Search

【Objective】 In order to ensure the standardization and accuracy of transgenic detection technology, this study is aimed to develop a multi-target plasmid standard molecule suitable for qualitative and quantitative detection of transgenic soybean. 【Method】In order to characterize molecular features of 13 transgenic soybean events, nucleic acid fragments containing multi-target sequences were synthesized. These fragments were inserted into the multiple cloning sites of the pUC57 plasmid and transformed into Escherichia coli, resulting in the development of a plasmid DNA standard molecule, pUC57-SOY, containing 27 transgenic soybean target sequences. The target specificity of the DNA standard molecule pUC57-SOY was tested using conventional PCR, single, and duplex real-time fluorescence quantitative PCR (qPCR) detection methods. The applicability range and quantitative parameters were evaluated using 13 transgenic soybean events for quantitative detection. 【Result】In PCR detection, all 24 target sequences contained in the plasmid DNA were consistently amplified without non-specific amplification products, indicating the excellent specificity of the plasmid DNA standard molecule pUC57-SOY in practical detection. Real-time fluorescence quantitative PCR (qPCR) analysis demonstrated a good linear correlation between different concentrations of the plasmid standard molecule and target amplification efficiency. Using pUC57-SOY as a positive reference, the actual sample detection results were consistent with expectations when applying the standard curve interpolation method. 【Conclusion】 The multi-target plasmid standard molecule pUC57- SOY developed in this study showed excellent performance in line with the requirements of qualitative and quantitative detection of transgenic components. In qualitative detection, 24 detection targets can be stably detected and have good specificity. In quantitative detection, a standard substance corresponding to 13 kinds of targets can be accurately determined. Therefore, the plasmid standard molecule pUC57-SOY created in this study can be used as a positive control product for the detection of transgenic soybeans. [ABSTRACT FROM AUTHOR]

Soybean [Glycine max (L.) Merr.], an essential staple food and oil crop worldwide, boasts abundant vegetable proteins and fats beneficial for both human and animal consumption. However, the soybean pod borer (Leguminivora glycinivorella) (SPB) stands as the most destructive soybean insect pest in northeast China and other northeastern Asian regions, leading to significant annual losses in soybean yield and economic burden. Therefore, this study aims to investigate the introduction of a previously tested codon-optimized cry1c gene, cry1c*, into the soybean genome and assess its effect on the SPB infestation by generating and characterizing stable transgenic soybeans overexpressing cry1c*. The transgenic soybean lines that constitutively overexpressed cry1c* exhibited a significant reduction in the percentage of damaged seeds, reaching as low as 5% in plants under field conditions. Additionally, feeding transgenic leaves to the larvae of S. exigua, S. litura, and M. separta resulted in inhibited larval growth, decreased larval body weight, and lower survival rates compared to larvae fed on wild-type leaves. These findings showed that the transgenic lines maintained their resistance to SPB and other lepidopteran pests, especially the transgenic line KC1. Southern blotting and genome-wide resequencing analysis revealed that T-DNA integration occurred as a single copy between loci 50,868,122 and 50,868,123 of chromosome 10 in the transgenic line KC1. Therefore, the transgenic line KC1, overexpressing high levels of cry1c* in leaves and seeds, holds strong potential for commercial use in the integrated management of SPB and other lepidopteran pests. [ABSTRACT FROM AUTHOR]

Abstract Background Crop-wild hybridization has generated great concerns since gene flow can be an avenue for transgene escape. However, a rather limited number of studies on risk assessment regarding the dispersion of transgenes from GM soybean to populations of its wild relatives have been previously conducted. Results The results of the 3-year experiment demonstrated that hybrids between GM soybeans and wild soybean had lower seed germination and higher seed productivity than GM soybean. Both of these features of hybrid (especially F2 and F3) were similar to those of wild soybean. Furthermore, the foreign protein was stably expressed in hybrid EPSPS positive plants; however, no difference was observed in agronomic measurements between hybrids that are glyphosate sensitive or resistant, homozygous or heterozygous for the transgene, indicating that the presence of the EPSPS transgene does not affect the vigor of hybrid. In contrast, hybridization between GM soybean and wild soybean may have more impact on hybrid growth and fecundity, this increase in biomass and yield confers a potential competition benefit to hybrids. Conclusions Gene flow from GM soybean to wild soybean has the potential to promote the adaptability of hybrids and may increase the possibility of dispersal of transgenes in wild soybean relatives.

Drought affects soybean growth and ultimately led to yield reduction. WRKY transcription factors involve in the regulation of abiotic stress. Few functions of WRKY transcription factors underlying drought tolerance in soybean are clear. Here, we reported a WRKY transcription factor named GmWRKY17 that positively regulates soybean drought tolerance by regulating drought-induced genes and ABA-related genes. Transcriptome sequencing (RNA-Seq) and yeast one hybrid analysis identified downstream genes regulated by GmWRKY17. ChIP-qPCR, EMSA and dual-luciferase reporter assay showed that GmWRKY17 directly bound to the promoters of the GmDREB1D and GmABA2, and activated their expression under drought stress. Overexpression of GmDREB1D gene enhanced drought tolerance of soybean. Taken together, our study revealed a regulatory mechanism that GmWRKY17 transcription factor may improve soybean drought tolerance by mediating ABA synthesis and DREB signaling pathway. Key message: GmWRKY17 improves the drought tolerance of soybean by reducing water loss, promoting ABA synthesis, and activating GmDREB1D and GmABA2 genes. [ABSTRACT FROM AUTHOR]

The commercial cultivation of herbicide-resistant (HR) transgenic soybeans (Glycine max L. Merr.) raises great concern that transgenes may introgress into wild soybeans (Glycine soja Sieb. et Zucc.) via pollen-mediated gene flow, which could increase the ecological risks of transgenic weed populations and threaten the genetic diversity of wild soybean. To assess the fitness of hybrids derived from transgenic HR soybean and wild soybean, the F2 and F3 descendants of crosses of the HR soybean line T14R1251-70 and two wild soybeans (LNTL and JLBC, which were collected from LiaoNing TieLing and JiLin BaiCheng, respectively), were planted along with their parents in wasteland or farmland soil, with or without weed competition. The fitness of F2 and F3 was significantly increased compared to the wild soybeans under all test conditions, and they also showed a greater competitive ability against weeds. Seeds produced by F2 and F3 were superficially similar to wild soybeans in having a hard seed coat; however, closer morphological examination revealed that the hard-seededness was lower due to the seed coat structure, specifically the presence of thicker hourglass cells in seed coat layers and lower Ca content in palisade epidermis. Hybrid descendants containing the cp4-epsps HR allele were able to complete their life cycle and produce a large number of seeds in the test conditions, which suggests that they would be able to survive in the soil beyond a single growing season, germinate, and grow under suitable conditions. Our findings indicate that the hybrid descendants of HR soybean and wild soybean may pose potential ecological risks in regions of soybean cultivation where wild soybean occurs. [ABSTRACT FROM AUTHOR]

Fuelled by agribusiness, transgenic soybean crops, genetically modified to withstand pesticide use, have increased in use during the last 20 years in the Southern Cone of Latin America. Plantations are understood as examples of ‘modular simplifications’ in ‘patchy Anthropocene’ landscapes (Tsing et al. 2019), where the attempt to reduce diversity may have social and ecological feral effects as diseases and toxins spread. In Uruguay, as an agro-exporter country, soybean expansionist processes correlate with an increased use of pesticides. Based on an ethnographic study (2016–2018) carried out in the main Uruguayan agricultural region, this Research Article seeks to analyse the experiences of toxicity among agricultural workers and rural inhabitants in the soybeanisation context. I propose that pesticide effects transcend biomedical diagnoses of ‘intoxication’. I also contend that the experience of toxicity can be understood as occurring along a continuum in the daily life of sufferers, which encompasses chemical and biological processes, their affects, intersectional conflicts, lay concepts of illnesses, informal self-care networks, and unequal access to health services. This ethnography demonstrates that the experience of toxic suffering embodies inequalities in environmental health in the time of the Anthropocene and is shaped by structural vulnerabilities and politics of exposure.

Background: Crop-wild hybridization has generated great concerns since gene flow can be an avenue for transgene escape. However, a rather limited number of studies on risk assessment regarding the dispersion of transgenes from GM soybean to populations of its wild relatives have been previously conducted. Results: The results of the 3-year experiment demonstrated that hybrids between GM soybeans and wild soybean had lower seed germination and higher seed productivity than GM soybean. Both of these features of hybrid (especially F2 and F3) were similar to those of wild soybean. Furthermore, the foreign protein was stably expressed in hybrid EPSPS positive plants; however, no difference was observed in agronomic measurements between hybrids that are glyphosate sensitive or resistant, homozygous or heterozygous for the transgene, indicating that the presence of the EPSPS transgene does not affect the vigor of hybrid. In contrast, hybridization between GM soybean and wild soybean may have more impact on hybrid growth and fecundity, this increase in biomass and yield confers a potential competition benefit to hybrids. Conclusions: Gene flow from GM soybean to wild soybean has the potential to promote the adaptability of hybrids and may increase the possibility of dispersal of transgenes in wild soybean relatives. [ABSTRACT FROM AUTHOR]

Soybean (Glycine max) is the main oilseed crop that provides vegetable oil for human nutrition. The main objective of its breeding research is to increase the total oil content. In the Kennedy pathway, Diacylglycerol acyltransferase (DGAT) is a rate-limiting enzyme that converts diacylglycerol (DAG) to triacylglycerol (TAG). Here, the AhDGAT3 gene was cloned from peanut and overexpressed in the wild-type (WT) Arabidopsis. The total fatty acid content in T3AhDGAT3 transgenic Arabidopsis seeds was 1.1 times higher on average than that of the WT. Therefore, AhDGAT3 was transferred into the WT (JACK), and four T3 transgenic soybean lines were obtained, which proved to be positive using molecular biological detection. Specific T-DNA insertion region location information was also obtained via genome re-sequencing. The results of high-performance gas chromatography showed that the contents of oleic acid (18:1) composition and total fatty acids in transgenic soybean plants were significantly higher than that of the WT. However, linoleic acid (18:2) was much lower compared to the WT. The agronomic trait survey showed that the quantitative and yield traits of AhDGAT3 transgenic soybean were better than those of the WT. These results suggest that fatty acids in transgenic soybeans, especially oleic acid and total fatty acid, are enhanced by the over-expression of AhDGAT3. [ABSTRACT FROM AUTHOR]

Key message: The salt-tolerance of transgenic soybean cleared for environmental release was improved by stable over-expression of AhBADH gene from Atriplexhortensis, which was demonstrated through molecular analysis and field experiments. An effective strategy for increasing the productivity of major crops under salt stress conditions is the development of transgenics that harbor genes responsible for salinity tolerance. Betaine aldehyde dehydrogenase (BADH) is a key enzyme involved in the biosynthesis of the osmoprotectant, glycine betaine (GB), and osmotic balance in plants, and several plants transformed with BADH gene have shown significant improvements in salt tolerance. However, very few field-tested transgenic cultivars have been reported, as most of the transgenic studies are limited to laboratory or green house experiments. In this study, we demonstrated through field experiments that AhBADH from Atriplexhortensis confers salt tolerance when transformed into soybean (Glycinemax L.). AhBADH was successfully introduced into soybean by Agrobacterium mediated transformation. A total of 256 transgenic plants were obtained, out of which 47 lines showed significant enhancement of salt tolerance compared to non-transgenic control plants. Molecular analyses of the transgenic line TL2 and TL7 with the highest salt tolerance exhibited stable inheritance and expression of AhBADH in progenies with a single copy insertion. TL1, TL2 and TL7 exhibited stable enhanced salt tolerance and improved agronomic traits when subjected to 300mM NaCl treatment. Currently, the transgenic line TL2 and TL7 with stable enhanced salt tolerance, which have been cleared for environmental release, are under biosafety assessment. TL 2 and TL7 stably expressing AhBADH could then be applied in commercial breeding experiments to genetically improve salt tolerance in soybean. [ABSTRACT FROM AUTHOR]

The field study was undertaken to examine the potential for adverse effects of transgenic soybean expressing bioactive human epidermal growth factor (with tolerance to the herbicide glufosinate, PPT) on the abundance and diversity of plant‐dwelling arthropods by comparing with those of a non‐GM parental cultivar, Gwangan soybean. Field surveys of soybean fields were carried out over two consecutive years, 2016 and 2017 at Ochang and Jeonju, Korea. The number of captured individuals associated with either of EGF and Gwangan soybean plants increased in 2017 compared with 2016 in both Ochang and Jeonju. During the survey period, the diversity and richness of the occurred insects and arachnids increased, dominance decreased, and the evenness of the insects remained static. The insects of Hymenoptera Order occurred most often comprised 25.4% of total captured insect pests. On the contrary, natural enemy from Hymenoptera Order and other insects from Diptera Order occurred more frequently (29.9% and 19.0%, respectively) in both the survey regions during the study periods. The score from PROXSCAL multidimensional scaling using combined data showed that the occurrence of insects and arachnids were separated due to their cultivation regions and years, irrespective of soybean cultivars. Consequently, the results indicated that there happened no notable change in the composition of arthropod communities in soybean agroecosystem due to GM event in soybean expressing EGF.

[Objectives]In the early stage of this study, we introduced gene BADH into the soybean cultivar ‘Williams 82'to generate the transgenic event L8014, which showed good salt tolerance(1.5% NaCl)and had been cleared for environmental release. Obtaining and analyzing the flanking sequence of T-DNA insertion site were very important for the safety evaluation and application of transgenic events. The characteristics of the transgenic soybean L8014 material were clarified to promote its biosafety evaluation. [Methods]In this study, we detected the copy number of BADH gene by Southern hybridization. Based on genome resequencing technology, Burrows-Wheeler-Alignment(BWA)method was used to compare and analyze the resequencing data with the T-DNA sequence and soybean genome sequence. [Results]T-DNA was found to be in nucleotides 3925017 to 3926022 in the chromosome 10 of soybean genome. Combined with PCR amplification technology, the left and right boundary flanking sequences of exogenous T-DNA integration site were obtained. [Conclusions]Based on these sequences, an event-specific PCR detection method was established, which might provide rapid and accurate detection to identify the transgenic soybean L8014. [ABSTRACT FROM AUTHOR]

Soybean [Glycine max (L.) Merr.], an essential staple food and oil crop worldwide, boasts abundant vegetable proteins and fats beneficial for both human and animal consumption. However, the soybean pod borer (Leguminivora glycinivorella) (SPB) stands as the most destructive soybean insect pest in northeast China and other northeastern Asian regions, leading to significant annual losses in soybean yield and economic burden. Therefore, this study aims to investigate the introduction of a previously tested codon-optimized cry1c gene, cry1c*, into the soybean genome and assess its effect on the SPB infestation by generating and characterizing stable transgenic soybeans overexpressing cry1c*. The transgenic soybean lines that constitutively overexpressed cry1c* exhibited a significant reduction in the percentage of damaged seeds, reaching as low as 5% in plants under field conditions. Additionally, feeding transgenic leaves to the larvae of S. exigua, S. litura, and M. separta resulted in inhibited larval growth, decreased larval body weight, and lower survival rates compared to larvae fed on wild-type leaves. These findings showed that the transgenic lines maintained their resistance to SPB and other lepidopteran pests, especially the transgenic line KC1. Southern blotting and genome-wide resequencing analysis revealed that T-DNA integration occurred as a single copy between loci 50,868,122 and 50,868,123 of chromosome 10 in the transgenic line KC1. Therefore, the transgenic line KC1, overexpressing high levels of cry1c* in leaves and seeds, holds strong potential for commercial use in the integrated management of SPB and other lepidopteran pests.

Copyright of Journal of Ecology & Rural Environment is the property of Journal of Ecology & Rural Environment Editorial Office and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Summary: The widespread application of isoproturon (IPU) can cause serious pollution to the environment and threaten ecological functions. In this study, the IPU bacterial N‐demethylase gene pdmAB was transferred and expressed in the chloroplast of soybean (Glycine max L. 'Zhonghuang13'). The transgenic soybeans exhibited significant tolerance to IPU and demethylated IPU to a less phytotoxic metabolite 3‐(4‐isopropylphenyl)‐1‐methylurea (MDIPU) in vivo. The transgenic soybeans removed 98% and 84% IPU from water and soil within 5 and 14 days, respectively, while accumulating less IPU in plant tissues compared with the wild‐type (WT). Under IPU stress, transgenic soybeans showed a higher symbiotic nitrogen fixation performance (with higher total nodule biomass and nitrogenase activity) and a more stable rhizosphere bacterial community than the WT. This study developed a transgenic (TS) soybean capable of efficiently removing IPU from its growing environment and recovering a high‐symbiotic nitrogen fixation capacity under IPU stress, and provides new insights into the interactions between rhizosphere microorganisms and TS legumes under herbicide stress. [ABSTRACT FROM AUTHOR]

Soybean is one of the most important agricultural products that are closely related to people’s life and economic and social development. At present, the improvement of soybean production level and increasing soybean self-sufficiency rate are major problems that must be solved in China’s agricultural development. Due to the shortage of cultivated land resources in China, scientific and technological innovation is the only way to improve soybean production capacity. Transgenic breeding is a key technology to promote the development of soybean production, and it has played an important role in the development of soybean industry in the world’s major producers such as the United States, Brazil and Argentina. In last 20 years, the breeding techniques of herbicide-tolerant and insect-resistant soybean have obtained a great progress and some products can be used for commercialization in China. And the commercial planting of transgenic soybeans can significantly reduce productive cost and raise soybean yield. Based on the developmental progress of transgenic soybean techniques and the characteristics of soybean production in China, the following strategy is suggested to boost the commercialization scientifically and orderly. Firstly, in terms of product application, based on the single trait product for glyphosate tolerance, and the products with multiple genes for two or more herbicide tolerant traits such as glyphosate and glufosinate tolerance, as well as for stacking of herbicide tolerance and insect resistance traits, the commercialization of the above seeds should be conducted in order. Secondly, in terms of product regional layout, based on occurrence and regional distribution characteristics of target weeds and pests, top-level design of growing zones to herbicide-tolerant and insect-resistant soybean products should be performed. Thirdly, in terms of biosafety management, population monitoring and management techniques for resistant weeds and pests should be developed to extend service period of genetically modified products. In the meantime, the conservation of wild soybean germplasm resources should be strengthened to reduce the negative impact on biodiversity of wild soybean caused by gene flow from transgenic soybean in natural eco-system. [ABSTRACT FROM AUTHOR]

Key message: Efficient selectable marker gene autoexcision in transgenic plants of soybean, cotton, canola, and maize is achieved by effective Cre recombinase expression. Selectable marker genes are often required for efficient generation of transgenic plants in plant transformation but are not desired once the transgenic events are obtained. We have developed Cre/loxP autoexcision systems to remove selectable marker genes in soybean, cotton, canola and maize. We tested a set of vectors with diverse promoters and identified promising promoters to drive cre expression for each of the four crops. We evaluated both the efficiency of generating primary transgenic events with low transgene copy numbers, and the frequency of marker-free progeny in the next generation. The best performing vectors gave no obvious decrease in the transformation frequency in each crop and generated homozygous marker-free progeny in the next generation. We found that effective expression of Cre recombinase for marker gene autoexcision can be species dependent. Among the vectors tested, the best autoexcision frequency (41%) in soybean transformation came from using the soybean RSP1 promoter for cre expression. The cre gene expressed by soybean RSP1 promoter with an Arabidopsis AtpE intron delivered the best autoexcision frequency (69%) in cotton transformation. The cre gene expressed by the embryo-specific eUSP88 promoter from Vicia faba conferred the best marker excision frequency (32%) in canola transformation. Finally, the cre gene expressed by the rice CDC45-1 promoter resulted in 44% autoexcision in maize transformation. The Cre/loxP recombinase system enables the generation of selectable marker-free transgenic plants for commercial product development in four agriculturally important crops and provides further improvement opportunities for more specific and better marker excision efficiency. [ABSTRACT FROM AUTHOR]

The introduction of herbicide-tolerant (HT) transgenic soybeans (Glycine max (L.) Merr.) into farming systems raises great concern that transgenes may flow to endemic wild soybeans (Glycine soja Sieb. et Zucc.) via pollen, which may increase the ecological risks by increasing the fitness of hybrids under certain conditions and threaten the genetic diversity of wild soybean populations. In order to demonstrate the potential risk of gene flow from the HT soybean to the wild soybean, the fitness of F2 and F3 hybrids obtained from two wild soybean populations (HLJHRB-1, JSCZ) collected from China and the HT soybean was measured under farmland and wasteland soil conditions, as well as with or without weed competition. Compared with their wild progenitors, the F2 and F3 hybrids of HLJHRB-1 displayed a higher emergence rate, higher aboveground dry biomass, more pods and filled-seed plants, as well as better composite fitness under four planting conditions. The F2 and F3 hybrids of JSCZ also displayed a higher emergence rate, higher aboveground dry biomass, more pods, and more filled seeds per plant under mixed planting, whereas these characteristics were lower under pure planting conditions in wasteland and farmland soil. Therefore, the composite fitness of JSCZ hybrids was higher or lower depending on the planting conditions. Furthermore, the soil microbial communities of the F3 of HLJHRB-1, JSCZ, and the wild soybean were investigated with 16S rDNA sequencing, which showed that low alpha diversity of rhizobacteria was relative to high fitness, and Rhizobium played an important role in promoting F3 plant growth. [ABSTRACT FROM AUTHOR]

Transgenic soybean (Glycine max) plants expressing mutant potyviral coat proteins that disrupt virion assembly exhibited non-strain-specific resistance against soybean mosaic virus., (© 2024 Institute of Botany, Chinese Academy of Sciences.)

The introduction of genetically modified (GM) soybean into farming systems raises great concern that transgenes from GM soybean may flow to endemic wild soybean via pollen. This may increase the weediness of transgenic soybean by increasing the fitness of hybrids under certain conditions and threaten the genetic diversity of wild soybean populations. Although pollen-mediated gene flow between GM crops and wild relatives is dependent on many factors, the sexual compatibility (SC) determined by their genetic backgrounds is the conclusive factor. The considerable genetic variation among wild soybean populations may cause compatibility differences between different wild and cultivated soybeans. Thus, an evaluation of the SC between transgenic soybean and different wild soybeans is essential for assessing the environmental consequences of cultivated soybean–wild soybean transgene flow. The podding and seed sets were assessed after artificial hybridization using transgenic glyphosate-resistant soybean as the paternal parent and 18 wild soybean populations as the maternal parents. Then, the average number of filled seeds produced in 200 flowers (AFS) was calculated for each wild soybean under natural self-pollination as well as under artificial crossing with transgenic soybean. Finally, the index of cross-SC was calculated (ICSC) as the ratio of the AFS of wild soybean artificially crossed with transgenic soybean and the AFS of naturally self-pollinated wild soybean. The results demonstrated that after self-pollination and crossing with transgenic soybean, the average podding rates of 18 wild soybean populations ranged within 96.50–99.50% and 4.92–18.03%, and the average filled seed numbers per pod varied from 1.70 to 2.69 and 0.20 to 0.48, respectively. The results showed that approximately 89% of wild soybeans displayed either medium or higher than medium SC with transgenic soybean (ICSC>1.0%). This implied the high possibility of gene flow via pollen from transgenic soybean to wild soybean.

The commercial cultivation of herbicide-resistant (HR) transgenic soybeans (Glycine max L. Merr.) raises great concern that transgenes may introgress into wild soybeans (Glycine soja Sieb. et Zucc.) via pollen-mediated gene flow, which could increase the ecological risks of transgenic weed populations and threaten the genetic diversity of wild soybean. To assess the fitness of hybrids derived from transgenic HR soybean and wild soybean, the F2 and F3 descendants of crosses of the HR soybean line T14R1251-70 and two wild soybeans (LNTL and JLBC, which were collected from LiaoNing TieLing and JiLin BaiCheng, respectively), were planted along with their parents in wasteland or farmland soil, with or without weed competition. The fitness of F2 and F3 was significantly increased compared to the wild soybeans under all test conditions, and they also showed a greater competitive ability against weeds. Seeds produced by F2 and F3 were superficially similar to wild soybeans in having a hard seed coat; however, closer morphological examination revealed that the hard-seededness was lower due to the seed coat structure, specifically the presence of thicker hourglass cells in seed coat layers and lower Ca content in palisade epidermis. Hybrid descendants containing the cp4-epsps HR allele were able to complete their life cycle and produce a large number of seeds in the test conditions, which suggests that they would be able to survive in the soil beyond a single growing season, germinate, and grow under suitable conditions. Our findings indicate that the hybrid descendants of HR soybean and wild soybean may pose potential ecological risks in regions of soybean cultivation where wild soybean occurs.

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant. [ABSTRACT FROM AUTHOR]

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Vegetable proteins such as soybean protein have numerous nutritional and functional characteristics, and consequently, their utilization in meat products development has dramatically increased in recent decades. Due to high demands for soybean, transgenic Roundup Ready (RR) soybean line grains were developed and widely distributed into global markets. The current study was designed to investigate the presence of transgenic soybean in meat products sold in Riyadh food retails, Saudi Arabia. After extraction of DNA from meat product samples, qualitative duplex polymerase chain reaction (PCR) was used to detect the genetically modified (GM) soybean products in the meat samples using pairs of primers targeting the lectin gene and the 35S promoter. Real-time PCR was used to quantify the percentage of RR soy products in the positive samples. The results clarified that out of 96 tested meat product samples (minced, burger, luncheon, canned, and sausages), 75 samples were positive for the presence of lectin gene, of which 42 samples representing 43.75% of total meat product samples were positive for the presence of 35S promoter. All positive samples for 35S promoter contained RR soy below 0.1%. The results of the consumer acceptance questionnaire of GM additives in meat products proved the presence of several critical aspects of concerns to consumers of meat products in different localities of Riyadh city. [ABSTRACT FROM AUTHOR]

The evaluation of genetically modified (GM) crops regarding their effect on non-target organisms is necessary to safeguard ecosystem components. In this study, we assessed the effects of transgenic soybean events TRX (expressing the human thioredoxin gene under the control of the β-conglycinin promoter with tolerance to the herbicide glufosinate, PPT) on plant‐dwelling non-target insects and arachnids compared with those of a non‐GM parental cultivar, Gwangan soybean. Field surveys of soybean fields were carried out at Ochang and Jeonju, Korea, in 2016 and 2017. We found that the number of captured individuals was higher at Ochang in 2017 on both TRX and Gwangan soybean plants. From 2016 to 2017, the average population density of the insect pests and natural enemies decreased; however, in the case of other insects, the population density remained unchanged. The dominance index of the captured non-target insects and arachnids decreased, whereas the diversity and richness indices increased over time on the genotypes at both regions. The evenness index of non-target insects and arachnids decreased at Jeonju but showed no change at Ochang, regardless of the genotype. Hemiptera, Hymenoptera, and Diptera were the most dominant orders of the insect pests, natural enemies, and other insects, respectively. The score from PROXSCAL multidimensional scaling using combined data showed that insects and arachnids in different natural environments differed due to their cultivation regions and years, irrespective of soybean cultivars. Overall, the results indicated that the GM soybean TRX did not negatively affect the community of plant‐dwelling non-target insects and arachnids. [ABSTRACT FROM AUTHOR]

Ukraine is among the world’s top ten soybean-producing countries. The significant prevalence of Roundup transgenic soybean varieties increases the likelihood of it becoming part of farm animal feed. Accordingly, it is important to study the effect of genetically modified soy on the body of animals and to develop ways to neutralize the deviations caused by its action. A study of the effect of traditional and transgenic soy on reproductive function, physiological, biochemical and economic parameters of lactating cows. Cows’ feed intake with the addition of conventional soya had no significant effect on litter size. In the group of animals that consumed transgenic soya, there was a tendency for a reduction in the total number of newborns and an increase in the number of stillborn calves. The use of transgenic soybeans by lactating cows promotes the increase of ALT activity and alkaline phosphatase concentration. Feeding genetically modified soy to cows does not change the chemical composition of milk and does not significantly affect daily milk yield. The addition of Nano argentum citrate to the diet of animals increased the average daily milk yield throughout the experimental period. At 10 days of Nano argentum use, the cows of the experimental group had higher daily milk yields by 10.5 %, and at 20 and 30 days – by 7.5 and 6.4 %, respectively. The corrective effect of the drug Nano argentum on physiological and biochemical parameters in animals that have used transgenic soy for a long time has been established. This indicates the detoxifying properties of the drug and allows to recommend it as a means of preventive protection of animals whose diet may include genetically modified soybeans

Abstract Background Antimicrobial peptides play important roles in both plant and animal defense systems. Moreover, over-expression of CaAMP1 (Capsicum annuum antimicrobial protein 1), an antimicrobial protein gene isolated from C. annuum leaves infected with Xanthomonas campestris pv. vesicatoria, confers broad-spectrum resistance to hemibiotrophic bacterial and necrotrophic fungal pathogens in Arabidopsis. Phytophthora root and stem rot (PRR), caused by the fungus Phytophthora sojae, is one of the most devastating diseases affecting soybean (Glycine max) production worldwide. Results In this study, CaAMP1 was transformed into soybean by Agrobacterium-mediated genetic transformation. Integration of the foreign gene in the genome of transgenic soybean plants and its expression at the translation level were verified by Southern and western blot analyses, respectively. CaAMP1 over-expression (CaAMP1-OX) lines inoculated with P. sojae race 1 exhibited enhanced and stable PRR tolerance through T2–T4 generations compared with the wild-type Williams 82 plants. Gene expression analyses in the transgenic plants revealed that the expression of salicylic acid-dependent, jasmonic acid-dependent, and plant disease resistance genes (R-genes) were significantly up-regulated after P. sojae inoculation. Conclusions These results indicate that CaAMP1 over-expression can significantly enhance PRR tolerance in soybean by eliciting resistance responses mediated by multiple defense signaling pathways. This provides an alternative approach for developing soybean varieties with improved tolerance against soil-borne pathogenic PRR.

Objective Near-infrared (NIR) spectroscopy and partial least squares-discriminant analysis (PLS-DA) were applied to discriminate soybean samples as being transgenic or non-transgenic. The rapid discrimination models for transgenic soybean were established, and the optimal model was selected. Methods Principal component analysis (PCA) was used to extract relevant features from the spectral data and remove anomalous samples. In experimental studies, 94 samples were used to build models and 41 samples were used as the validation to evaluate the performance of the developed models. The effects of sample morphology (intact or ground), wavelength range and spectral pretreatment method on the correctness of the model were discussed. Results Models for intact soybean samples obtain better judgment performance than models for ground samples. The best discriminant model for intact soybean samples possessed both 100.00% discriminant correct rate in calibration and validation sets at 9 403-5 438 cm-1 using second derivative (2nd). The best discriminant model for ground soybean samples also achieved both 100.00% discriminant correct rate in calibration and validation sets at 7 505-4 597 cm-1 using standard normal variate plus first derivative (SNV+1st). Conclusion By selecting sample morphology, wavelength range and spectral pretreatment method, the discrimination model can be optimized and the discriminant correct rate can be significantly improved.

The field study was undertaken to examine the potential for adverse effects of transgenic soybean expressing bioactive human epidermal growth factor (with tolerance to the herbicide glufosinate, PPT) on the abundance and diversity of plant‐dwelling arthropods by comparing with those of a non‐GM parental cultivar, Gwangan soybean. Field surveys of soybean fields were carried out over two consecutive years, 2016 and 2017 at Ochang and Jeonju, Korea. The number of captured individuals associated with either of EGF and Gwangan soybean plants increased in 2017 compared with 2016 in both Ochang and Jeonju. During the survey period, the diversity and richness of the occurred insects and arachnids increased, dominance decreased, and the evenness of the insects remained static. The insects of Hymenoptera Order occurred most often comprised 25.4% of total captured insect pests. On the contrary, natural enemy from Hymenoptera Order and other insects from Diptera Order occurred more frequently (29.9% and 19.0%, respectively) in both the survey regions during the study periods. The score from PROXSCAL multidimensional scaling using combined data showed that the occurrence of insects and arachnids were separated due to their cultivation regions and years, irrespective of soybean cultivars. Consequently, the results indicated that there happened no notable change in the composition of arthropod communities in soybean agroecosystem due to GM event in soybean expressing EGF. [ABSTRACT FROM AUTHOR]

Key message: Proteomic and lipidomics analyses of WT and GmDGAT1-2 transgenic soybeans showed that GmDGAT1-2 over-expression induced lipoxygenase down-regulatation and oleoin up-regulatation, which significantly changed the compositions and total fatty acid. The main goal of soybean breeding is to increase the oil content. Diacylglycerol acyltransferase (DGAT) is a key rate-limiting enzyme in fatty acid metabolism and may regulate oil content. Herein, 10 GmDGAT genes were isolated from soybean and transferred into wild-type (WT) Arabidopsis. The total fatty acid was 1.2 times higher in T3GmDGAT1-2 transgenic Arabidopsis seeds than in WT. Therefore, GmDGAT1-2 was transferred into WT soybean (JACK), and four T3 transgenic soybean lines were obtained. The results of high-performance gas chromatography and Soxhlet extractor showed that, compared with those of JACK, oleic acid (18:1), and total fatty acid levels in transgenic soybean plants were much higher, but linoleic acid (18:2) was lower than WT. Palmitic acid (16:0), stearic acid (18:0), and linolenic acid (18:3) were not significantly different. For mechanistic studies, 436 differentially expressed proteins (DEPs) and 180 differentially expressed metabolites (DEMs) were identified between WT (JACK) and transgenic soybean pods using proteomic and lipidomics analyses. Four lipoxygenase proteins were down-regulated in linoleic acid metabolism while four oleosin proteins were up-regulated in the final oil formation. The results showed an increase in the total fatty acid and 18:1 composition, and a decrease in the 18:2 composition of fatty acid. Our study brings new insights into soybean genetic transformation and the deep study of molecular mechanism that changes the total fatty acid, 18:1, and 18:2 compositions in GmDGAT1-2 transgenic soybean. [ABSTRACT FROM AUTHOR]

Salt stress is an important abiotic factor that causes severe losses in soybean yield and quality. Therefore, breeding salt-tolerant soybean germplasm resources via genetic engineering has gained importance. Aspergillus glaucus, a halophilic fungus that exhibits significant tolerance to salt, carries the gene AgGlpF. In this study, we used the soybean cotyledonary node transformation method to transfer the AgGlpF gene into the genome of the soybean variety Williams 82 to generate salt-tolerant transgenic soybean varieties. The results of PCR, Southern blot, ddPCR, and RT-PCR indicated that AgGlpF was successfully integrated into the soybean genome and stably expressed. When subjected to salt stress conditions via treatment with 250 mM NaCl for 3 d, the transgenic soybean plants showed significant tolerance compared with wild-type plants, which exhibited withering symptoms and leaf abscission after 9 d. The results of this study indicated that the transfer of AgGlpF into the genome of soybean plants produced transgenic soybean with significantly improved salt stress tolerance. [ABSTRACT FROM AUTHOR]

Polymerase chain reaction (PCR) technology has become a standard technique for the detection of genetically modified organisms (GMOs). However, this method requires a PCR amplification process which is both expensive and time-consuming. Herein, we propose electric field-induced release and measurement (EFIRM) technology as an alternative method for GMO screening. The specificity and sensitivity of the EFIRM assay were proven to be comparable to those of the real-time PCR method for detecting genetically modified soybeans. After all the parameters had been evaluated, the actual evaluation of soybean samples from soybean cargoes was performed. An actual EFIRM screening was performed on 157 soybean cargo samples, which had 102 transgenic soybean samples containing the GTS-40-3-2 gene, through a blind trial at the Dalian port of China. Our results showed that 101 transgenic soybean samples were correctly detected, with only one false-negative case, and 55 non-transgenic soybean samples were detected as negative; this demonstrates that the EFIRM assay is an effective, accurate, simple, and economical novel method for detecting transgenic products, which may have a positive impact on the development of rapid on-site GMO monitoring platforms. [ABSTRACT FROM AUTHOR]

Genetically modified (GM) soybeans expressing Cry1A.105/Cry2Ab2/Cry1Ac (event MON 87701 × MON 89788 × MON 87751 × MON 87708) and Cry1Ac (event MON 87701 × MON 89788) from Bacillus thuringiensis Berliner (Bt) are valuable technologies for managing key lepidopteran pests of soybean in South America, but do not provide stand-alone protection against Spodoptera species. Here, we evaluated the use of these Bt soybeans and their integration with insecticides for managing Spodoptera species. Cry1A.105/Cry2Ab2/Cry1Ac soybean provided reasonable levels of protection against S. cosmioides, S. albula, and S. eridania. However, S. frugiperda had higher survival on this Bt soybean, and Cry1Ac soybean showed low lethality against all species evaluated. Spodoptera larvae that survived on Bt and non-Bt soybean showed comparable susceptibility to flubendiamide and thiodicarb in diet-overlay bioassays. Regardless of soybean plant type, the field doses of flubendiamide and thiodicarb were effective in controlling surviving Spodoptera larvae. We conclude that Cry1A.105/Cry2Ab2/Cry1Ac soybean is effective in controlling S. cosmioides and S. albula, and also has reasonable control of S. eridania, but not S. frugiperda. Cry1Ac soybean provided poor control of all Spodoptera species. Nonetheless, Spodoptera larvae surviving on both Bt and non-Bt soybean were controlled by flubendiamide and thiodicarb. Thus, integrated control tactics would provide effective management of Spodoptera species in Bt soybean fields in South America.

The introduction of herbicide-tolerant (HT) transgenic soybeans (Glycine max (L.) Merr.) into farming systems raises great concern that transgenes may flow to endemic wild soybeans (Glycine soja Sieb. et Zucc.) via pollen, which may increase the ecological risks by increasing the fitness of hybrids under certain conditions and threaten the genetic diversity of wild soybean populations. In order to demonstrate the potential risk of gene flow from the HT soybean to the wild soybean, the fitness of F2 and F3 hybrids obtained from two wild soybean populations (HLJHRB-1, JSCZ) collected from China and the HT soybean was measured under farmland and wasteland soil conditions, as well as with or without weed competition. Compared with their wild progenitors, the F2 and F3 hybrids of HLJHRB-1 displayed a higher emergence rate, higher aboveground dry biomass, more pods and filled-seed plants, as well as better composite fitness under four planting conditions. The F2 and F3 hybrids of JSCZ also displayed a higher emergence rate, higher aboveground dry biomass, more pods, and more filled seeds per plant under mixed planting, whereas these characteristics were lower under pure planting conditions in wasteland and farmland soil. Therefore, the composite fitness of JSCZ hybrids was higher or lower depending on the planting conditions. Furthermore, the soil microbial communities of the F3 of HLJHRB-1, JSCZ, and the wild soybean were investigated with 16S rDNA sequencing, which showed that low alpha diversity of rhizobacteria was relative to high fitness, and Rhizobium played an important role in promoting F3 plant growth.

Modern agriculture has gained significant economic benefits worldwide with the use of genetically modified (GM) technologies. While GM crops provide convenience to humans, their biosafety has attracted increasing concern. In this study, the Illumina MiSeq was used to perform a high-throughput sequencing of the V3-V4 hypervariable regions of 16S rRNA gene (16S rDNA) amplicons to compare the rhizosphere bacterial communities of the EPSPS/GAT dual transgenic glyphosate-tolerant soybean line Z106, its recipient variety ZH10, and Z106 with glyphosate application (Z106G) during flowering, seed filling, and maturing stages under field settings. At each of the three stages, the alpha and beta diversity of rhizosphere bacterial communities revealed no significant differences between ZH10, Z106, and Z106G. However, some bacterial taxa demonstrated a greater proportional contribution, particularly the nitrogen-fixing rhizobium Ensifer fredii, in the rhizospheric soil of Z106 at the seed filling and maturing stages, when compared to ZH10 and Z106G. The present study therefore suggests that the EPSPS/GAT dual transgenic line Z106 and exogenous glyphosate application have a minimal effect on the composition of the soybean rhizosphere bacterial community but have no impact on the structure of the rhizosphere microbial community during a single planting season. [ABSTRACT FROM AUTHOR]

Abstract Background Cry8-like from Bacillus thuringiensis (Bt) encodes an insecticidal crystal (Cry) protein. Holotrichia parallela (Coleoptera: Scarabaeoidae), commonly known as the dark black chafer, is a troublesome pest of soybean (Glycine max). To test whether cry8-like can confer resistance against H. parallela to soybean, we introduced cry8-like from the Bt strain HBF-18 into soybean cultivar Jinong 28. Results Quantitative reverse transcription-PCR analysis demonstrated that cry8-like was expressed most highly in soybean leaves. In addition, Southern blot assays revealed that one copy of the integrated fragment was present in the transformed plants. Eight independent cry8-like transgenic lines were subsequently fed on by H. parallela. Under H. parallela feeding stress, the survival rates of the non-transgenic plants were 92% lower than those of the transgenic plants. The mortality rate of H. parallela increased when the larvae fed on the roots of T1 transgenic soybean plants. Moreover, the surviving larvae were deformed, and their growth was inhibited. Conclusions Collectively, our data suggest that transgenic soybean plants expressing the cry8-like gene are more resistant to H. parallela than non-transgenic plants and that transgenic expression of the cry8-like gene may represent a promising strategy for engineering pest tolerance. The events generated in this study could thus be utilized in soybean breeding programs.

Glyphosate is a highly efficient, broad-spectrum nonspecific herbicide that inhibits the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS)-mediated pathway of shikimic acid. The screening of glyphosate-resistant EPSPS gene is a major means for the development of new genetically modified glyphosate-resistant transgenic crop. Currently, the main commercialized glyphosate-resistant soybean contains glyphosate-resistant gene CP4-EPSPS. In this study, a G10-EPSPS gene was reported providing glyphosate resistance in Zhongdou 32. Here, G10-EPSPS gene was introduced into soybeans through Agrobacterium-mediated soybean cotyledon node. PCR, Southern blotting, semi-quantitative RT-PCR, qRT-PCR, and Western blotting were used, and the results revealed that G10-EPSPS had been integrated into the soybean genome and could be expressed steadily at both mRNA and protein levels. In addition, glyphosate resistance analysis showed that the growth of transgenic soybean had not been affected by concentrations of 900 and 2700 g a.e. ha−1 of glyphosate. All the results indicated that G10-EPSPS could provide high glyphosate resistance in soybeans and be applied in production of glyphosate-resistant soybean.

With the development and application of transgenic technology, enrichment and degradation of transgnic foreign protein in environment has become a public concern. Detection and monitoring of exogenous protein in the environment has become a direction of genetically modified organism research and supervision. In this study, transgenic soybean (5% GTS40-3-2) seeds containing CP4-EPSPS protein were treated by simulated natural degradation and protease K. Western blot, lateral flow test strip and enzyme linked immunosorbent assay (ELISA) were selected to detect the presence of CP4-EPSPS. The results showed that CP4-EPSPS was gradually degraded under simulated natural degradation conditions, and completely degraded in about 17 weeks. In the condition of protease K treatment, CP4-EPSPS was rapidly degraded in 9 hours. This study explored the degradation rule of CP4-EPSPS in natural environment. And it provided new ideas for the future research of rapid, safe and effective degradation of CP4-EPSPS. [ABSTRACT FROM AUTHOR]

Research, production, and use of genetically modified (GM) crops have split the world between supporters and opponents. Up to now, this technology has been limited to the control of weeds and pests, whereas the second generation of GM crops is expected to assist farmers in abiotic stress tolerance or improved nutritional features. Aiming to analyze this subject holistically, in this presentation we address an advanced technology for drought-tolerant GM crops, upscaling from molecular details obtained in the laboratory to an extensive network of field trials as well as the impact of the introduction of this innovation into the market. Sunflower has divergent transcription factors, which could be key actors in the drought response orchestrating several signal transduction pathways, generating an improved performance to deal with water deficit. One of such factors, HaHB4, belongs to the homeodomain-leucine zipper family and was first introduced in Arabidopsis. Transformed plants had improved tolerance to water deficits, through the inhibition of ethylene sensitivity and not by stomata closure. Wheat and soybean plants expressing the HaHB4 gene were obtained and cropped across a wide range of growing conditions exhibiting enhanced adaptation to drought-prone environments, the most important constraint affecting crop yield worldwide. The performance of wheat and soybean, however, differed slightly across mentioned environments; whereas the improved behavior of GM wheat respect to controls was less dependent on the temperature regime (cool or warm), differences between GM and wild-type soybeans were remarkably larger in warmer compared to cooler conditions. In both species, these GM crops are good candidates to become market products in the near future. In anticipation of consumers’ and other stakeholders’ interest, spectral analyses of field crops have been conducted to differentiate these GM crops from wild type and commercial cultivars. In this paper, the potential impact of the release of such market products is discussed, considering the perspectives of different stakeholders.

Considering that the genetically modified soybean lectin gene is affected by the gene type, to improve the stability of the genetically modified soybean lectin gene, a method based on fluorescence quantitative PCR to analyze the genetic characteristics of the genetically modified soybean lectin was proposed. The common soybean varieties, Wangshuibai and Huangdou No. 3 were selected as materials for tissue-specific expression analysis. Under the background conditions of analyzing the genetically modified soybean lectin genes, fluorescent quantitative PCR was applied to the analysis of genetic characteristics. The characteristics of the genetically modified soybean lectin gene were analyzed in terms of location characteristics and expression characteristics. The results showed that the soybean lectin gene has a complex functional mechanism and may participate in a variety of stress-related regulatory or signal transduction pathways in different ways; Lectin2.1 transcripts are expressed in abundance in glume and lemma in seedling tips, Lectin2.2 was mainly expressed in the roots, and a small amount was expressed in leaves and lemma; Lectin2.1 and Lectin2.2 are highly similar in nucleic acid and amino acid composition, and have similar subcellular localization characteristics. [ABSTRACT FROM AUTHOR]

The releasing of transgenic soybeans (Glycine max (L.) Merr.) into farming systems raises concerns that transgenes might escape from the soybeans via pollen into their endemic wild relatives, the wild soybean (Glycine soja Sieb. et Zucc.). The fitness of F1 hybrids obtained from 10 wild soybean populations collected from China and transgenic glyphosate-resistant soybean was measured without weed competition, as well as one JLBC-1 F1 hybrid under weed competition. All crossed seeds emerged at a lower rate from 13.33–63.33%. Compared with those of their wild progenitors, most F1 hybrids were shorter, smaller, and with decreased aboveground dry biomass, pod number, and 100-seed weight. All F1 hybrids had lower pollen viability and filled seeds per plant. Finally, the composite fitness of nine F1 hybrids was significantly lower. One exceptional F1 hybrid was IMBT F1, in which the composite fitness was 1.28, which was similar to that of its wild progenitor due to the similarities in pod number, increased aboveground dry biomass, and 100-seed weight. Under weed competition, plant height, aboveground dry biomass, pod number per plant, filled seed number per plant, and 100-seed weight of JLBC-1 F1 were lower than those of the wild progenitor JLBC-1. JLBC-1 F1 hybrids produced 60 filled seeds per plant. Therefore, F1 hybrids could emerge and produce offspring. Thus, effective measures should be taken to prevent gene flow from transgenic soybean to wild soybean to avoid the production F1 hybrids when releasing transgenic soybean in fields in the future. [ABSTRACT FROM AUTHOR]

BACKGROUND Spodoptera eridania (Stoll), S. cosmioides (Walker) and S. albula (Walker) (Lepidoptera: Noctuidae) are considered secondary pests of soybean in South America. The genetically‐modified soybean DAS‐444Ø6‐6 × DAS‐81419‐2 with tolerance to 2,4‐dichlorophenoxyacetic acid (2,4‐D), glyphosate and ammonium glufosinate herbicides (event DAS‐444Ø6‐6) and insect‐resistance due to expression of Cry1Ac and Cry1F Bt proteins (event DAS‐81419‐2) may provide a potential tool for integrated pest management (IPM) of these species in soybean fields. Based on this, we conducted bioassays to evaluate the survival and development of S. eridania, S. cosmioides and S. albula fed on Cry1Ac/Cry1F‐soybean leaf tissue. RESULTS: Spodoptera eridania and S. cosmioides fed on Cry1Ac/Cry1F‐soybean showed longer developmental time, lower larval and egg to adult survival compared to those fed on non‐Bt soybean, reducing the population growth of these species. Spodoptera albula also had lower larval survival and number of insects that reached adulthood on Cry1Ac/Cry1F‐soybean. However, no significant effects of Cry1Ac/Cry1F‐soybean on population growth parameters were detected in this species. CONCLUSIONS: Soybean with stacked events DAS‐444Ø6‐6 × DAS‐81419‐2 expressing Cry1Ac/Cry1F Bt proteins provide population suppression of S. eridania and S. cosmioides. However, this Bt soybean had minimal effects on S. albula, and is unlikely to have negative population‐level effects on this species. It is expected that under field conditions, other control tactics must be integrated with Cry1Ac/Cry1F‐soybean for the management of these Spodoptera species. © 2020 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. [ABSTRACT FROM AUTHOR]

Copyright of Scientific Journal 'Animal Science & Food Technologies' is the property of National University of Life & Environmental Sciences of Ukraine and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Low availability of inorganic phosphate (Pi) in soil is often a limiting factor for plant growth and productivity. The Pi transporter plays an important role in the absorption and utilization of phosphorus in plants. Eutrema salsugineum shows strong tolerance under Pi stress conditions, but the function of the E. salsugineum PHT1 genes has not yet been systematically studied.This study isolated a phosphate transporter gene (EsPHT1;1) from the halophyte E. salsugineum and functionally characterized it in the herbaceous model plant, Arabidopsis thaliana, and in an important oil crop species, soybean (Glycine max (L.) Merr.).Under Pi deficient conditions, transgenic Arabidopsis and transgenic soybean grew better and exhibited significant improvement in root growth, biomass accumulation and seed yield compared with wild‐type (WT) plants. These phenotypic enhancements were more apparent under inadequate Pi conditions than under sufficient or no Pi conditions, which is in agreement with the observation that the transgenic plants accumulated higher amounts of Pi and total P in shoots and roots than WT plants only when inadequate Pi was supplied.The results of the present study indicate that overexpression of EsPHT1;1 can efficiently enhance the growth and reproductive performance of both Arabidopsis and soybean plants challenged by low P stress, which results confirm the important role of PHT1;1 in dealing with Pi deficiency. [ABSTRACT FROM AUTHOR]

Copyright of Journal of Food Safety & Quality is the property of Journal of Food Safety & Quality Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: Antimicrobial peptides play important roles in both plant and animal defense systems. Moreover, over-expression of CaAMP1 (Capsicum annuum antimicrobial protein 1), an antimicrobial protein gene isolated from C. annuum leaves infected with Xanthomonas campestris pv. vesicatoria, confers broad-spectrum resistance to hemibiotrophic bacterial and necrotrophic fungal pathogens in Arabidopsis. Phytophthora root and stem rot (PRR), caused by the fungus Phytophthora sojae, is one of the most devastating diseases affecting soybean (Glycine max) production worldwide. Results: In this study, CaAMP1 was transformed into soybean by Agrobacterium-mediated genetic transformation. Integration of the foreign gene in the genome of transgenic soybean plants and its expression at the translation level were verified by Southern and western blot analyses, respectively. CaAMP1 over-expression (CaAMP1-OX) lines inoculated with P. sojae race 1 exhibited enhanced and stable PRR tolerance through T2–T4 generations compared with the wild-type Williams 82 plants. Gene expression analyses in the transgenic plants revealed that the expression of salicylic acid-dependent, jasmonic acid-dependent, and plant disease resistance genes (R-genes) were significantly up-regulated after P. sojae inoculation. Conclusions: These results indicate that CaAMP1 over-expression can significantly enhance PRR tolerance in soybean by eliciting resistance responses mediated by multiple defense signaling pathways. This provides an alternative approach for developing soybean varieties with improved tolerance against soil-borne pathogenic PRR. [ABSTRACT FROM AUTHOR]

Soybean (Glycine max L.) is the world's largest source of protein feed and the second largest source of vegetable oil. Water restriction is the main limiting factor to achieve maximum soybean yields. Therefore, development of varieties that maintain yield under environmental stresses is a major objective of soybean breeding programs. The HaHB4 (Helianthus annuus homeobox 4) gene from sunflower encodes for a transcription factor involved in the plant´s tolerance to environmental stress. The introduction of HaHB4 in soybean led to the development of event IND-ØØ41Ø-5 (HB4® soybean), which displayed higher yield in environments having low productivity potential, compared with the parental control variety. Compositional analyses of soybean event IND-ØØ41Ø-5 were conducted both in Argentina and the United Sates. A total of 44 components were analyzed in grain and 9 components in forage. Based on the results of these studies it was concluded that soybean event IND-ØØ41Ø-5 was compositionally equivalent to its non-transgenic parental control. [ABSTRACT FROM AUTHOR]

Soybean yield is limited primarily by abiotic constraints. No transgenic soybean with improved abiotic stress tolerance is commercially available. We transformed soybean plants with genetic constructs able to express the sunflower transcription factor HaHB4, which confers drought tolerance to Arabidopsis and wheat. One line (b10H) carrying the sunflower promoter was chosen among three independent lines because it exhibited the best performance in seed yield, and was evaluated in the greenhouse and in 27 field trials in different environments in Argentina. In greenhouse experiments, transgenic plants showed increased seed yield under stress conditions together with greater epicotyl diameter, larger xylem area, and increased water use efficiency compared with controls. They also exhibited enhanced seed yield in warm and dry field conditions. This response was accompanied by an increase in seed number that was not compensated by a decrease in individual seed weight. Transcriptome analysis of plants from a field trial with maximum difference in seed yield between genotypes indicated the induction of genes encoding redox and heat shock proteins in b10H. Collectively, our results indicate that soybeans transformed with HaHB4 are expected to have a reduced seed yield penalty when cultivated in warm and dry conditions, which constitute the best target environments for this technology. [ABSTRACT FROM AUTHOR]

Lunasin, a bioactive peptide with a variety of physiological functions, was overexpressed in soybean to generate a transgenic soybean. Polymerase chain reaction (PCR) analysis suggested that lunasin was successfully inserted into the soybean genome, and three transgenic lines, L12, L43, and L45, were selected for further study. Lunasin expression was characterized in the lines by Western blot and ultra-performance liquid chromatography with tandem mass spectrometry. Enzyme-linked immunosorbent assay showed that lunasin content in L12, L43, and L45 lines was 1.47 mg g−1, 1.32 mg g−1 and 1.98 mg g−1, respectively; these values were significantly higher than that in wild-type soybean (0.94 mg g−1). Lunasin enrichments from transgenic soybean (LET) exhibited stronger DPPH, ABTS+, and oxygen radical scavenging activity than lunasin enrichments from wild-type soybean (LEW). Further, LET presented superior anti-inflammatory activity on lipopolysaccharide-induced macrophage cells compared to LEW, and it significantly suppressed the release of nitric oxide (NO) and pro-inflammatory cytokines including interleukin-1 and -6. Moreover, LET showed higher anti-proliferation activity on MDA-MB-231 cells than LEW. Immunofluorescence staining showed that LET could internalize into NIH-3T3 cells, and localize in the nucleus. In conclusion, it is feasible and efficient to produce lunasin through a transgenic soybean expression system. Lunasin overexpressing soybean could be consumed as a functional food in the diets of patients with cancer and obesity in the future. [ABSTRACT FROM AUTHOR]