Search

Genetica formale Metodo e prove sperimentali di Mendel Caratteri singoli e segregazione, Caratteri e assortimento indipendente, Esperienze mendeliane "ieri ed oggi", I Leggi di Mendel, I Caratteri mendeliani e reincrocio IGenetica "oltre" Mendel Dominanza incompleta Codominanza Significato e valore della dominanza e della recessività Alleila multipla Pleiotropia Interazione tra geni Alleli letali Linkage: esperienze di Morgan e associazione genica Associazione completa e associazione incompleta Basi biologiche della ricombinazione Complesso sinaptonemale, rotture a doppio filamento e crossing over Mappe fisiche e mappe genetiche Ambiente e geni L'ambiente e l'espressione dei geni: penetranza ed espressività Poligenia ed ereditarietà quantitativa Sesso e geni Determinazione del sesso nelle specie animali Cromosomi sessuali, X e Y

libro di testo

Folate receptor family members (FOLRs) mediate the delivery of 5-methyltetrahydrofolate to the interior of, out of within, or between cells in a process known as potocytosis. Three FOLRs and a pseudogene map to 11q13.4. The aim of this study was to verify whether FOLRs could be responsible for the onset of nonsyndromic cleft lip with or without cleft palate (CL/P). Linkage and linkage disequilibrium between genetic markers and disorder were analyzed. Patients and their mothers from 71 familial CL/P pedigrees and 75 sporadic cases from Italian population were investigated by PCR-SSCP analysis. Data from mutation scanning allowed us to find only a silent mutation in FOLR1 present in a mother and her child. Our findings do not support FOLR1 and FOLR2 genes in the onset of CL/P.

Background Many investigators detected the simian polyomavirus SV40 footprints in human brain tumors and neurologic diseases and recently it has been indicated that SV40 seems to be associated with multiple sclerosis (MS) disease. Interestingly, SV40 interacts with human leukocyte antigen (HLA) class I molecules for cell entry. HLA class I antigens, in particular non-classical HLA-G molecules, characterized by an immune-regulatory function, are involved in MS disease, and the levels of these molecules are modified according with the disease status. Objective We investigated in serum samples, from Italian patients affected by MS, other inflammatory diseases (OIND), non-inflammatory neurological diseases (NIND) and healthy subjects (HS), SV40-antibody and soluble sHLA-G and the association between SV40-prevalence and sHLA-G levels. Methods ELISA tests were used for SV40-antibodies detection and sHLA-G quantitation in serum samples. Results The presence of SV40 antibodies was observed in 6 % of patients affected by MS (N = 4/63), 10 % of OIND (N = 8/77) and 15 % of NIND (N = 9/59), which is suggestive of a lower prevalence in respect to HS (22 %, N = 18/83). MS patients are characterized by higher sHLA-G serum levels (13.9 ± 0.9 ng/ml; mean ± St. Error) in comparison with OIND (6.7 ± 0.8 ng/ml), NIND (2.9 ± 0.4 ng/ml) and HS (2.6 ± 0.7 ng/ml) subjects. Interestingly, we observed an inverse correlation between SV40 antibody prevalence and sHLA-G serum levels in MS patients. Conclusion The data obtained showed a low prevalence of SV40 antibodies in MS patients. These results seems to be due to a generalized status of inability to counteract SV40 infection via antibody production. In particular, we hypothesize that SV40 immune-inhibitory direct effect and the presence of high levels of the immune-inhibitory HLA-G molecules could co-operate in impairing B lymphocyte activation towards SV40 specific peptides.

National audience

libro di biologia e genetica

The normal development of cranial primordia and orofacial structures involves fundamental processes in which growth, morphogenesis, and cell differentiation take place and interactions between extracellular matrix (ECM) components, growth factors and embryonic tissues are involved. Biochemical and molecular aspects of craniofacial development, such as the biological regulation of normal or premature cranial suture fusion, has just begun to be understood, thanks mainly to studies performed in the last decade. Several mutations has been identified in both syndromic and non-syndromic craniosynostosis patients throwing new light onto the etiology, classification and developmental pathology of these diseases. In the more common craniosynostosis syndromes and other skeletal growth disorders, the mutations were identified in the genes encoding fibroblast growth factor receptor types 1-3 (FGFR1, 2 and 3) where they are dominantly acting and affect specific and important protein binding domain. The unregulated FGF signaling during intramembranous ossification is associated to the Apert and Crouzon syndrome. The non syndromic cleft of the lip and/or palate (CLP) has a more complex genetic background if compared to craniosynostosis syndrome because of the number of involved genes and type of inheritance. Moreover, the influence of environmental factor makes difficult to clarify the primary causes of this malformation. ECM represents cell environment and results mainly composed by collagens, fibronectin, proteoglycans (PG) and hyaluronate (HA). Cooperative effects of ECM and growth factors regulate regional matrix production during the morphogenetic events, connective tissue remodelling and pathological states. In the present review we summarize the studies we performed in the last years to better clarify the role of ECM and growth factors in the etiology and pathogenesis of craniosynostosis and CLP diseases.

Nonsyndromic cleft lip with or without cleft palate (CL/P; MIM 119530), a common birth defect, is a genetically complex trait. Several genetic and environmental factors seem to be involved in the development of this malformation [Carinci et al., 2003]. Nevertheless, CL/P also occurs as a part of many single gene syndromes, and some of these genes may also have roles in nonsyndromic CL/P. Suzuki et al. [2000] showed that the rare autosomal recessive syndrome CL/P-ectodermal dysplasia (CLPED1; MIM 225060) is caused by the loss-of-function of PVRL1 gene, which encodes nectin-1, a cell-to-cell adhesion molecule. The same group demonstrated that heterozygosity of the nonsense mutation W185X is a genetic risk factor for nonsyndromic CL/P in northern Venezuela [Sozen et al., 2001]. To verify whether the W185X mutation is a genetic risk factor for nonsyndromic CL/P in the Italian population, 71 familial CL/P belonging to 71 different pedigrees, 75 sporadic CL/P, and 100 unrelated unaffected individuals were enrolled in this study. The W185X mutation is a singlenucleotide change G!A that creates a StyI restriction endonuclease site. Therefore, a 160 bp segment of the exon 3 containing the mutation was amplified by PCR using the following primers: W185X.for 50CCACCAATTGGATAGAGGGTA30 and W185X.rev 50CGGATCTCCTGGTACTCTGC30. Amplimers were digested with StyI restriction endonuclease, electrophoresed on 2.5% agarose gel, and visualized by ethidium bromide. Positive controls, containing the mutation generated by site-directed mutagenesis (www.buckinstitute. org/benz/prot/prot12.htm), were included to verify the assay efficiency in each test. Of the 146 CL/P patients and of the 100 unaffected individuals analyzed in this study for the presence of the W185X mutation in the PVRL1 exon 3, none was positive. The results of this investigation indicate that in Italy the W185X mutation is not common and in turn, it does not constitute a risk factor for nonsyndromic CL/P. As suggested by Suzuki et al. [2000], since the PVRL1 gene product constitutes a receptor for herpesviruses, in the Margarita Island population the mutation may be selected positively for an increased resistance to infections of the carriers. Our findings significantly differ from those previously observed in the Venezuelan population [Sozen et al., 2001]. This discrepancy likely reflects the complex etiology of the CL/P malformation. Indeed, the numerous genetic and environmental factors involved probably contribute differently to the development of the malformation in distinct populations.

This prospective study was designed to assess whether the use of GnRH antagonists can improve the success rate of controlled ovarian stimulation (COS) in intrauterine insemination (IUI) treatments.Eighty patients were divided into two groups: GnRH antagonist group (Group A, n=40) and control group (Group B, n=40). Patients in Group B underwent COS with recombinant Follicle Stimulating Hormone (r-FSH, 50-75 IU/d) only, while patients in Group A were administered r-FSH (50-75 IU/d) plus cetrorelix (0.25 mg/d, starting when ≥ 2 follicles ≥ 14 mm were detected on ultrasound scan). In both groups a single insemination was performed 36 hours after human Chorionic Gonadotropin (hCG, 250 mcg) administration. The primary outcome was clinical Pregnancy Rate (PR). Secondary outcomes were ongoing PR, incidence of Premature Luteinization (PL), number of follicles with mean diameter ≥ 16 mm and between 11 and 15 mm on the day of hCG administration, miscarriage rate, cycle cancellation rate, total amount of r-FSH used and duration of treatment. Student's t test and Chi-square test were used (p.05 statistically significant).A total of 146 cycles were performed (Group A: n=72; Group B: n=74). A trend towards higher PR in Group A was detected, although it was not statistically significant (Clinical PR: 18.05% vs 10.81%). The number of follicles ≥ 16 mm was significantly increased in Group A. The incidence of both premature LH surge and premature luteinization (PL) was significantly higher in Group B. No significant differences were found in the duration of the stimulation protocol, and in the total amount of r-FSH administered.The addition of GnRH antagonist in COS/IUI protocol significantly increases the number of mature follicles. However, this multifollicular recruitment is not linked to a significantly higher PR.