Search

Objectives: To investigate discordance in oxy-hemoglobin saturation measured both by pulse oximetry (SpO 2 ) and arterial blood gas (ABG, SaO 2 ) among critically ill coronavirus disease 2019 (COVID-19(+)) patients compared to COVID-19(-) patients., Methods: Paired SpO 2 and SaO 2 readings were collected retrospectively from consecutive adult admissions to four critical care units in the United States between March and May 2020. The primary outcome was the rate of discordance (|SaO 2 -SpO 2 |>4%) in COVID-19(+) versus COVID-19(-) patients. The odds each cohort could have been incorrectly categorized as having a PaO 2 /FiO 2 above or below 150 by their SpO 2 : Fractional inhaled oxygen ratio (pulse oximetry-derived oxyhemoglobin saturation:fraction of inspired oxygen ratio [SF]) was examined. A multivariate regression analysis assessed confounding by clinical differences between cohorts including pH, body temperature, renal replacement therapy at time of blood draw, and self-identified race., Results: There were 263 patients (173 COVID-19(+)) included. The rate of saturation discordance between SaO 2 and SpO 2 in COVID-19(+) patients was higher than in COVID-19(-) patients (27.9% vs 16.7%, odds ratio [OR] 1.94, 95% confidence interval [CI]: 1.11 to 2.27). The average difference between SaO 2 and SpO 2 for COVID-19(+) patients was -1.24% (limits of agreement, -13.6 to 11.1) versus -0.11 [-10.3 to 10.1] for COVID-19(-) patients. COVID-19(+) patients had higher odds (OR: 2.61, 95% CI: 1.14-5.98) of having an SF that misclassified that patient as having a PaO 2 :FiO 2 ratio above or below 150. There was not an association between discordance and the confounders of pH, body temperature, or renal replacement therapy at time of blood draw. After controlling for self-identified race, the association between COVID-19 status and discordance was lost., Conclusions: Pulse oximetry was discordant with ABG more often in critically ill COVID-19(+) than COVID-19(-) patients. However, these findings appear to be driven by racial differences between cohorts., Competing Interests: Declaration of Conflicting InterestsThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Breeding program to improve economically important growth traits in striped catfish (Pangasianodon hypophthalmus) requires effective molecular markers. This study was conducted to identify single nucleotide polymorphisms (SNPs) of Insulin-like Growth Factor-Binding Protein 7 (IGFBP7) gene which plays multiple roles in regulating growth, energy metabolism and development. The association between SNPs in IGFBP7 gene and growth traits in striped catfish was analyzed in order to uncover the SNPs that have potential to be valuable markers for improving growth traits. Firstly, fragments of IGFBP7 gene from ten fast-growing fish and ten slow-growing fish were sequenced in order to discover SNPs. After filtering the detected SNPs, an intronic SNP (2060A > G) and two non-synonymous SNPs (344 T > C and 4559C > A) causing Leu78Pro and Leu189Met in protein, respectively, were subjected to further validated by individual genotyping in 70 fast-growing fish and 70 slow-growing fish using single base extension method. Our results showed that two SNPs (2060A > G and 4559 C > A (p. Leu189Met)) were significantly associated with the growth in P. hypophthalmus (p < 0.001), thus being candidate SNP markers for the growth traits of this fish. Moreover, linkage disequilibrium and association analysis with growth traits of haplotypes generated from the 3 filtered SNPs (344 T > C, 2060 A > G and 4559 C > A) were examined. These revealed that the non-coding SNP locus (2060A > G) had higher genetic diversity at which the G allele was predominant over the A allele in the fast-growing fish. Furthermore, the results of qPCR showed that expression of IGFBP7 gene with genotype GG (at locus 2060) in fast-growing group was significantly higher than that with genotype AA in slow-growing group (p < 0.05). Our study provides insights into the genetic variants of IGFBP7 gene and useful data source for development molecular marker for growth traits in breeding of the striped catfish., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Steel slag is an industrial by product of steel manufacturing processes and has been widely utilized within civil and construction materials for road materials and environmental remediation in countries like Japan, USA, and European Union nations. However, the current utilization of steel slag in Vietnam is very low mainly because of lack of quality control of slag treatment and chances for reuse of treated steel slag. This paper presents the up to date steel slag production status in Vietnam through the extensive survey and sampling at seven large steel factories. The paper also highlights the environmental and quality control issues of these steel slags to use as road construction aggregates by assessing the heavy metals concentration in the leachate. The basic oxygen furnace (BOF) and electric arc furnace (EAF) slag samples were collected to evaluate leaching properties of metals leached from the slags. The two standardized batch leaching tests of steel slag roadbed material in Japan (JIS K 0058-1) and toxicity characteristics leaching procedure (TCLP-EPA method 1311) were performed to the evaluated the hazardous metals. The results of the leaching test show that almost all of the concentration of the metals in the leached solution does not exceed the National Standard for Industrial Wastewater Discharge (QCVN 40-2011). The pH and parameters such as total chromium, nickel, copper, lead, arsenic, and manganese differ from the two test methods. The acidic conditions employed in the EPA 1311 were not representative of condition excepted during slag reuse in road constructions because in the operation condition of the road, acidic liquid is absent. The leaching test results confirmed that JIS test which uses deionized water with gentle mixing prevents the slag sample from size degradation is suitable for the environmental assessment of steel slag use for roadbed material. This research suggests that the adjustment of pH value prior to disposal or reuse as base materials and official guideline should be promulgate by the authorities to ensure the leachate meet the surface water quality standard., (© 2021. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

The microstructure directly influences the subsequent mechanical properties of materials. In the manufactured parts, the elaboration processes set the microstructure features such as phase types or the characteristics of defects and grains. In this light, this article aims to understand the evolution of the microstructure during the directed energy deposition (DED) manufacturing process of Ti6Al4V alloy. It sets out a new concept of time-phase transformation-block (TTB). This innovative segmentation of the temperature history in different blocks allows us to correlate the thermal histories computed by a 3D finite element (FE) thermal model and the final microstructure of a multilayered Ti6Al4V alloy obtained from the DED process. As a first step, a review of the state of the art on mechanisms that trigger solid-phase transformations of Ti6Al4V alloy is carried out. This shows the inadequacy of the current kinetic models to predict microstructure evolution during DED as multiple values are reported for transformation start temperatures. Secondly, a 3D finite element (FE) thermal simulation is developed and its results are validated against a Ti6Al4V part representative of repair technique using a DED process. The building strategy promotes the heat accumulation and the part exhibits heterogeneity of hardness and of the nature and the number of phases. Within the generated thermal field history, three points of interest (POI) representative of different microstructures are selected. An in-depth analysis of the thermal curves enables distinguishing solid-phase transformations according to their diffusive or displacive mechanisms. Coupled with the state of the art, this analysis highlights both the variable character of the critical points of transformations, and the different phase transformation mechanisms activated depending on the temperature value and on the heating or cooling rate. The validation of this approach is achieved by means of a thorough qualitative description of the evolution of the microstructure at each of the POI during DED process. The new TTB concept is thus shown to provide a flowchart basis to predict the final microstructure based on FE temperature fields.

We studied sandfly (Diptera: Psychodidae) populations in six provinces of Vietnam. This work explores the diversity of sandfly species according to the province, as well as environment, and updated information on public health since leishmaniasis cases were reported in two provinces. Sandflies were collected using 428 CDC light traps from May 30 to October 13, 2016 and identified based on the morphology of the cibarium, pharynx and/or male genitalia or female spermathecae. A total of 2585 sandflies belonging to five genera and 13 identified species were collected. The main species were: the Sergentomyia barraudi group (12.53%), Se. sylvatica (9.63%) and Phlebotomus stantoni (3.95%). In all, 294 Sergentomyia specimens classified as Se. sp2 and Se. sp3 and a heterogeneous group, herein called Se. und&#95;sp., showed unknown morphological characteristics requiring further studies. We provide detailed comments about morphological description and taxonomical identification in order to help standardization of sandfly classification in Southeast Asia. We observed differentiation according to the provinces in terms of density and species richness, with Lang Son having the highest density and Ninh Binh having the highest species richness. The majority of specimens were collected in rock caves and outdoors, suggesting mainly cavernicolous and exophilic characters of sandfly species in Northern Vietnam. However, specimens were also collected in intra- and peri-domiciliary sites. It is worth noting that Ph. stantoni was the main species found in dog sheds and indoors, and in particular in a leishmaniasis patient's house., (© S.N. Vu et al., published by EDP Sciences, 2021.)

In this study, we present an analysis of metagenome sequences obtained from a filtrate of a siphon tissue homogenate of otter clams (Lutraria rhynchaena) with swollen-siphon disease. The viral signal was mined from the metagenomic data, and a novel circular ssDNA virus was identified. Genomic features and phylogenetic analysis showed that the virus belongs to the phylum Cressdnaviricota, which consists of viruses with circular, single-stranded DNA (ssDNA) genomes. Members of this phylum have been identified in various species and in environmental samples. The newly found virus is distantly related to the currently known members of the phylum Cressdnaviricota.

The Drosophila Hedgehog receptor functions to regulate the essential downstream pathway component, Smoothened, and to limit the range of signaling by sequestering Hedgehog protein signal within imaginal disc epithelium. Hedgehog receptor function requires both Patched and Ihog activity, the latter interchangeably encoded by interference hedgehog (ihog) or brother of ihog (boi). Here we show that Patched and Ihog activity are mutually required for receptor endocytosis and degradation, triggered by Hedgehog protein binding, and causing reduced levels of Ihog/Boi proteins in a stripe of cells at the anterior/posterior compartment boundary of the wing imaginal disc. This Ihog spatial discontinuity may contribute to classically defined cell segregation and lineage restriction at the anterior/posterior wing disc compartment boundary, as suggested by our observations that Ihog activity mediates aggregation of otherwise non-adherent cultured cells and that loss of Ihog activity disrupts wing disc cell segregation, even with downstream genetic rescue of Hedgehog signal response.

Organic fertilizer application is often touted as an economical and effective method to increase soil fertility. However, this amendment may increase dissolved organic carbon (DOC) runoff into downstream aquatic ecosystems and may consequently alter aquatic microbial community. We focused on understanding the effects of DOC runoff from soils amended with compost, vermicompost, or biochar on the aquatic microbial community of a tropical reservoir. Runoff collected from a series of rainfall simulations on soils amended with different organic fertilizers was incubated for 16 days in a series of 200 L mesocosms filled with water from a downstream reservoir. We applied 454 high throughput pyrosequencing for bacterial 16S rRNA genes to analyze microbial communities. After 16 days of incubation, the richness and evenness of the microbial communities present decreased in the mesocosms amended with any organic fertilizers, except for the evenness in the mesocosms amended with compost runoff. In contrast, they increased in the reservoir water control and soil-only amended mesocosms. Community structure was mainly affected by pH and DOC concentration. Compared to the autochthonous organic carbon produced during primary production, the addition of allochthonous DOC from these organic amendments seemed to exert a stronger effect on the communities over the period of incubation. While the Proteobacteria and Actinobacteria classes were positively associated with higher DOC concentration, the number of sequences representing key bacterial groups differed between mesocosms particularly between the biochar runoff addition and the compost or vermi-compost runoff additions. The genera of Propionibacterium spp. and Methylobacterium spp. were highly abundant in the compost runoff additions suggesting that they may represent sentinel species of complex organic carbon inputs. Overall, this work further underlines the importance of studying the off-site impacts of organic fertilizers as their impact on downstream aquatic systems is not negligible.

Black spot, also known as Ascochyta blight, is the most important disease on field pea (Pisum sativum). It is caused by a complex of pathogens, the most important of which in Australia include Didymella pinodes, Phoma pinodella, and P. koolunga. The relative proportions of these and other component pathogens of the complex fluctuate widely across time and geographic locations in Australia, limiting the ability of breeders to develop varieties with effective resistance to black spot. To address this, 40 field pea genotypes were tested under controlled environment conditions for their individual stem and leaf responses against these three pathogens. Disease severity was calculated as area under disease progress curve (AUDPC), and subsequently converted to mean rank (MR). The overall rank (OR) for each pathogen was used to compare response of genotypes under inoculation with each pathogen. The expressions of host resistance across the field pea genotypes were largely dependent upon the individual test pathogen and whether the test was on stem or leaf. Overall, P. koolunga caused most severe stem disease; significantly more severe than either D. pinodes or P. pinodella. This is the first report of the host resistance identified in field pea to P. koolunga; the five genotypes showing highest resistance on stem, viz. 05P778-BSR-701, ATC 5338, ATC 5345, Dundale, and ATC 866, had AUDPC MR values <250.4, while the AUDPC MR values of the 19 genotypes showing the best resistance on leaf was less than 296.8. Two genotypes, ATC 866 and Dundale, showed resistance against P. koolunga on both stem and leaf. Against D. pinodes, the four and 16 most resistant genotypes on stem and leaf had AUDPC MR values <111.2 and <136.6, respectively, with four genotypes showing resistance on both stem and leaf including 05P770-BSR-705, Austrian Winter Pea, 06P822-(F5)-BSR-6, and 98107-62E. Against P. pinodella, four and eight genotypes showing the best resistance on stem and leaf had AUDPC MR values <81.3 and <221.9, respectively; three genotypes, viz. 98107-62E, Dundale, and Austrian Winter Pea showed combined resistance on stem and leaf. A few genotypes identified with resistance against two major pathogens of the complex will be of particular significance to breeding programs. These findings explain why field pea varieties arising from breeding programs in Australia fail to display the level or consistency of resistance required against black spot and why there needs to be a wider focus than D. pinodes in breeding programs.

Black spot (also referred to as Ascochyta blight, Ascochyta foot rot and black stem, and Ascochyta leaf and pod spot) is a devastating disease of pea (Pisum sativum) caused by one or more pathogenic fungi, including Didymella pinodes, Ascochyta pisi, and Phoma pinodella. Surveys were conducted across pea-growing regions of Western Australia in 1984, 1987, 1989, 1996, 2010, and 2012. In total, 1,872 fungal isolates were collected in association with pea black spot disease symptoms. Internal transcribed spacer regions from representative isolates, chosen based on morphology, were sequenced to aid in identification. In most years and locations, D. pinodes was the predominant pathogen in the black spot complex. From 1984 to 2012, four new pathogens associated with black spot symptoms on leaves or stems (P. koolunga, P. herbarum, Boeremia exigua var. exigua, and P. glomerata) were confirmed. This study is the first to confirm P. koolunga in association with pea black spot symptoms in field pea in Western Australia and show that, by 2012, it was widely present in new regions. In 2012, P. koolunga was more prevalent than D. pinodes in Northam and P. pinodella in Esperance. P. herbarum and B. exigua var. exigua were only recorded in 2010. Although A. pisi was reported in Western Australia in 1912 and again in 1968 and is commonly associated with pea black spot in other states of Australia and elsewhere, it was not recorded in Western Australia from 1984 to 2012. It is clear that the pathogen population associated with the pea black spot complex in Western Australia has been dynamic across time and geographic location. This poses a particular challenge to development of effective resistance against the black spot complex, because breeding programs are focused almost exclusively on resistance to D. pinodes, largely ignoring other major pathogens in the disease complex. Furthermore, development and deployment of effective host resistance or fungicides against just one or two of the pathogens in the disease complex could radically shift the make-up of the population toward pathogen species that are least challenged by the host resistance or fungicides, creating an evolving black spot complex that remains ahead of breeding and other management efforts.

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as "black spot disease" in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5'GTTTCCGTAGGTGAACCTGC 3') and AB28 (5'ATATGCTTAAGTTCAGCGGGT 3') were used to amplify extracted DNA from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 10 6 conidia ml -1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation., (Copyright 2010 Elsevier Inc. All rights reserved.)

Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation., (Copyright 2009 Elsevier Inc. All rights reserved.)

Peripherally inserted central venous catheter (PICC) lines have become a frequently used method of intravenous access for long-term administration of antibiotics, chemotherapy, and parenteral nutrition. Catheter-related complications involving the arterial tree are rare. We report a case of a 25-year-old woman with a history of difficult PICC line placement that presented with an arteriovenous fistula in the left arm. Duplex ultrasound confirmed the diagnosis of a brachial artery-to-brachial vein arteriovenous fistula (AVF), and the patient underwent surgical repair. To our knowledge, this is the first reported case of an AVF resulting from PICC line placement. Correction of AVF is indicated to alleviate symptoms as well as to prevent future complications.

Acute acalculous cholecystitis remains a diagnostic challenge in critically ill trauma patients. Laboratory studies are nonspecific and associated injuries or mental status changes may mask clinical signs and symptoms. We conducted a retrospective study to assess the utility of ultrasound in the diagnosis of acute acalculous cholecystitis. We hypothesized that ultrasound is inadequate as a screening tool for acute acalculous cholecystitis. The abdominal ultrasounds of all patients undergoing evaluation for acute acalculous cholecystitis in a 40-month period at our Level I trauma center were reviewed. Thickened gallbladder wall, pericholecystic fluid and emphysematous gallbladder were considered positive sonographic criteria. Sludge, cholelithiasis, and hydrops were considered suggestive. Patients who did not undergo cholecystectomy had their gallbladders evaluated either during subsequent laparotomy or at autopsy or they were discharged from the hospital without need for intervention. Sixty-two patients were included. Twenty-one patients underwent cholecystectomy for presumed acute acalculous cholecystitis. The data revealed a sensitivity of 30 per cent (6/20) and a specificity of 93 per cent (39/42) for ultrasound evaluation. Twenty patients had subsequent hepatobiliary scans [hepato-iminodiacetic acid (HIDA)] with a sensitivity of 100 per cent (12/12) and specificity of 88 per cent (7/8). Our data do not support ultrasound as a reliable routine screening tool for acute acalculous cholecystitis. Despite its convenience as a bedside procedure ultrasound has insufficient sensitivity to justify its use and a more sensitive diagnostic tool should be used.

Objective: This study evaluated whether prostacyclin is a necessary mediator of inflammation in graded bacteremia or is sufficient alone in pathophysiologic concentrations to cause the pulmonary derangement of bacteremic shock., Design: Experimental., Setting: Laboratory., Subjects: Twenty-three anesthetized adult swine. INTERVENSIONS: Swine were studied in four groups for 4 hrs: a) an anesthesia control group (n = 6); b) a septic control group (n = 6), in which 1010/mL Aeromonas hydrophila was infused intravenously at 0.2 mL.kg-1.hr-1 and increased to 4.0 mL.kg-1.hr-1 over 3 hrs; c) a prostacyclin infusion group (n = 6), which received prostacyclin infusion to match septic control plasma concentrationsclm without bacteremia; and d) an antiprostacyclin antibody group (n = 5), which received continuous Aeromonas hydrophila infusion plus antiprostacyclin antibody infusion., Measurements and Main Results: Pulmonary hemodynamics, arterial blood gases, and plasma concentrations of arachidonate metabolites were measured hourly over a 4-hr period. In the septic control group and antiprostacyclin antibody group, elevated pulmonary vascular resistance index and pulmonary artery pressure with decreased Pao2, as well as lower pH, were documented after 1 and 3 hrs of graded bacteremia compared with the anesthesia control group and prostacyclin infusion group (p <.05). Thromboxane B2 concentration increased significantly in all groups during septic shock. In the antiprostacyclin antibody group, leukotriene B4 increased immediately after starting antiprostacyclin antibody infusion and reached significance at 3 hrs compared with the septic control group (p <.05). The prostacyclin infusion group had consistently lower concentrations of leukotrienes C4, D4, and E4 than all other groups., Conclusions: Prostacyclin does not mediate blood gas changes, alterations of pulmonary hemodynamics, or platelet abnormalities in porcine septic shock, because antiprostacyclin antibody infusion did not change the pulmonary hypertension and hypoxemia, and infusion of prostacyclin to pathophysiologic blood concentrations did not reproduce such changes. Antiprostacyclin blockade during bacteremia significantly increased concentrations of leukotrienes C4, D4, and E4 and leukotriene B4, whereas prostacyclin infusion suppressed concentrations of leukotrienes C4, D4, and E4, suggesting that endogenous prostacyclin may blunt leukotriene release.

Endotracheal intubation in rabbits is a formidable task and has led to the devising of a new endoscopic method. Sixty New Zealand White rabbits (2.0-3.5 kg) underwent experimental left thoracotomy requiring mechanical ventilation. After anaesthetic induction was achieved, the animal was placed in a supine position. A rigid 30 degrees endoscope was passed through a 4.5 mm endotracheal tube (ET) and then used to advance, under direct vision, through the oropharynx and vocal cords. Once passing the vocal cords, the ET was advanced into the trachea as the endoscope was withdrawn. All animals were successfully intubated within 30 s to 2 min and then ventilated. No complications or deaths occurred during or after intubation, or postoperatively. No instances of oesophageal intubation occurred. All animals survived long-term. Thirty animals underwent necropsy at 10 days and, 30 at 30 days, with no postoperative evidence of orotracheal injury. We have established a new method of endotracheal intubation in rabbits. It is reliable, effective, non-traumatic, safe, and expeditious.

Background: We hypothesized that induction of coagulopathy in sheep would model clinical needle hole and surgical bleeding from synthetic graft anastomoses, and that a new tissue bioadhesive (BioGlue) would control postoperative blood loss during surgical repair of the thoracic aorta., Methods: Sheep were anticoagulated with aspirin and heparin. A bypass was made using end-to-side anastomoses of a graft to a partially occluded descending thoracic aorta. Experimental anastomoses (EXP, n = 9) were treated with BioGlue, and control anastomoses (CON, n = 5) were treated with Surgicel to gain intraoperative hemostasis., Results: EXP animals exhibited significantly reduced postsurgical bleeding (CON median 955 mL versus EXP median 470 mL, p < 0.003), a reduced rate of blood loss over the first 2 postoperative hours (CON median 210 mL/hr versus EXP median 92.5 mL/hr, p < 0.006), and over the entire recovery period (CON median 158 mL/hr versus EXP median 86 mL/hr, p < 0.05), and reduced total blood loss (CON mean 1,497 +/- 691 mL versus EXP mean 668 +/- 285 mL, p < 0.008). On histologic examination of tissues explanted after 3 months, BioGlue was relatively inert and demonstrated a minimal inflammatory response., Conclusions: The use of BioGlue significantly reduced the volume and rate of postsurgical bleeding in a coagulopathic sheep model for thoracic aortic operations. Histopathologically, BioGlue generated only a minimal inflammatory response. This new surgical tissue bioadhesive should prove extremely beneficial for coagulopathic patients undergoing thoracic aortic or vascular procedures.

There have been many various animal studies to evaluate the structural integrity and antithrombogenicity of prosthetic heart valves. We were interested in developing a novel sheep model to study the thrombogenicity of mechanical heart valves placed into the systemic circulation but without the need for cardiac bypass. Also, we wanted to minimize the risk ofparaplegia from complete thoracic aortic clamping. Six sheep underwent left lateral thoracotomy for placement of a mechanical heart valve in parallel with the descending thoracic aorta. A valved conduit with a dacron tube graft sutured to the back end was fashioned. Employing partial aortic occlusion with a side-biting clamp, the proximal and distal ends were anastomosed in an end-to-side fashion. Once flow was confirmed through the graft, the native aorta was occulded with umbilical tape. The sheep received no postoperative anticoagulation. The median operative time and estimated blood loss (EBL) was 170 min and 250 cc, respectively. Patency of the valved conduits was confirmed during the initial procedure, and there was no incidence of paraplegia postoperatively. Two animals expired shortly after extubation and at necropsy the valved conduits were patent with preserved valve function. The four survivors were sacrificed a median of 37 days postoperatively. Prior to euthanasia, the valved conduits were evaluated in situ with ultrasound. In all cases, the valves had clot formation at the hinges, which prevented active movement of the leaflets. This novel in vivo technique provides an alternative in testing the thrombogenicity of prosthetic heart valves without cardiac bypass or the risk of paraplegia in an animal that is extremely sensitive to complete aortic cross-clamp.

Background: Plasma viral load has recently been associated with clinical outcome in patients with human immunodeficiency virus (HIV) infection and acquired immunodeficiency syndrome (AIDS). We hypothetized that, in addition to CD4 lymphocytes, plasma HIV-1 RNA counts are predictive of postoperative outcome., Methods: HIV-infected and AIDS patients admitted to a major teaching hospital requiring invasive or surgical procedures were retrospectively analyzed for postoperative outcome. Preoperative and postoperative immune cell counts including plasma HIV-1 RNA counts were recorded. Chi-square analysis, Fisher's exact test, and multivariate regression were performed with statistical significance P

This study evaluated whether or not prostacyclin (PGI2) was necessary or sufficient by itself in a pathophysiologic concentration to mediate the cardiovascular dysfunction of septic shock. Anesthetized adult swine received anesthesia only (ANESTHESIA CONTROL, n = 6); graded Aeromonas hydrophila, 10(10)/mL, infusion at 0.2 mL/kg/h that increased to 4.0 mL/kg/h over 3 h (SEPTIC SHOCK CONTROL, n = 6); pathophysiologic prostacyclin infusion to match septic shock control plasma levels without bacteremia (PGI2 INFUSION, n = 6), or graded Aeromonas hydrophila plus anti-prostacyclin antibody infusion (ANTI-PGI2-Ab INFUSION, n = 5). This graded porcine bacteremia model was 100% lethal after 4 h. Cardiovascular hemodynamics, arterial blood gases, and plasma levels of arachidonate metabolites were measured at baseline and hourly over a 4-h period. The results showed that PGI2 was not a necessary mediator of impaired cardiovascular hemodynamics in graded bacteremia, as anti-PGI2 antibody infusion did not improve the cardiac index, systemic vascular resistance, or peripheral oxygen balance in septic animals. Also, PGI2 was not sufficient alone to cause the cardiovascular dysfunction of sepsis, as pathophysiologic infusion of PGI2 did not reproduce such changes in normal animals. PGI2 blockade during bacteremia significantly increased LTC4D4E4, and LTB4 whereas PGI2 infusion suppressed LTC4D4E4 concentration, suggesting that endogenous PGI2 may blunt leukotriene release during septic shock. These results indicate a complex dynamic equilibrium among prostacyclin and leukotrienes in septic shock.

Objective: To determine the efficacy of concurrent preoperative cisplatin chemotherapy and radiotherapy (CT/RT) for patients with advanced head and neck cancer and cervical metastatic disease., Design: Retrospective analysis., Setting: University hospitals., Patients: Eighty-eight patients with operable stage III and IV squamous cell carcinoma of the head and neck and palpable cervical lymphogenous metastases received preoperative concurrent CT/RT followed by planned neck dissection., Interventions: All patients undergoing CT/RT received concomitant continuous infusions of cisplatin (20 mg/m2) on days 1 to 4 and 22 to 25 of CT/RT. Thirty-nine patients underwent single-fraction (1.8-Gy) radiotherapy to 45.0 Gy, and 49 patients received 10 single-fraction (1.8-Gy) treatments, which were hyperfractionated (1.2-Gy twice a day) to 46.8 Gy., Main Outcome Measures: The 71 patients for whom complete post-CT/RT data were available were evaluated for clinical response in addition to survival. Histologic complete response (HCR) was confirmed from planned neck dissection specimens (n = 48) after clinical complete response (CCR) from initial CT/RT. Kaplan-Meier statistical analysis for disease-specific survival and overall survival was performed on all 88 patients who received CT/RT., Results: A CCR and an HCR were noted in 78% (18/23) and 59% (10/17) of patients with N1 lesions, respectively, and in 60% (29/48) and 45% (14/31) of patients with N2-3 lesions, respectively. The percentage of patients with CCR who also had HCR was 67% (10/15) for patients with N1 lesions and 54% (14/26) for patients with N2-3 lesions. With a median follow-up of 18.5 months, the Kaplan-Meier disease-specific survival rate at 54 months (n = 88) was 70% (21/30) for patients with N1 lesions, 60% (24/40) for patients with N2 lesions, and 39% (7/18) for patients with N3 lesions. The overall survival and disease-specific survival rates at 5 years for all nodal groups combined were 36% (32/88) and 59% (52/88), respectively., Conclusions: A CCR to CT/RT was achieved in nearly two thirds of patients with head and neck cervical lymphogenous metastases, independent of nodal tumor load. Most patients (59% [24/41]) with CCR were pathologically tumor free before neck dissection.

Surgical repair of aneurysms, traumatic injuries, or congenital anomalies of the thoracic aorta are associated with high morbidity and mortality mainly as a result of excessive and uncontrollable hemorrhage from diffuse coagulopathy. We developed a model in sheep that simulates this coagulopathic state for experimentation with thoracic aorta surgery. This experimental animal model involves administering a 600-mg aspirin suppository once a day for the 2 days preceding surgery and a final dose on-call to surgery. Prior to cross-clamping the aorta, an intravenous (i.v.) bolus of heparin (400 IU/kg) was administered. Thirty minutes later, the i.v. heparin bolus was repeated. Pre- and intraoperative activated clotting time was 101 +/- 10 s and >1500 s (p < .0001); prothrombin time, 21 +/- 1 s and >100 s (p < .0001); and activated partial thromboplastin time, 20 +/- 1 s and >50 s (p < .0001), respectively. We utilized a partial cross-clamp-and-sew technique to anastomose a woven, gelatin-impregnated, 16-mm tube graft end-to-side to the descending thoracic aorta. Mean total blood loss was 1367 +/- 282 mL, which included mean blood loss from time of release of aortic cross-clamp to close (422 +/- 135 mL) and mean total blood output from chest tube drain (945 +/- 203 mL). The mean time to achieve hemostasis at suture lines after aortic cross-clamp release was 15.5 +/- 6.6 min. In conclusion, a sheep model with induced coagulation defects was successfully developed and reproducible for experimentation involving thoracic aortic surgery.

Purpose: The goal of this study was to determine the efficacy of a single intraperitoneal administration of a chondroitin sulfate solution in preventing postoperative adhesion formation. METHODS. Twenty-five Sprague-Dawley rats had a 1-cm(2) area of cecal serosa abraded. Controls (CON, n = 5) received no treatment, the chondroitin sulfate group (CS, n = 10) received chondroitin sulfate (0.013 g/kg) in 0.9% NaCl intraperitoneally (ip), and vehicle controls (VC, n = 10) received an equal volume of 0.9% NaCl solution ip before the abdomen was closed. All animals were sacrificed on postoperative day 10. The extent of adhesion was quantified according to Mazuji's adhesion grade (0 to 4: 0 = no adhesion and 4 = very dense adhesion) and quantitated after H&E, trichome, and immunohistochemical staining for fibrin and collagen type I and type III using digital image analysis., Results: The mean Mazuji's adhesion grade in the CON was 4.0 +/- 0.0, in the VC 2.60 +/- 0.37, and in the CS 1.3 +/- 0.42 (P < 0.01 for CS vs CON and P < 0.05 for CS vs VC comparisons). The mean gray-scale intensity (0-255: 0 = dense amount and 255 = none) of adhesion density in the CON was 105. 5 +/- 5.5, in the VC 125 +/- 15.0, and in the CS 178.3 +/- 21.0 (P < 0.01 for CS vs CON and P < 0.05 for CS vs VC comparisons). The mean adjusted intensity stain indices (AISI) for fibrin and collagen type I in the CON were 59 +/- 17 and 53 +/- 19, in the VC 27 +/- 3 and 25 +/- 7, and in the CS 16 +/- 5 and 6 +/- 3, respectively (P < 0.05 between CS and CON comparisons). The AISI of collagen type III was not significant among all the groups (P > 0.1)., Conclusions: The extent of early postoperative intra-abdominal adhesion formation as determined by gross assessment and from quantitation of fibrin and collagen type I deposition was significantly reduced by a single intraperitoneal administration of a chondroitin sulfate solution., (Copyright 2000 Academic Press.)

The cellular mechanisms by which topical cyclosporine A (tCsA) induces site-specific immunosuppression were investigated. Experiments were designed to elucidate how cyclosporine A (CsA) suppresses activated immunocytes in animals that are undergoing local alloactivation and concomitant tCsA immune suppression. Lewis rats received dual Lewis x Brown Norway rat skin allografts; the rats were treated with systemic CsA (sCsA) at 8 mg/kg/day for 10 days after grafting and then tCsA and vehicle thereafter. CsA added to mixed lymphocyte reactions 24 hours after culture initiation modeled the local effects of CsA on alloactivated immunocytes, and tCsA in conjunction with limited sCsA prolonged local skin allograft survival. CsA inhibited both antigen-specific and nonspecific activated alloresponses of immunocytes from animals that had received allografts and that underwent limited sCsA treatment only in a dose-dependent manner. When tCsA had been applied, immunocyte responses to a nonspecific antigen were extremely CsA-resistant as compared with those induced by antigen-specific suppression. However, this nonspecific alloresponse was fully suppressible with the use of elevated CsA doses (66 microg/mL); thus alloresponding immunocytes were significantly more sensitive to CsA if they were challenged with the donor antigen and preexposed to limited sCsA followed by tCsA in vivo.

Transmyocardial laser revascularization (TMLR) has been widely evaluated for treatment of the ischemic myocardium either in conjunction with coronary artery bypass grafting or as sole therapy. Clinically, it has shown significant improvement for angina symptoms, but the mechanism by which this modality works is unknown at this time. The original premise on which transmyocardial revascularization was established depended on its ability to essentially generate channels that would directly carry blood from the ventricle into the ischemic myocardium. This theory, however, has not been substantiated, so other mechanisms have been postulated. This article gives a historical perspective on the advent of transmyocardial revascularization and the many animal and human studies that have paved the way for its clinical use. Current controversies are examined, along with the new advances in laser technology and where the future of TMLR is headed.

Purpose: Dermal application of immunosuppressants can be an effective means of achieving site-specific immunosuppression (SITE) on skin allografts in burn wound management and in the treatment of various immune skin disorders. We have previously reported success with topical cyclosporine A (tCsA) in the treatment of skin allograft rejection in rats. Using a new tCsA formulation with a penetration enhancer (PE), polyethylene glycol-8 (PEG-8) glyceryl caprylate/caprate (Labrasol, Gattefossé, St. Priest, France), in a trinary drug delivery system, we hypothesized that we would induce SITE and significantly delay rejection of dual skin allografts in rats., Methods: Dual rat skin allografts from Lewis x Brown-Norway (LBN) donors were grafted to Lewis (Lew) recipients. Experimental animals (EXP, n = 7) received a 10-day course of systemic cyclosporine (sCsA, 8 mg/kg/day) followed by topical application. One of the two allografts on each experimental animal received tCsA/PE application (5 mg/kg/day) until sacrifice (tCsA/PE-treated). The other allograft received vehicle only (vehicle-treated). Allogeneic controls (ALLO-CON, n = 9) received no sCsA or tCsA. First signs of rejection were determined based on the initial observation of erythema, hair loss, flakiness, and/or scabs., Results: The mean time to rejection for ALLO-CON allografts was 6.3 +/- 0.7 days (t test, P = 0.0013); for vehicle-treated allografts, 12.3 +/- 3.8 days (paired t test, P = 0.0146); and for tCsA/PE-treated allografts, 25.6 +/- 5.4 days. The disparity of days to rejection between dual allografts in the ALLO-CON group was 0.0 +/- 0.0 day and that between the tCsA/PE- and vehicle-treated dual allografts was 13.3 +/- 3.9 days (t test, P = 0.0016)., Conclusions: A new formulation of tCsA in a trinary drug delivery system is successful at delaying the onset of rejection in dual skin allografts in rats by SITE, and PEG-8 glyceryl caprylate/caprate may represent a potentially effective transdermal penetration enhancer., (Copyright 1999 Academic Press.)

All mechanical heart valves (MHV) are thrombogenic. Application of surface modification technology to reduce the incidence of thrombus formation on MHV is a novel undertaking. This requires collaboration within the bioengineering and cardiothoracic surgery fields. From reviewing results of recent and past investigations, and our own preliminary study with diamond-like carbon coating (DLC) and plasma or glow discharge treatment (GDT) of MHV, we identify and discuss several potentially beneficial effects that may reduce the extent of valve-related thrombogenesis by surface modification. DLC and GDT may affect the surfaces of MHV in many ways, including cleaning of organic and inorganic debris, generating reactive and functional groups on the surface layers without affecting their bulk properties, and making the surfaces more adherent to endothelial cells and albumin and less adherent to platelets. These different effects of surface modification, separately or in combination, may transform the surfaces of MHV to be more thromboresistant in the vascular system.

An assay for the quantification of plasma and urine levels of CVS 1123, an orally bioavailable thrombin inhibitor, and its desmethyl form. CVS 738, was developed to support clinical and toxicology studies. This assay uses solid-phase extraction, reversed-phase HPLC separation, and post-column fluorescent derivatization with ninhydrin. An internal standard is added to correct for recovery. In aqueous solution, the arginine aldehyde structures of CVS 1123 and CVS 738 exist in multiple forms which can be separated under standard reversed-phase HPLC conditions. HPLC conditions were optimized to give rapid interconversion of the forms on the separation time scale, and consequently a single chromatographic peak. Extraction conditions were modified for quantitative extraction of drug compounds from large volumes of human plasma. The assay was shown to be accurate and precise, with a quantification limit of 17 ng CVS 1123/ml human plasma.