Search

Introduction: Online patient education materials (PEMs) that are difficult to read disproportionately affect patients with low health literacy and educational attainment. Patients may not be fully informed or empowered to engage meaningfully with providers and advocate for their goals. We aim to assess the readability of online PEMs regarding polydactyly and syndactyly., Methods: Google was used to query "polydactyly" and "syndactyly" in English and Spanish. The first 50 results were categorized into institutional (government, medical school, teaching hospital), noninstitutional (private practice, blog), and academic (journal articles, book chapters). Readability scores were generated using the Simple Measure of Gobbledygook and Spanish Simple Measure of Gobbledygook scales., Results: All polydactyly PEMs and >95% of syndactyly PEMs exceeded the National Institutes of Health recommended 6th-grade reading level. Altogether, English PEMs had an average reading level of a university freshman and Spanish PEMs had an average reading level of nearly a high school sophomore. For both diagnoses, English PEMs were harder to read than Spanish PEMs overall and when compared across the 3 categories between the 2 languages. Generally, noninstitutional PEMs were more difficult to read than their institutional counterparts., Conclusions: To improve patient education, health literacy, and language equity, online resources for polydactyly and syndactyly should be written at the 6th-grade level. Currently, these PEMs are too advanced, which can make accessing, understanding, and pursuing healthcare decisions more challenging. Understanding health conditions and information is crucial to empower patients, regardless of literacy., Competing Interests: Conflicts of interest and sources of funding: Dr Wendy Chen is a paid consultant for the Allergan AbbVie company. The authors report no proprietary or commercial interest in any product mentioned or concept discussed in this article., (Copyright © 2024 Wolters Kluwer Health, Inc. All rights reserved.)

Purpose: Transverse deficiency (TD) and symbrachydactyly may be difficult to distinguish due to shared phenotypes and a lack of pathognomonic features. The 2020 Oberg-Manske-Tonkin classification update modified these anomalies to include "with ectodermal elements" for symbrachydactyly and "without ectodermal elements" for TD as a defining differentiating characteristic. The purpose of this investigation was to characterize ectodermal elements and the level of deficiency and to examine whether ectodermal elements versus the level of deficiency was a greater determining factor for Congenital Upper Limb Differences (CoULD) surgeons making the diagnosis., Methods: This was a retrospective review of 254 extremities from the CoULD registry with a diagnosis of symbrachydactyly or TD by pediatric hand surgeons. Ectodermal elements and the level of deficiency were characterized. A review of the registry radiographs and photographs was used to classify the diagnosis and compare it with the diagnosis given by the pediatric hand surgeons. The presence/absence of nubbins versus the level of deficiency as the determining factor to differentiate the pediatric hand surgeons' diagnosis of symbrachydactyly (with nubbins) versus TD (without nubbins) was analyzed., Results: Based on radiographs and photographs of the 254 extremities, 66% had nubbins on the distal end of the limb; of the limbs with nubbins, nails were present on 51%. The level of deficiency was amelia/humeral (n = 9), <1/3 transverse forearm (n = 23), 1/3 to 2/3 transverse forearm (n = 27), 2/3 to full forearm TD (n = 38), and metacarpal/phalangeal (n = 103). The presence of nubbins was associated with a four times higher likelihood of a pediatric hand surgeon's diagnosis of symbrachydactyly. However, a distal deficiency is associated with a 20-times higher likelihood of a diagnosis of symbrachydactyly than a proximal deficiency., Conclusions: Although both the level of deficiency and ectodermal elements are important, the level of deficiency was a greater determining factor for a diagnosis of symbrachydactyly versus TD. Our results suggest that the level of deficiency and nubbins should both be described to help provide greater clarity in the diagnosis of symbrachydactyly versus TD., Type of Study/level of Evidence: Diagnostic IV., (Copyright © 2024 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.)

Ectodermal dysplasia-syndactyly syndrome 1 (EDSS1) is an exceedingly rare condition associated with mutations in the PVL4 gene. It is characterised by sparse, brittle hair, eyebrows and eyelashes, abnormal dentition and nails, along with bilateral cutaneous syndactyly involving the fingers and toes. We report a 2-year-old girl who presented to us with bilateral complete simple syndactyly of the third and fourth web spaces of the hands, along with bilateral syndactyly of both feet involving the second to fourth toes. Upon examination, sparse hair and eyebrows, along with abnormal dentition, were noted. Thorough clinical examination and genetic analysis were conducted on the affected child and her father, who exhibited similar clinical features. Genetic analysis revealed a homozygous nonsense mutation in the PVL4 gene in both individuals. According to the literature, EDSS1 has been reported in only 10 families worldwide, and there are no reported cases from India. Level of Evidence: Level V (Therapeutic).

Introduction: Fraser syndrome, named after George Fraser, is an autosomal recessive disorder showing a highly variable interfamilial phenotypic variation, with malformations ranging from minor symptoms to lethal anomalies like renal agenesis, incompatible with survival. Limb reduction defects have not been reported to be associated with it., Case Presentation: A 21-year-old primigravida presented to the antenatal outpatient department with a level two targeted anomaly scan report suggestive of severe oligohydramnios with suspected renal agenesis. The cranial vault bones were compressed, and orbital globes and lenses could not be visualized. Renal agenesis was confirmed due to sleeping adrenals sign, non-visualization of the urinary bladder, and Doppler of renal arteries. A detailed examination of the fetal head in the sagittal section showed the absence of an eye globe and lens, arousing suspicion of Fraser syndrome. After pregnancy termination, a complete fetal autopsy was done to look for any additional findings., Conclusion: Patients who have a syndromic mix of acrofacial and urogenital abnormalities with or without cryptophthalmos should be evaluated for Fraser syndrome, which can be diagnosed by clinical examination and perinatal autopsy., (© 2024. The Author(s), under exclusive licence to Springer-Verlag France SAS, part of Springer Nature.)

Introduction: Timothy syndrome (TS) is an extremely rare, multisystem disorder classically associated with long QT, syndactyly, ventricular arrhythmias, and hypoglycaemia. A neonatal diagnosis allows maximal medical and device therapy to be implemented to avoid malignant arrhythmias and sudden cardiac death., Methods: This was a retrospective case series study of type I TS (TS1) patients using data from the Timothy Syndrome Foundation's international registry, encompassing patients with a genetic diagnosis (CACNA1C variant G406R in exon 8A) recruited over a 28-year period., Results: Forty-four cases of TS1 were included (26 male; 60%). Mean gestational age (GA) was 35.6 weeks (range 28 weeks - term), with 43% of patients born less than 37 weeks GA. In TS1 patients presenting with foetal bradycardia, mean GA was significantly lower (34.2 weeks, p &lt; 0.05). Foetal bradycardia secondary to atrioventricular block was present in 20 patients (45%), resulting in premature delivery in 14 patients (32%). Fifteen patients (34%) were diagnosed with TS1 as neonates. Long QT at birth helped secure a diagnosis in 25 patients (57%). Syndactyly was seen in most patients (n = 40, 91%). Twenty patients died, with an average age of death of 2.3 years (range 1 month-6 years). Of the 7 patients who died before the first year of life (16%), the average age of death was 2.5 months., Conclusion: TS is associated with high early mortality. TS should be considered in paediatric patients presenting with long QT and syndactyly. Recognition of TS in the neonatal period allows for early intervention to prevent life-threatening arrhythmias., (© 2024 S. Karger AG, Basel.)

Background: Cenani-Lenzsyndactyly syndrome (CLSS; OMIM 212780) is a rare autosomal recessive acral deformity, which is mainly manifested in the fusion of fingers or toes, disordered phalangeal structure, shortening or fusion of the radius and ulna, and renal hypoplasia., Case Presentation: Our report described an individual with mild phenotypes from China. His parents were not consanguineous. The affected individual was non-dysmorphic. Standard X-ray showed that the both hands have only four metacarpal bones. The distal end of the first metacarpal bone on the right was relatively slender, and the distal phalanx was absent. Multiple phalanges and some soft tissues of both hands were fused. Exome sequencing revealed a novel biallelic c.282C⟩Avariant in low-density lipoprotein receptor-related protein 4 (LRP4; OMIM604270; NM&#95;002334.4) causing p. (Asn94Lys) change in the encoded protein. This variant is predicted to be potentially pathogenic, affecting protein structure and function., Conclusion: We report a novel missense variant present in homozygosity in LRP4 to broaden the pathogenic spectrum of LRP4 in syndactyly, and exome sequencing technology is a powerful tool for genetic analysis in prenatal diagnosis and medical research, as a preferred method for the diagnosis of syndactyly and related phenotypes., (© 2023 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.)

Competing Interests: Disclosures None.

ERI1 is an evolutionary conserved 3'-5' exonuclease with an important function in multiple RNA processing pathways. Although the molecular mechanisms in which ERI1 is involved have been studied extensively in model organisms, the pathology associated with ERI1 variants in humans has remained elusive because no case has been reported so far. Here, we present a case of a female patient with a homozygous nonsense variant in ERI1 gene. The patient exhibits mild intellectual disability, eyelid ptosis, and anomalies in her hands and feet (brachydactyly, clinodactyly, dysplastic/short nail of halluces, brachytelephalangy, short metacarpals, and toe syndactyly). This case report is the first of its kind and is invaluable for understanding ERI1 pathology in humans., (© 2022 Wiley Periodicals LLC.)

The term symbrachydactyly has been used for the phenotype of two or three short fingers or toes, hypoplasia of the middle and distal phalanges and variable syndactyly of the affected digits. Some clinicians have extended this diagnosis to include other phenotypes, specifically cleft hand, terminal transverse limb defects, hypoplasia of the thumb and fifth finger with nubbins for fingers 2, 3, and 4 and the hand deformity of the Poland anomaly. A malformations surveillance program can identify enough affected infants to characterize a phenotype. In the Active Malformations Surveillance Program in Boston (1972-2012) among 289,365 births, all infants and fetuses with structural abnormalities were identified from reading the examination findings by the pediatricians and pathologists and the results of diagnostic tests. Liveborn and stillborn infants were included, as well as fetuses from elective terminations because of anomalies identified in prenatal testing. We present the findings in 14 infants, all liveborn, who had symbrachydactyly of one or both hands (n = 12) or feet (n = 2). We suggest restricting the term symbrachydactyly to this single phenotype to improve counseling and to focus future research on identifying the cause(s)., (© 2022 Wiley Periodicals LLC.)

Rationale: Triphalangeal thumb (TPT) is a rare congenital malformation where the thumb has three phalanges instead of two. Syndactyly is a condition in which children are born with fused or webbed fingers. The combination of TPT, Syndactyly, and thumb duplication is extremely rare, especially when these deformities are combined in one hand., Patient Concerns: Hand abnormalities and polydactyl have been reported in a 1-year-old boy., Diagnosis: A clinical examination reveals two thumb duplications, finger fusion (Syndactyly), and a thumb with three phalanges (TPT). The diagnosis was based on clinical findings and an X-ray image of the hand., Interventions: The Z-plasty method was used to remove the adhesion between the thumb and forefinger, as well as the removal of the medial and distal phalanx of the thumb's medial tip., Outcomes: The patient was followed for 2 months and found him in good health. To authors' knowledge, we described an unusual case from Syria, considered the first in medical history., Lessons Learned: General and plastic surgeons should be aware about this unusual mix of the three abnormalities. The family history must also be carefully investigated to explore the occurrence of hereditary illnesses., Competing Interests: The authors have no funding, ethical statement and conflicts of interest to disclose., (Copyright © 2022 the Author(s). Published by Wolters Kluwer Health, Inc.)

The voltage-dependent L-type calcium channel isoform Ca V 1.2 is critically involved in many physiological processes, e.g., in cardiac action potential formation, electromechanical coupling and regulation of insulin secretion by beta cells. Gain-of-function mutations in the calcium voltage-gated channel subunit alpha 1 C ( CACNA1C ) gene, encoding the Ca V 1.2 α 1 -subunit, cause Timothy syndrome (TS), a multisystemic disorder that includes autism spectrum disorders and long QT (LQT) syndrome. Strikingly, TS patients frequently suffer from hypoglycemia of yet unproven origin. Using next-generation sequencing, we identified a novel heterozygous CACNA1C mutation in a patient with congenital hyperinsulinism (CHI) and associated hypoglycemic episodes. We characterized the electrophysiological phenotype of the mutated channel using voltage-clamp recordings and in silico action potential modeling experiments. The identified Ca V 1.2 L566P mutation causes a mixed electrophysiological phenotype of gain- and loss-of-function effects. In silico action potential modeling supports that this mixed electrophysiological phenotype leads to a tissue-specific impact on beta cells compared to cardiomyocytes. Thus, CACNA1C variants may be associated with non-syndromic hyperinsulinemic hypoglycemia without long-QT syndrome, explained by very specific electrophysiological properties of the mutated channel. We discuss different biochemical characteristics and clinical impacts of hypoglycemia in the context of CACNA1C variants and show that these may be associated with significant morbidity for Timothy Syndrome patients. Our findings underline that the potential of hypoglycemia warrants careful attention in patients with CACNA1C variants, and such variants should be included in the differential diagnosis of non-syndromic congenital hyperinsulinism.

The formation of the digits is a tightly regulated process. During embryogenesis, disturbance of genetic pathways in limb development could result in syndactyly; a common congenital malformation consisting of webbing in adjacent digits. Currently, there is a paucity of knowledge regarding the exact developmental mechanism leading to this condition. The best studied canonical interactions of Wingless-type-Bone Morphogenic Protein-Fibroblast Growth Factor (WNT-BMP-FGF8), plays a role in the interdigital cell death (ICD) which is thought to be repressed in human syndactyly. Animal studies have displayed other pathways such as the Notch signaling, metalloprotease and non-canonical WNT-Planar cell polarity (PCP), to also contribute to failure of ICD, although less prominence has been given. The current diagnosis is based on a clinical evaluation followed by radiography when indicated, and surgical release of digits at 6 months of age is recommended. This review discusses the interactions repressing ICD in syndactyly, and characterizes genes associated with non-syndromic and selected syndromes involving syndactyly, according to the best studied canonical WNT-BMP-FGF interactions in humans. Additionally, the controversies regarding the current syndactyly classification and the effect of non-coding elements are evaluated, which to our knowledge has not been previously highlighted. The aim of the review is to better understand the developmental process leading to this condition., (© 2022. The Author(s).)

Syndactyly is the most common limb defect depicting the bony and/or cutaneous fusion of digits. Syndactyly can be of various types depending on the digits involved in the fusion. To date, eight syndactyly-associated genes have been reported, of which HOXD13 and GJA1 have been explored in a few syndactyly but most of them have unknown underlying genetics. In the present study HOXD13, GJA1 and TP63 genes have been screened by resequencing in 24 unrelated sporadic cases with various syndactyly. The screening revealed two pathogenic HOXD13 variants, NM&#95;000523:c.500 A > G [p.(Y167C)], and NM&#95;000523:c.961 A > C [p.(T321P)] in syndactyly type 1b and type 1c, respectively. This is the first report to identify HOXD13 pathogenic variant in syndactyly type 1b and third report in syndactyly type 1c pathogenesis. Furthermore, this study also reports a TP63 pathogenic variant, NM&#95;003722:c.953 G > A [p.(R318H)] in Ectrodactyly and Cleft lip and palate (ECLP). In conclusion, the current study expands the clinical spectrum of HOXD13 and TP63-related disorders., (© 2021. The Author(s), under exclusive licence to The Japan Society of Human Genetics.)

Loss of function variants of GLI3 are associated with a variety of forms of polysyndactyly: Pallister-Hall syndrome (PHS), Greig-Cephalopolysyndactyly syndrome (GCPS), and isolated polysyndactyly (IPD). Variants affecting the N-terminal and C-terminal thirds of the GLI3 protein have been associated with GCPS, those within the central third with PHS. Cases of IPD have been attributed to variants affecting the C-terminal third of the GLI3 protein. In this study, we further investigate these genotype-phenotype correlations. Sequencing of GLI3 was performed in patients with clinical findings suggestive of a GLI3-associated syndrome. Additionally, we searched the literature for reported cases of either manifestation with mutations in the GLI3 gene. Here, we report 48 novel cases from 16 families with polysyndactyly in whom we found causative variants in GLI3 and a review on 314 previously reported GLI3 variants. No differences in location of variants causing either GCPS or IPD were found. Review of published data confirmed the association of PHS and variants affecting the GLI3 protein's central third. We conclude that the observed manifestations of GLI3 variants as GCPS or IPD display different phenotypic severities of the same disorder and propose a binary division of GLI3-associated disorders in either PHS or GCPS/polysyndactyly., (© 2021 The Authors. Clinical Genetics published by John Wiley & Sons Ltd.)

Background: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention., Methods: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis., Results: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206&#95;207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171&#95;182delGGCGGCGGCGGC: p.56&#95;60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56&#95;60delAAAA) converted the disordered fragment into a short β-strand (residues 63-68 or residues 64-68), thereby forming a conformational change., Conclusions: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management., (© 2021 American Association of Anatomists.)

Oculodentodigital dysplasia (ODDD) is a rare congenital disorder characterised by developmental abnormalities of the eye, dentition and digits of the hands and feet, with neurological symptoms reported in 30% of individuals. Dental anomalies associated with ODDD include enamel hypoplasia and subsequent caries, microdontia, missing teeth, amelogenesis imperfecta, pulp stones and delayed tooth development. Here, we describe the comprehensive dental management of a 3-year-old girl who presented with rapid deterioration of the primary dentition due to generalised enamel hypomineralisation. Conservative, comprehensive restorative management was performed under general anaesthesia. Within 6 months, further breakdown of the remaining unrestored enamel was noted. This case documents the challenges of conservative management in dental anomalies that are not well documented due to the extreme rarity of the disorder., Competing Interests: Competing interests: None declared., (© BMJ Publishing Group Limited 2020. No commercial re-use. See rights and permissions. Published by BMJ.)

Polydactyly is a limb malformation and can occur as nonsyndromic polydactyly, syndromic polydactyly, or along with other limb defects. A few genes have been identified that cause various forms of syndromic and nonsyndromic polydactyly, of which GLI3 has been extensively explored. In the present study, GLI3 gene was screened by direct resequencing in 15 polydactyly cases with or without other anomalies. GLI3 screening revealed two novel pathogenic variants, NM&#95;000168.6:c.3414delC [p.(H1138Qfs*68)] and NM&#95;000168.6:c.1862C>T [p.(P621L)], found in two unrelated cases of familial complex pre- and postaxial polysyndactyly and sporadic Greig cephalopolysyndactyly syndrome (GCPS), respectively. The first pathogenic GLI3 variant, NM&#95;000168.6:c.3414delC, causes premature protein truncation at the C-terminal domain of GLI3. Alternatively, the second pathogenic variant, NM&#95;000168.6:c.1862C>T, lies in the DNA binding domain of GLI3 protein and may affect its hydrophobic interaction with DNA. Both pathogenic GLI3 variants had reduced transcriptional activity in HEK293 cells that likely had led to haploinsufficiency and, consequently, the clinical phenotypes. Overall, the present study reports a novel familial case of complex pre- and postaxial polysyndactyly and the underlying novel pathogenic GLI3 variant expanding the clinical criteria for GLI3 mutational spectrum to complex pre- and postaxial polysyndactyly. Furthermore, this study also reports a novel GLI3 pathogenic variant linked to GCPS, highlighting the known genotype-phenotype correlation., (© 2020 Wiley Periodicals LLC.)

Background: Aplasia cutis congenita (ACC) is a rare, congenital disorder characterized by localized or widespread absence of skin at birth with heterogeneous clinical presentation. The classification proposed by Frieden in 1986 is widely used., Aim: To establish whether, 34 years on, the Frieden classification still meets the needs of dermatologists., Methods: We conducted a retrospective chart review of all patients with a diagnosis of ACC presenting over a 25-year period to a tertiary paediatric dermatology department. We compiled demographic data, clinical characteristics (e.g. number, location and morphology of the lesions), imaging and genetic results where available, and other associated abnormalities, and grouped them according to the Frieden classification. For Type 6 ACC (Bart syndrome) we reviewed neonatal photographs of all babies born with epidermolysis bullosa (EB) over 5 years., Results: Excluding Type 6, there were 56 children with ACC. The scalp was involved in 82.1%, and Type 1 was the commonest type. Over 5 years, 13 of 108 neonates (12%) with EB were born with the appearance of Type 6 ACC. Two children did not fit Frieden's original classification and one had a previously undescribed association of ACC with cleft lip/palate-ectodermal dysplasia 1 syndrome., Conclusion: We conclude that the Frieden classification remains valid with some modifications. Type 3 ACC probably represents a mosaic RASopathy syndrome, while Type 7 could cover nongenetic ACC attributable to trauma. Type 8 should be subdivided into two subgroups: teratogenic and infective. Type 9 covers at least four subgroups. The classification will continue to evolve as new genes and pathomechanisms emerge., (© 2020 British Association of Dermatologists.)

Background: Lacrimo-auriculo-dento-digital (LADD) syndrome is a rare autosomal dominant disorder caused by mutations in one of the three genes: fibroblast growth factor receptor 2 (FGFR2), FGFR3, or FGF10. Affected patients have hypoplasia/aplasia of lacrimal ducts/glands, hypoplasia/aplasia of salivary glands, dental anomalies, ear anomalies, hearing loss, and digital anomalies., Case Presentation: Proband was an 11-year-old male with xerostomia, xerophthalmia, and a referring diagnosis of Sjogren syndrome. He presented with microdontia, hypodontia, low-set/cupped ear auricles, and hearing loss in the left ear., Methods: Whole exome sequencing (WES) was performed on proband. Variations and segregation within the family were verified using Sanger sequencing., Results: Molecular studies revealed a novel heterozygous missense mutation in exon 11 of FGFR2: c.1547C>T (p.Ala516Val), compatible with LADD syndrome., Conclusion: To the best of our knowledge, this is the first report of a family with LADD syndrome in Korea. The combination of xerostomia and xerophthalmia, seen in patients with LADD syndrome, may be misdiagnosed as Sjogren syndrome. WES may be a useful clinical tool in ascertaining the affected gene in patients with suspected genetic disorders. Here, a literature review and summary of 23 case reports/series of LADD syndrome are presented, which may help to identify patients with this condition., (© 2020 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.)

Fraser syndrome (cryptophthalmos-syndactyly syndrome) is a rare autosomal recessive malformation disorder. The first description of the syndrome was reported by George Fraser in 1962. Diagnosis is based on the major and minor criteria established by van Haelst et al. in 2007. Unilateral or bilateral cryptophthalmos, syndactyly, unilateral renal agenesis, and genital anomalies are the most frequent anomalies. Several maxillofacial, oro-dental, ear-nose-throat, hormonal, and anorectal disorders are reported. Cardiac malformations and musculoskeletal anomalies are uncommon. The syndrome is related to mutations in three different genes (FRAS1, FREM2, and GRIP1) resulting in failure of the apoptosis program and disruption of the epithelial-mesenchymal interactions during embryonic development. Prenatal diagnosis is based on the detection of renal agenesis and laryngeal atresia, together with a family history. Most foetuses with severe anomalies are terminated or are stillborn. All patients or pregnancies with a diagnosis of Fraser syndrome should be referred to expert centres. A collaborative approach including anaesthetists, ENT specialists, maxillofacial surgeons, and geneticists is necessary for the management of this syndrome. In vivo and in vitro research models are available to better understand the underlying aetiology., (Copyright © 2020 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.)

Context: Although congenital hand anomalies are among the more common musculoskeletal anomalies worldwide, we do not know its prevalence in our practice., Aims: The aim of the study was to determine the pattern of congenital hand anomalies presenting to our tertiary plastic surgery outpatient service in South-Western Nigeria., Materials and Methods: This is a cross-sectional retrospective analysis of outpatient cases of congenital hand anomalies presenting over a 10-year period. Descriptive and inferential statistics were performed using frequencies, Student's t-test and Chi-square as appropriate. The data were analysed using IBM SPSS Statistics 23.0. The statistical significance value was set at P < 0.05., Results: One hundred and twenty-two cases were identified. The highest number of cases was seen in the year 2012, 23 patients (19.3%). There was a male preponderance of 66 patients (55.1%). Thirty-two patients (26.2%) presented as neonates and 36 (29.5%) as infants. Bilateral anomalies were seen in 67 patients (54.9%). The most common anomaly was failure of differentiation, 88 patients (72.1%) followed by duplication, 26 patients (21.3%). Syndactyly with 43 patients (35.2%) was the most common anomaly under failure of differentiation. No significant associations were found between the type of anomaly and gender or laterality., Conclusions: Syndactyly was the most common congenital hand anomaly in this study. There was a preponderance of bilateral involvement in both syndactyly and polydactyly., Competing Interests: None

Cenani-Lenz syndactyly (CLS) is a rare autosomal recessive syndrome characterized by disorganized oligosyndactyly of upper and lower limbs as well as radioulnar synostosis. Structural renal abnormalities are also common. We report two affected brothers, born to orthodox Jewish parents, in whom we found a novel homozygous missense variant c.4910G>A; p.(Cys1637Tyr) in LRP4 situated in an EGF-like domain between the fourth beta-propeller and transmembrane domains. Both brothers have had recurrent ketotic hypoglycaemia which has not been associated previously. We present 3D computed tomographic imaging illustrating the limb abnormalities in detail.

Background: Long QT syndrome type 8 (LQT8) is a rare genotype of long QT syndrome. Late-appearing T-waves (LaT) are often documented in patients with LQT8, as in long QT syndrome type 3 (LQT3); however, the frequency of LaT and its relevance to the clinical severity of LQT8 remains unclear. This study investigated T-wave morphology (TWM) in LQT3 and LQT8 patients and compared the phenotypes of different TWMs., Methods and results: TWMs were classified into 3 types: early onset T-waves (EoT), LaT, and bifid T-waves (biT). Electrocardiogram (ECG) measurements, symptoms, and topology were compared among TWM types. The study cohort comprised 25 patients with LQT8 (14 mutations) and 25 patients with LQT3 (14 mutations). LaT was detected in 17 (68%) and 13 (52%) LQT8 and LQT3 patients, respectively. There were no significant differences in ECG measurements or the severity of symptoms between patients with LaT and those with other TWMs in either the LQT8 or LQT3 group. However, only patients with LaT experienced cardiopulmonary arrest. Compared with the LQT3 group, in the LQT8 group there was a tendency for mutations in patients with LaT to be located in domain-linking regions., Conclusions: In this study, two-thirds of patients with LQT8 exhibited LaT on ECG, and nearly one-third of those experienced cardiopulmonary arrest. Further investigations are warranted to differentiate between LQT3 and LQT8 in patients exhibiting LaT to optimize therapy.

Background: Syndactyly is a clinical feature of split-hand foot malformation (SHFM), ectodermal-dysplasia-syndactyly (EDSS1) and Cenani-Lenz syndactyly syndromes (CLSS). In EDSS1, only cutaneous syndactyly is observed, with sparse hair, abnormal nails and dentition. In SHFM, bony syndactyly may vary from hypoplasia of one phalanx to aplasia of central digits, extending to complete fusion of all fingers and toes in CLSS. Several genes have been assigned to these syndromes. Performing a single step molecular diagnostics becomes a challenge when a phenotype has overlaps with several syndromes or when some of the clinical features are not fully expressed in patients., Methods: Whole exome sequencing (WES) analysis on one sample derived from a consanguineous family was performed. A causative variant in WES data was prioritized via standard bioinformatics tools. The selected variant was Sanger sequenced in all the available family members for autosomal recessive segregation., Results: A novel missense variant (c.1151A>G; p.Tyr384Cys) was identified in the LRP4 gene. Sanger validation confirmed that all affected individuals were homozygous and the obligate carriers were heterozygous for this variant. The variant is neither reported in 1000 human genomes, nor in 60 706 exomes databases, and is predicted as "pathogenic" by SIFT, Polyphen-2 and MutationTaster software., Conclusions: The present study broadens the pathogenic spectrum of the LRP4 gene in syndactyly syndromes. WES is a powerful tool for genetic analysis in research and can be readily used as a first-line diagnostic test in syndactyly and related phenotypes., (© 2019 John Wiley & Sons, Ltd.)

Grange syndrome (OMIM 602531) is an autosomal recessive condition characterized by severe early onset vascular occlusive disease and variable penetrance of brachydactyly, syndactyly, bone fragility, and learning disabilities. Grange syndrome is caused by homozygous or compound heterozygous loss-of-function variants in the YYA1P1 gene. We report on the case of a 53-year old female with novel homozygous missense variants in YYA1P1 (c.1079C>T, p.Pro360Leu), presenting with a history of brachysyndactyly, hypertension, and ischemic stroke. Imaging studies revealed stenosis of the bilateral internal carotid with extensive collateralization of cerebral vessels in a moyamoya-like pattern, along with stenosis in the splenic, common hepatic, celiac, left renal, and superior mesenteric arteries. Functional studies conducted with the patient's dermal fibroblasts suggest that the p.Pro360Leu variant decreases the stability of the YY1AP1 protein. This is the first report of a missense variant associated with Grange syndrome characterized by later onset of vascular disease and a lack of developmental delay and bone fragility., (© 2019 Wiley Periodicals, Inc.)

Background: Primary and revision surgery for complete complex congenital syndactyly (CCCS) of the hand carries a risk of complications such as web maceration, which can result in flap or graft loss and alter the final appearance. No consensus emerges from the scant published data on postoperative care after CCCS surgery. The objective of this study was to assess the role for temporary external fixation in stabilising the commissure and facilitating surgical wound care., Hypothesis: Using external fixation after CCCS release facilitates postoperative wound care and decreases the complication rate., Material and Methods: Eighteen patients requiring primary CCCS surgery or revision CCCS surgery due to adhesions or web creep were included in a single-centre retrospective study. After release, an external fixator made of Kirschner pins was installed to temporarily immobilise the inter-phalangeal joints. The dressing was changed every 3 days for 3 weeks, and the external fixator was then removed. The parents and nurses completed questionnaires that used 0-10 point scales to assess ease and duration of dressing changes and perceptions and apprehensions experienced by parents and nurses, as well as pain by patients, during dressing changes., Results: No patient experienced maceration or failure of a graft or flap. Pin site discharge was noted in 1 patient and resolved fully after pin removal. Pain intensity was estimated at 4.2/10 during the first dressing change and 1.3/10 during the last dressing change. In the parents, apprehension was 9.6/10 and 5.1/10 during the first and last dressing changes, and stress was 8.1/10 and 4.1/10, respectively. Dressing change difficulty was rated 1.1/10 at the first and 0.9/10 at the last dressing change. Dressing change duration decreased from 13 to 10minutes., Conclusion: These encouraging results support temporary commissure stabilisation by an external fixator to decrease postoperative complication rates and facilitate dressing changes after CCCS release., Level of Evidence: IV, retrospective observational study., (Copyright © 2019 Elsevier Masson SAS. All rights reserved.)

Purpose: We aimed to present a comprehensive assessment of the ophthalmic characteristics of genetically confirmed oculodentodigital dysplasia (ODDD) in 4 members of a single Korean family across 3 generations., Patients and Methods: The characteristics of 4 affected ODDD patients were evaluated. Comprehensive ophthalmic and medical examinations were performed in 3 patients including the proband, together with genetic analysis, and retrospective chart review was conducted for an affected ancestor. For genetic analysis, targeted gene panel sequencing was conducted using genomic DNA extracted from peripheral blood., Results: All affected individuals in this family showed shared ophthalmic abnormalities of microcornea, microphthalmia, elevated intraocular pressure, and shallow anterior chamber, all of which have been reported as typical ocular features of ODDD. Myopic refractive error despite short axial length and thick cornea were highlighted as new findings of ODDD. Facial abnormalities were common in all affected members, but their fingers were normal. Severity of glaucoma was different among the affected individuals and seemed to depend on elevation of intraocular pressure, which occurred in narrow, but open-angle. Genetic analysis revealed the presence of c.119C>T (p.Ala40Val) in GJA1, which is responsible for ODDD, but not found in the control population., Conclusions: This report describes detailed ocular characteristics in a genetically confirmed ODDD family, including unreported findings of thick cornea and myopic refractive error despite short axial length. The ocular features derived from the A40V mutation in GJA1 showed complete penetrance, suggesting a possible role of Cx43 in regulation of IOP and pathogenesis of glaucoma.

Although congenital hand anomalies associated with finger nubbins may be produced by amniotic band disruption sequence (ABDS), symbrachydactyly should be considered in the differential diagnosis. ABDS usually affects more than one limb but symbrachydactyly largely is limited to one upper extremity, and has five distinct clinical presentations: short-fingered, atypical cleft, monodactylous, peromelic, and a forearm proximal transverse deficiency. This article discusses the diagnosis of symbrachydactyly compared with ABDS and outlines plans for managing patients with symbrachydactyly.

Lacrimo-auriculo-dento-digital syndrome (LADD) is a rare autosomal dominant disorder arising from heterozygous mutations in the genes encoding fibroblast growth factor receptors two and three and the gene encoding the fibroblast growth factor 10. The characteristics associated with LADD are mainly related with hypoplasia or aplasia of lacrimal and salivary ducts, low cup-shaped ears, sensorineural or conductive hearing loss, abnormalities of teeth, and anomalies of the hands and feet. The purpose of this paper is to describe a 13-year-old female patient with a history of a blocked tear duct, mild hearing loss, congenitally missing teeth, tauro- dontism, and malformation of the fingers who was referred for a dental evaluation. She was diagnosed with LADD syndrome based on her clinical picture. (J Dent Child 2019;86(1):53-60)
Received August 16, 2018; Last Revision November 8, 2018; Accepted November 9, 2018 .