twentieth century, and Madrid was its uncontested epicentre. Between 1903 and 1910, the Spanish capital was hit by two waves of epidemic typhus. Their causes were associated with the fault lines drawn in the city's structure during the previous decades. The origins of both epidemics, the resources deployed to control them and their socio-spatial spread can be linked to the gaps in urban policies in Madrid in comparison with the transformations that the city underwent after the middle of the nineteenth century. [ABSTRACT FROM AUTHOR]

Copyright of Secuencia: Revista de Historia y Ciencias Sociales is the property of Instituto de Investigaciones - Dr. Jose M. Luis Mora and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

In late 18th century Britain, typhus fever plagued the mass mobilisation of soldiers and posed a significant challenge to physicians of the time. Epidemic typhus was spread through highly infectious faeces of infected lice and carried a high mortality in patients and healthcare staff alike. Physicians James Carmichael Smyth (1741–1821) and Archibald Menzies (1754–1842) theorized that typhus fever was caused by infection of human exhalation. They trialled the use of vapourised nitrous acid to fumigate patients, their clothes and their bedspace, with apparent success. Despite this, typhus fever continued to ravage deployments of soldiers into the early 19th century, stimulating the continuing evolution of the understanding of typhus and its treatment. [ABSTRACT FROM AUTHOR]

Health challenges of communities are often assessed using biomedical or individual risk-based frameworks which are often inadequate for understanding their full extent. We use observations from the global South to demonstrate the usefulness of structural assessment to evaluate a public health problem and spur action. Following newspaper reports of excessive deaths in the marginalised indigenous or Adivasi community of the Pando people in Northern Chhattisgarh in central India, we were asked by the state government's public health authorities to identify root causes of these deaths. In this rapidly evolving situation, we used a combination of public health, social medicine, and structural vulnerability frameworks to conduct biomedical investigation, social inquiry, and structural assessment. After biomedical investigations, we identified scrub typhus, a neglected tropical disease, as the most likely cause for some of the deaths which was unrecognised by the treating physicians. In the social inquiry, the community members identified the lack of Adivasi status certificates, education, and jobs as the three major social factors leading to these deaths. During the structural assessment of these deaths, we inductively identified the following ten structures– political, administrative, legal, economic, social, cultural, material, technical, biological, and environmental. We recommended improving the diagnosis and treatment of scrub typhus, making the hospitals more friendly for Adivasi people, and tracking the health status of the Adivasi communities as some of the measures. We suggest that a combination of biomedical, social,and structural assessments can be used to comprehensively evaluate a complex public health problem to spur action.. [ABSTRACT FROM AUTHOR]

Copyright of Dynamis is the property of Dynamis - Facultad de Medicina de la Universidad de Granada and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

In the Crimean War (1854–56), infamous for its high death rate from disease at 212 per thousand British troops annually – one third of which was due to cholera or dysentery – skin disease was common, accounting for 13% of all admissions and 4.2% of all deaths. Excluding typhus, skin disease caused 252 per thousand annual admissions and 8.8 per thousand annual deaths, with an overall case fatality of 3.4%. The commonest skin diseases were: localised cellulitis/abscess, ulcer, venereal disease, frostbite, scurvy, eruptive rashes and scabies. The biggest number of skin disease-related deaths were from frostbite and scurvy. Cutaneous afflictions with the highest case fatality were erysipelas (27%), gangrene (25%), smallpox (21%) and frostbite (19%). Problems from frostbite lessened during the better provisioned second winter. The experience of skin disease in the Crimea highlights the importance of public health and personal sanitation to skin health in the military context, and shows that skin-related infections and nutritional deficiencies easily develop if environmental conditions deteriorate. [ABSTRACT FROM AUTHOR]

Typhus is an acute febrile disease caused by a series of bacteria called Rickettsia that is transmitted by insects such as lice, fleas, and ticks. This disease has appeared several times in Iran and caused many casualties. There were some therapeutic measures taken by European physicians in Tehran and medical graduates of the Dar al-Fonun school or expatriates who had studied medical courses in Western countries, even though the taken steps were not enough. Due to the lack of sanitation and cleaning products after the outbreak of World War I in March 1917 and its synchronization with the swift outbreak of Typhus in 1918, heavy casualties followed. In this study, we first examine the prevalence of Typhus in the Qajar dynasty in Iran, and will then focus on the pathological importance of this disease history in Iran. After that, we will study the role of Typhus prevalence and World War I in the Persian famine, malnutrition, and food poverty. Moreover, we investigated the role that this great war had in strengthening the spread of this disease and its role in the death of many Iranian people. [ABSTRACT FROM AUTHOR]

Typhoid, paratyphoid, leptospirosis, scrub typhus, and melioidosis are some of the common bacterial infections which are endemic in the region of South Asia. Typhoid and paratyphoid cause enteric fever which is a common cause of fever in the general population in this region. It is caused by Salmonella through contaminated food and water. Enteric fever is one of the most common causes of fever in travelers in this region. Leptospirosis is a zoonotic disease caused by Leptospira and occurs due to direct contact with animals like or through abraded skin after the monsoon in the endemic area. Fever and jaundice are the most common presentations. Scrub typhus is caused by mite Orientia tsutsugamushi and it has now emerged as one of the most common causes of pyrexia in this region. Melioidosis is an uncommon infection caused by the bacteria Burkholderia pseudomalle, which is endemic in some regions of South Asia and is usually seen in immunocompromised individuals. Melioidosis is often called great mimicker due to a variety of clinical manifestations which might confuse it with other diseases. All these infections can cause fever or other systemic complications involving various organs in transplant recipients, so they should be kept as part of differential diagnosis of pyrexia in transplant recipients. There are no recommendations to screen for these infections in transplant candidates or donors, however, transplant candidates or donors with fever should be investigated for these infections and transplant should be deferred until full recovery and for some time thereafter. [ABSTRACT FROM AUTHOR]

Objective To summarize the clinical manifestations, laboratory examination, imaging examination, genetic test, treatment and prognosis of scrub typhus combined with central nervous system (CNS) infection. Methods and Results The clinical data of 4 cases of scrub typhus encephalitis diagnosed and treated from October to November in Tianjin Huanhu Hospital were analyzed. The main clinical manifestations were eschar and lymphadenopathy (4 cases), headache (4 cases), nausea and vomiting (3 cases), fever (3 cases), rash (3 cases), and mental behavior disorder (3 cases); laboratory examination of hepatic in 3 cases were abnormality. Three patients underwent lumbar puncture of cerebral spinal fluid (CSF), including 3 cases with elevated pressure, 2 with elevated white blood cell count, 3 with elevated protein quantification, and 3 with abnormal immune function. Head MRI examination in 3 cases were normal, and one case showed a slightly linear hyperintensity of FLAIR in the bilateral occipital lobes. Metagenomic next-generation sequencing (mNGS) of CSF was completed in 3 patients, and Orientia tsutsugamushi was detected in all of them. All 4 cases were diagnosed as scrub typhus encephalitis and recovered after effective antibiotic treatment. Conclusions The clinical manifestations of scrub typhus combined with CNS infection are not specific, so it is necessary to be vigilant against the occurrence of scrub typhus in patients with CNS infection of unknown etiologys. In particular, scrub typhus should be considered during the epidemic season, if there is a history of farm work or suburban activities. [ABSTRACT FROM AUTHOR]

The exposure of a research team to chigger mites in southern Chile allowed the first identification of a trombiculid species as vector and reservoir of scrub typhus outside the tsutsugamushi triangle, providing unique insights into the ecology and transmission of this recently discovered rickettsial infection in South America. [ABSTRACT FROM AUTHOR]

Background: Scrub typhus is relatively less common among infants but found to have a mentionable association with multiple organ dysfunction and turbulent course. The aim of this study was to delineate the clinicolaboratory profile of infantile scrub typhus, complication, course of illness, and responsiveness to therapy. Subjects and Methods: This retrospective observational study was undertaken in two tertiary care pediatric teaching centers in eastern India among infants with diagnosis of scrub typhus. Clinical features, especially pattern of organ dysfunction, laboratory findings with emphasis on hyperferritinemia, and treatment schedules with responsiveness to therapy, were analyzed retrospectively. Results: A total of 272 cases of scrub typhus had been admitted during the study period. Among them, 17 kids (6.25%) were infants. All of them presented with lethargy and poor feeding as a common complaint along with seizures and respiratory distress. Seven out of 17 (41%) were identified early. Fifteen (88%) were critically ill and required pediatric intensive care unit admission, out of which 13 (76.4%) patients were put on ventilator support. Thirteen (76.4%) of them developed hyperferritinemia with multi-organ dysfunction syndrome (MODS) and required additional immunotherapy. Sixteen of them recovered completely without any sequelae. Severe complications such as acute respiratory distress syndrome and MODS were significantly high (P = 0.001 and 0.004, respectively) and hospital stay was longer (P-0.04) in infants in comparison to older children. Conclusion: We conclude that infantile scrub typhus, though not very common, should be considered an important differential in infants presenting with an acute febrile illness with hyperferritinemia and MODS. Infants with scrub typhus can have a more stormy disease course compared to their older counterparts. [ABSTRACT FROM AUTHOR]

Cardiovascular manifestations and electrocardiographic abnormalities have been reported among some prevalent infections in tropical regions, which lead to a great amount of morbidity and mortality. The major infectious diseases include chikungunya, dengue fever, H1N1 influenza, and coronavirus disease-19 (COVID-19) in the viral category, leptospirosis, salmonellosis, scrub typhus and tuberculosis in the bacterial category, and malaria in the protozoan parasite category. All these infirmities constitute a foremost infection burden worldwide and have been linked to the various cardiac rhythm aberrancies. So we aimed to identify and compile different studies on these infections and associated acute electrocardiographic (ECG) changes. The search was made in online international libraries like PubMed, Google Scholar, and EMBASE, and 38 most relevant articles, including original research, systematic reviews, and unique case reports were selected. All of them were evaluated thoroughly and information regarding ECG was collected. Myocarditis is the predominant underlying pathology for rhythm disturbance and can be affected either due to the direct pathogenic effect or the abnormal immune system activation. ECG variabilities in some infections like chikungunya, scrub typhus, and leptospirosis are associated with longer hospital stay and poor outcome. Tropical infective diseases are associated with prominent acute cardiac rhythm abnormalities due to myocarditis, which can be identified preliminarily by ECG changes. [ABSTRACT FROM AUTHOR]

Rickettsial illnesses, comprising mainly spotted fever group, typhus group and scrub typhus, are vector-borne re-emerging or newly emerging febrile illnesses where humans are an accidental dead-end host. They are a major cause of non-malarial febrile illnesses among returned travellers. They commonly present as an acute febrile illness and carry a characteristic entry wound (eschar) or a discrete erythematous maculo-popular rash based on the organism and the region. The illness severity is mainly dependent on the virulence of the rickettsial organism and delay in the diagnosis is known to cause severe illness with multi-organ involvement carrying high mortality. Almost all rickettsial infections respond to anti-rickettsial antibiotics such as doxycycline within 48--72 hours. Awareness of rickettsial illnesses and their various clinical presentations helps in early diagnosis and institution of appropriate treatment and hence prevent morbidity and mortality. [ABSTRACT FROM AUTHOR]

Copyright of Journal of Education & Science is the property of Republic of Iraq Ministry of Higher Education & Scientific Research (MOHESR) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The article discusses how Guillain Barre Syndrome is associated with Scrub Typhus infection, a a zoonotic disease, caused by Rickettsia, Orientia tsutsugamushi (OT). Topics include Treatment given including intravenous immunoglobulin (IVIG) or Plasma exchange (PE); and temporal association in the present study supports the notion that GBS might have been triggered by humoral immune response against ST.

Background: The rickettsioses, except for typhus fever and scrub typhus (ST), were not really recognized as distinct clinical entities until the early 20th century. Only when specific rickettsial serologic testing was introduced in the 1940s could the precise etiologies of various rickettsial diseases (RDs) be determined with certainty. Although ST is a well- recognized zoonotic disease entity, but non-scrub typhus rickettsial infection like spotted fever group and typhus group are not well studied in India and are still underestimated. Methods: We report cases who had shown seropositivity of spotted fever and typhus fever RD in IgM and IgG ELISA whose samples were referred from various hospitals of Delhi/National Capital Region in which clinicians had strong suspicion of rickettsiosis other than ST or Weil-Felix test found positive for any of the OX2, 19, and K antigens. Results: We reported 18 cases of SFG and TGRD with mostly cases presented with fever followed by hepato-intestinal symptoms. Conclusion: The vast variability and nonspecific presentation of rickettsiosis in spotted and typhus fever at times have often made it difficult to diagnose clinically. Prompt antibiotic therapy shortens the course of the disease, lowers the risk of complications, and in turn, reduces morbidity and mortality owing to RDs. There is a distinct need for physicians and health care workers at all levels of care in India to be aware of the clinical features, available diagnostic tests and their interpretation, and the therapy for these infections.

Background: A clinical risk-scoring algorithm (CRSA) to forecast the scrub typhus severity was developed from two general hospitals in Thailand where patients were classified into three groups--nonsevere, severe, and fatal. In this study, an attempt was made to validate the risk-scoring algorithm for prognostication of scrub typhus severity in India. Materials and methods: This prospective study was conducted at a hospital in South India between November 2017 and March 2019. Patients of scrub typhus were categorized into nonsevere, severe, and fatal according to the CRSA. The patients were also grouped into severe and nonsevere according to the definition of severe scrub typhus which was used as a gold standard. The obtained CRSA score was validated against the classification based on the definition of severe scrub typhus. Receiver operating characteristics (ROC) curve for the scores was plotted and the Youden's index for optimal cutoff was used. Results: A total of 198 confirmed cases of scrub typhus were included in the study. According to the ROC curve, at a severity score ≥7, an optimal combination of sensitivity of 75.9% and specificity of 77.5% was achieved. It correctly predicted 76.77% (152 of 198) of patients as severe, with an underestimation of 10.61% (21 patients) and an overestimation of 12.63% (25 patients). Conclusion: In the present study setting, a cutoff of ≥7 for severity prediction provides an optimum combination of sensitivity and specificity. These findings need to be validated in further studies. [ABSTRACT FROM AUTHOR]

Sphingobacterium spiritivorum is a rare cause of human infections worldwide. After reviewing the literature, we could find only eight case reports to date. The majority of cases were of cellulitis and septicemia. Most of these patients were immunocompromised and the recovery rate was lesser. We present a case of a young female diagnosed with scrub typhus complicated by acute respiratory distress syndrome who developed septicemia and septic shock due to S. spiritivorum. She was managed with sensitive antibiotic levofloxacin, clinically improved, and discharged in satisfactory condition. [ABSTRACT FROM AUTHOR]

Scrub typhus most commonly presents as febrile illness, myalgia, headache, lymphadenopathy and rash. There can be diverse clinical presentations ranging from subclinical presentation to sepsis leading to multiorgan failure. The patient can also present with features of acute abdominal pain which is usually managed conservatively. Scrub typhus cases are commonly reported from rural areas of Indonesia, China, Southeast Asia, Japan and India. Most common lesion is an eschar which starts as a vesicular lesion at the mite bite site. It further forms an ulcer with black necrotic centre. Secondary bacterial infection can also be present at the eschar site forming an abscess at a later stage. The case reported here is one of the rarest presentations where the patient presented with eschar and abscess formation over the previous scar site. Incision and drainage were done for the scar site abscess. ELISA for IgM antibodies to Orientia tsutsugamushi in view of multiple eschars which turned out to be positive. She improved with medical management. [ABSTRACT FROM AUTHOR]

This article explores three epidemic episodes in 1950s Bolivia: a typhus outbreak in Oruro in September 1954, a typhoid outbreak in Cochabamba in January 1956, and a polio outbreak along the Bolivia-Argentine border in March 1956. Each case discusses state-imposed quarantine and sanitation measures, using newspaper reports and editorials, letters to health officials, and government publications to document institutional responses to these epidemic episodes and people's reactions. Through press coverage, the article analyzes praise and critiques of government responses to these epidemics to assess what measures public health authorities implemented, how effective they were, and how Bolivians felt about their political and medical leadership during these crises. These case studies evidence that Bolivians did not respond uniformly to government containment policies, and responses varied by region and disease. They also demonstrate that quarantines are effective even if not always popular, and that the public's perception of the measures' efficacy and implementation impact their feelings about state legitimacy. Finally, they show that disease outbreaks create opportunities for citizens to critique government officials and push for improvements to public health. [ABSTRACT FROM AUTHOR]

Copyright of Secuencia: Revista de Historia y Ciencias Sociales is the property of Instituto de Investigaciones - Dr. Jose M. Luis Mora and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Introduction: Children with scrub typhus may present with one or more organ failures. Identifying the predictors of severe disease and need for pediatric intensive care unit (PICU) admission would help clinicians during outbreak seasons. Materials and methods: This observational study included 160 children admitted to the emergency department (ED) with scrub typhus confirmed by polymerase chain reaction (PCR) between January 2013 and December 2015. Demographic, clinical, and laboratory data were collected and predictors for PICU admission were identified. Results: There was a seasonal trend with peak presentation in post-monsoon months between August and October. Mean (SD) age at presentation was 6.8 (3.2) years. Fever was present in all with a median (IQR) duration of 9 (6-11) days. Respiratory distress (42%), altered sensorium (24%), hepatomegaly (93%), splenomegaly (57%), and lymphadenopathy (54%) were other features. Rash and eschar were noted in 24% each. Thrombocytopenia (83%), hypoalbuminemia (63%), and hyponatremia (62%) were common laboratory abnormalities. Meningoencephalitic presentation was noted in 29%; acute kidney injury (AKI) (16%), acute respiratory distress syndrome (ARDS) (11%), and myocarditis (3%) were other organ dysfunctions. Sixty-six (41%) children required PICU admission. Intensive care needs include invasive ventilation (n = 27, 17%), vasoactive drugs therapy for hemodynamic support (n = 43, 27%), osmotherapy to treat raised intracranial pressure (n = 27, 17%), and renal replacement therapy (n = 3, 2%). Mortality was 8.8%. On multivariable analysis, lymphadenopathy, respiratory distress, shock, elevated lactate, and meningoencephalitis predicted the requirement of PICU admission. Conclusion: Scrub typhus presents with organ dysfunction during post-monsoon months. We identified predictors of intensive care in children with scrub typhus admitted to ED. Clinical significance: Our results would help clinicians identify severe cases and prioritize resources. [ABSTRACT FROM AUTHOR]

Scrub typhus, a neglected infectious disease caused by the obligate intracellular bacterium Orientia tsutsugamushi , is a major cause of fever across the Asia Pacific region with more than a billion people at risk. Treatment with antibiotics such as doxycycline or chloramphenicol is effective for the majority of patients. In the 1990s, reports from northern Thailand raised a troubling observation; some scrub typhus patients responded poorly to doxycycline, which investigators attributed to doxycycline resistance. Despite the controversial nature of these reports, independent verification was neglected, with subsequent studies speculating on the role of doxycycline resistance in contributing to failure of treatment or prophylaxis. In this review, we have outlined the evidence for drug-resistant Orientia tsutsugamushi , assessed the evidence for doxycycline resistance, and highlight more recent findings unsupportive of doxycycline resistance. We conclude that doxycycline resistance is a misconception, with treatment outcome likely to be determined by other bacterial, host, and pharmacological factors. [ABSTRACT FROM AUTHOR]

One of the historical periods of Iran that can be studied for contagious diseases and how they spread, is the late Qajar period. The city of Mashhad, after Tehran and Tabriz, had a special place among Russian and English governments in the Qajar period as one of the significant religious, political and economic centers in Iran due to Imam Reza's holy shrine, a large population and great geographical scale. The central governments' incompetence in preventing the outbreak of contagious diseases and lack of essential amenities, caused many lives to be lost all over Iran and especially Mashhad during the Qajar period. Hence, the neighbor governments such as Russia, ordered for quarantines to be set up at the borders and dispatched doctors to stop diseases' from reaching Russian lands. However, these attempts did not prevent the deaths of people in the border areas, especially in Mashhad, from diseases such as cholera, plague, smallpox, typhus, flu and other diseases. In this study, we investigate and explain the subjects: disease outbreaks, the problem of commerce, quarantine and its outcomes at the end of Qajar period, between the years 1892 and 1921 AD in Mashhad, with the help of historical and documentary sources using an analytical and medical historiography method. [ABSTRACT FROM AUTHOR]

The objectives of this paper are to locate documentation to study the morbidity and mortality caused by exanthematous typhus in Jerez de la Frontera (1941-1942); to study the sanitary measures that were carried out in this city against this disease, and to point out other problems of morbidity and mortality in the 1940s. [ABSTRACT FROM AUTHOR]

Rickettsia are obligate intracellular bacteria often associated with ticks and best known for causing human diseases (rickettsiosis), including typhus fever and sporadic cases of serious infection. In this study, we conducted a large survey of ticks in French Guiana to understand the overall diversity of Rickettsia in this remote area largely covered by dense rainforests. Out of 819 individuals (22 tick species in six genera), 252 (30.8%) samples were positive for Rickettsia infection. Multilocus typing and phylogenetic analysis identified 19 Rickettsia genotypes, but none was 100% identical to already known Rickettsia species or strains. Among these 19 genotypes, we identified two validated Rickettsia species, Rickettsia amblyommatis (spotted fever group) and Rickettsia bellii (bellii group), and characterized a novel and divergent Rickettsia phylogenetic group, the guiana group. While some tick hosts of these Rickettsia genotypes are among the most common ticks to bite humans in French Guiana, their potential pathogenicity remains entirely unknown. However, we found a strong association between Rickettsia genotypes and their host tick species, suggesting that most of these Rickettsia genotypes may be nonpathogenic forms maintained through transovarial transmission. [ABSTRACT FROM AUTHOR]

This article examines Mexico City's typhus epidemic of 1915-16 and makes three central claims. First, the federal response to the outbreak, while laudable in light of the grim circumstances, was disjointed and excessively bureaucratic. Second, the epidemic drew out long-standing stereotypes of poor indigenous populations, leading people to make misguided linkages between the high incidence of typhus within those populations and their supposed moral or intellectual shortcomings. Third, the typhus epidemic prompted fundamental reforms to the nation's public health system. As a delegate to the constitutional convention of 1917, the nation's chief public health officer, general and doctor José Marıá Rodríguez, successfully promoted his vision of a "sanitary dictatorship" that would operate according to strict authoritarian principles for the sake of efficiency. The epidemic thus shaped not only the human experience in that moment but also the course of revolutionary political reform in the years to come. [ABSTRACT FROM AUTHOR]

Background Substantial outbreaks of scrub typhus, coupled with the discovery of this vector-borne disease in new areas, suggest that the disease remains remarkably neglected. The objectives of this study were to map the contemporary and potential transmission risk zones of the disease and to provide novel insights into the health burden imposed by scrub typhus in southern China. Methods Based on the assembled data sets of annual scrub typhus cases and maps of environmental and socioeconomic correlates, a boosted regression tree modeling procedure was used to identify the environmental niche of scrub typhus and to predict the potential infection zones of the disease. Additionally, we estimated the population living in the potential scrub typhus infection areas in southern China. Results Spatiotemporal patterns of the annual scrub typhus cases in southern China between 2007 and 2017 reveal a tremendous, wide spread of scrub typhus. Temperature, relative humidity, elevation, and the normalized difference vegetation index are the main factors that influence the spread of scrub typhus. In southern China, the predicted highest transmission risk areas of scrub typhus are mainly concentrated in several regions, such as Yunnan, Guangxi, Guangdong, Hainan, and Fujian. We estimated that 162 684 million people inhabit the potential infection risk zones in southern China. Conclusions Our results provide a better understanding of the environmental and socioeconomic factors driving scrub typhus spread, and estimate the potential infection risk zones beyond the disease's current, limited geographical extent, which enhances our capacity to target biosurveillance and help public health authorities develop disease control strategies. [ABSTRACT FROM AUTHOR]

Background: Pediculus humanus capitis is one of the ectoparasites which lead to transition of Typhus fever. Rickettsial infections which affect the vasculature cause nonspecific signs and symptoms making it difficult to diagnose the disease clinically. This study was performed to investigate the genetic sequence of these external parasites and the possibility of their development that may make them more dangerous to transfer many pathogens to the human body. Method: In this study, 200 patients of school students (65 males and 135 females) with their ages =18 years were enrolled. In addition, 8(4%) of them were infected with rickettsiosis. All the patients were tested for detection of IGM and IgG anti- Rickettsia antibodies by ELISA and IFA techniques. Results: The serum titers for Anti- Rickettsia Antibodies (IgG) were 1/128, 1/256 and 1/512 among 8 of them as 2(25%), 4(50%) and 2(25%), respectively. The COI gene was detected with 552bp. The primers used F- AGCTCATTTGTTCAAGGCGG and R TACCAACACCCTCCAGCAAA with sequence size 827.. Conclusion: There was a 100 percent similarity between USA strains and Iraqi strains of the Bene Bank, indicating that the lice have not been developed. [ABSTRACT FROM AUTHOR]

The article focuses on Uzbekistan's rural communities experienced ocharchilik and shortages of food convinced some them to eat potatoes and plant potatoes. It mentions oral history accounts tell about drought, and subsequent grain shortfall, across most of Uzbekistan in the spring of 1933; about deaths from starvation and typhus. It mentions Amartya Sen's question about entitlements and Uzbeks struggled to find sustenance in famine conditions.