Search

Complementary (c)DNA clones corresponding to the full‐length genome of T36CA (a Californian isolate of Citrus tristeza virus with the T36 genotype), which shares 99.1% identity with that of T36FL (a T36 isolate from Florida), were made into a vector system to express the green fluorescent protein (GFP). Agroinfiltration of two prototype T36CA‐based vectors (pT36CA) to Nicotiana benthamiana plants resulted in local but not systemic GFP expression/viral infection. This contrasted with agroinfiltration of the T36FL‐based vector (pT36FL), which resulted in both local and systemic GFP expression/viral infection. A prototype T36CA systemically infected RNA silencing‐defective N. benthamiana lines, demonstrating that a genetic basis for its defective systemic infection was RNA silencing. We evaluated the in planta bioactivity of chimeric pT36CA‐pT36FL constructs and the results suggested that nucleotide variants in several open reading frames of the prototype T36CA could be responsible for its defective systemic infection. A single amino acid substitution in each of two silencing suppressors, p20 (S107G) and p25 (G36D), of prototype T36CA facilitated its systemic infectivity in N. benthamiana (albeit with reduced titre relative to that of T36FL) but not in Citrus macrophylla plants. Enhanced virus accumulation and, remarkably, robust systemic infection of T36CA in N. benthamiana and C. macrophylla plants, respectively, required two additional amino acid substitutions engineered in p65 (N118S and S158L), a putative closterovirus movement protein. The availability of pT36CA provides a unique opportunity for comparative analysis to identify viral coding and noncoding nucleotides or sequences involved in functions that are vital for in planta infection. [ABSTRACT FROM AUTHOR]

Lettuce infectious yellows virus (LIYV)-infected plants contain a heterogeneous population of defective RNAs (D RNAs) derived from LIYV genomic RNA 2. To partly address how LIYV D RNAs are generated, in vitro synthesized transcripts corresponding to the LIYV genomic RNAs 1 and 2 were inoculated to protoplasts, and these were analysed for genomic and D RNAs. De novo generated D RNAs were readily detected by 48 h post-inoculation. Furthermore, when separate aliquots from the same protoplast preparation were separately inoculated with aliquots of the same LIYV RNA 1 and RNA 2 transcript preparations, different D RNA populations were detected in each. Thus, different D RNAs arose de novo within separate protoplast samples. Nucleotide sequence analysis of some de novo LIYV D RNAs revealed that they have a similar structure to the LIYV D RNAs described previously from whole plants, and to those of other plant viruses, consisting of one large internal deletion of the LIYV genomic RNA 2, but retaining 5' and 3' terminal sequences. However, one of the LIYV D RNAs had two non-contiguous internal deletions. [ABSTRACT FROM AUTHOR]

Watermelon ( Citrullus lanatus ) and melon ( Cucumis melo ) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies ( Bemisia tabaci ) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus ( Opuntia auberi ) from Sonora, Mexico, and from one cactus ( O. cochenillifera ), lamb's ears ( Stachys byzantine ), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

During the summer of 2022, a cluster of Madagascar periwinkle plants with white and mauve flowers were observed with foliar mild yellow mosaic symptoms on a private property in Harlingen, Cameron County, Texas. The symptoms were reproduced on mechanically inoculated periwinkle and Nicotiana benthamiana plants. Virions of 776 to 849 nm in length and 11.7 to 14.8 nm in width were observed in transmission electron microscopy of leaf dip preparations made from symptomatic periwinkle leaves. High-throughput sequencing (HTS) analysis of total RNA extracts from symptomatic leaves revealed the occurrence of two highly divergent variants of a novel Potyvirus species as the only virus-like sequences present in the sample. The complete genomes of both variants were independently amplified via reverse transcriptase PCR, cloned, and Sanger sequenced. The 5' and 3' of the genomes were acquired using random amplification of cDNA ends methodology. The assembled virus genomes were 9,936 and 9,944 nucleotides (nt) long, and they shared 99.9 to 100% identities with the respective HTS-derived genomes. Each genome encoded hypothetical polyprotein of 3,171 amino acids (aa) (362.6 kilodaltons [kDa]) and 3,173 aa (362.7 kDa), respectively, and they shared 77.3/84.4% nt/aa polyprotein identities, indicating that they represent highly divergent variants of the same Potyvirus species. Both genomes also shared below-species-threshold polyprotein identity levels with the most closely phylogenetically related known potyviruses, thus indicating that they belong to a novel species. The name periwinkle mild yellow mosaic virus (PwMYMV) is given to the potyvirus with complete genomes of 9,936 nt for variant 1 (PwMYMV-1) and 9,944 nt for variant 2 (PwMYMV-2). We propose that PwMYMV be assigned into the genus Potyvirus (family Potyviridae )., Competing Interests: The author(s) declare no conflict of interest.

Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area., Competing Interests: The author(s) declare no conflict of interest.

Apricot vein clearing-associated virus is the type species of genus Prunevirus, family Betaflexiviridae. The virus was first discovered from an Italian apricot tree (Prunus armeniaca) showing leaf vein clearing and mottling symptoms (Elbeaino et al. 2014). Since then, apricot vein clearing-associated virus (AVCaV) has been reported in symptomatic and asymptomatic plants from other countries (Marais et al. 2015; Kinoti et al. 2017; Kubaa et al. 2014). In 2018, a domestic selection of a flowering apricot (P. mume cv. Peggy Clarke) (PC01) with no discernible foliar virus-like symptoms was received for inclusion in the Foundation Plant Services (UC-Davis) collection. The plant originated from a private Prunus collection located in California. Total nucleic acids (TNA) were isolated from PC01 leaves using MagMax Plant RNA Isolation Kit (Thermo Fisher Scientific). The TNA were analyzed for a panel of 15 Prunus-infecting viruses by reverse-transcription quantitative PCR (RT-qPCR) (Diaz-Lara et al. 2020). In addition, to screen for sap-transmissible viruses, young leaves of PC01 were homogenized in inoculation buffer and were rubbed onto leaves of herbaceous indicator plants, Chenopodium amaranticolor, C. quinoa, Cucumis sativus, and Nicotiana clevelandii (Rowhani et al. 2005). The source PC01 tested negative for the 15 screened viruses. Interestingly, vein clearing symptoms were observed on leaves of C. quinoa and C. amaranticolor plants (Figure S1). These results suggested the presence of a mechanically transmissible virus in PC01. To determine the identity of mechanically transmissible viral agent, symptomatic C. quinoa and PC01 plant were advanced for high throughput sequencing analysis. Aliquots of TNA from PC01 and C. quinoa were rRNA-depleted and used for cDNA library preparation with TruSeq Stranded Total RNA kit (Illumina). The raw reads were trimmed, de novo assembled, and subsequently were annotated using tBLASTx algorithm (Al Rwahnih et al. 2018). A total of 47,261,138 and 8,812,296 single-end reads were obtained from cDNA libraries of PC01 and C. quinoa, respectively. The de novo assembly generated near-complete contigs resembling AVCaV genome ) from both PC01 and C. quinoa, which were 99.8% identical at the nucleotide level. The longest contig (8,342 nucleotides, 73.5x coverage depth) obtained from PC01 was further completed using SMARTer RACE 5'/3' kit (Takara Bio). The complete genome sequence of AVCaV-PC01 is 8,364 nucleotides long (GenBank: MK170158). The full-length virus genome was compared with GenBank database using BLASTn, which the best hit corresponded to KY132099 with 98% identity. Additionally, AVCaV infection was confirmed in both PC01 selection and the symptomatic C. quinoa by RT-PCR as previously described (Marais et al. 2015). Lastly, symptomatic leaves of C. quinoa were used in leaf dip method to visualize virus particles by transmission electron microscope. As a result, flexuous rod-shaped virions were observed from leaf dips of symptomatic C. quinoa plants (Figure S2). Therefore, our results represent the first report of AVCaV in California, USA. Furthermore, mechanical transmission of an AVCaV isolate infecting flowering apricot to herbaceous hosts was confirmed. Field surveys and biological studies are underway to determine the prevalence of AVCaV in commercial orchards and assess its effect on tree performance.