Search

Using a hippocampus-dependent contextual threat learning and memory task, we report widespread, coordinated DNA methylation changes in CA1 hippocampus of Sprague-Dawley rats specific to threat learning at genes involved in synaptic transmission. Experience-dependent alternations in gene expression and DNA methylation were observed as early as 1 h following memory acquisition and became more pronounced after 24 h. Gene ontology analysis revealed significant enrichment of functional categories related to synaptic transmission in genes that were hypomethylated at 24 h following threat learning. Integration of these data sets with previously characterized epigenetic and transcriptional changes in brain disease states suggested significant overlap between genes regulated by memory formation and genes altered in memory-related neurological and neuropsychiatric diseases. These findings provide a comprehensive resource to aid in the identification of memory-relevant therapeutic targets. Our results shed new light on the gene expression and DNA methylation changes involved in memory formation, confirming that these processes are dynamic and experience-dependent. Finally, this work provides a roadmap for future studies to identify linkage of memory-associated genes to altered disease states.

Understanding the cellular and molecular mechanisms underlying the formation and maintenance of memories is a central goal of the neuroscience community. It is well regarded that an organism's ability to lastingly adapt its behavior in response to a transient environmental stimulus relies on the central nervous system's capability for structural and functional plasticity. This plasticity is dependent on a well-regulated program of neurotransmitter release, post-synaptic receptor activation, intracellular signaling cascades, gene transcription, and subsequent protein synthesis. In the last decade, epigenetic markers like DNA methylation and post-translational modifications of histone tails have emerged as important regulators of the memory process. Their ability to regulate gene transcription dynamically in response to neuronal activation supports the consolidation of long-term memory. Furthermore, the persistent and self-propagating nature of these mechanisms, particularly DNA methylation, suggests a molecular mechanism for memory maintenance. In this review, we will examine the evidence that supports a role of epigenetic mechanisms in learning and memory. In doing so, we hope to emphasize (1) the widespread involvement of these mechanisms across different behavioral paradigms and distinct brain regions, (2) the temporal and genetic specificity of these mechanisms in response to upstream signaling cascades, and (3) the functional outcome these mechanisms may have on structural and functional plasticity. Finally, we consider the future directions of neuroepigenetic research as it relates to neuronal storage of information.

Experiences during early development profoundly affect development of the central nervous system (CNS) to impart either risk for or resilience to later psychopathology. Work in the developmental neuroscience field is providing compelling data that epigenetic marking of the genome may underlie aspects of this process. Experiments in rodents continue to show that experiences during sensitive periods of development influence DNA methylation patterns of several genes. These experience-induced DNA methylation patterns represent stable epigenetic modifications that alter gene transcription throughout the lifespan and promote specific behavioral outcomes. We discuss the relevance of these findings to humans, and also briefly discuss these findings in the broader contexts of cognition and psychiatric disorder. We conclude by discussing the implications of these observations for future research.

Post-retrieval interference with a memory has uncovered a phenomenon known to the field as reconsolidation. In this article, we will review the specific molecular mechanisms that have been implicated in reconsolidation. As a result of numerous studies over the past five years, it can now be said with a fair amount of certainty that reconsolidation is not a recapitulation of the mechanisms underlying consolidation, despite what the term "reconsolidation" may suggest. Therefore, in addition to reviewing the known mechanisms of reconsolidation, we will propose that two experimental approaches involving the targeting of specific molecular mechanisms, and the study of these mechanisms during retrieval, may serve useful to the field as it is now able to advance beyond comparisons between consolidation and reconsolidation.

Long-term memory formation is regulated by many distinct molecular mechanisms that control gene expression. An emerging model for effecting a stable, coordinated pattern of gene transcription involves epigenetic tagging through modifications of histones or DNA. In this study, we investigated the regulation of histone phosphorylation in the hippocampus by the ERK/MAPK (extracellular signal-regulated kinase/mitogen-activated protein kinase) pathway. We found that activation of ERK/MAPK in vitro significantly increased histone H3 phosphorylation in hippocampal area CA1. Furthermore, we found that contextual fear conditioning in vivo leads to a rapid time-dependent increase in histone H3 phosphorylation in area CA1. This increase paralleled the time course of contextual fear-dependent activation of ERK, and was inhibited in vivo by a latent inhibition paradigm as well as by injection of an N-methyl-d-aspartic acid receptor (NMDA-R) antagonist. Finally, injection of an inhibitor of MEK (MAP kinase/ERK kinase), the unique dual-specificity kinase upstream of ERK, blocked the increase in histone H3 phosphorylation seen after contextual fear conditioning. These results demonstrate that changes in histone phosphorylation in the hippocampus are regulated by ERK/MAPK following a behavioral fear conditioning paradigm. (Contains 4 figures.)

Memory formation is a multi-stage process that initially requires cellular consolidation in the hippocampus, after which memories are downloaded to the cortex for maintenance, in a process termed systems consolidation (1). Epigenetic mechanisms regulate both types of consolidation (2-7), but histone variant exchange, in which canonical histones are replaced with their variant counterparts, is an entire branch of epigenetics that has received limited attention in the brain (8-12) and has never, to our knowledge, been studied in relation to cognitive function. Here we show that histone H2A.Z, a variant of histone H2A, is actively exchanged in response to fear conditioning in the hippocampus and the cortex, where it mediates gene expression and restrains the formation of recent and remote memory. Our data provide evidence for H2A.Z involvement in cognitive function and specifically implicate H2A.Z as a negative regulator of hippocampal consolidation and systems consolidation, probably through downstream effects on gene expression. Moreover, alterations in H2A.Z binding at later stages of systems consolidation suggest that this histone has the capacity to mediate stable molecular modifications required for memory retention. Overall, our data introduce histone variant exchange as a novel mechanism contributing to the molecular basis of cognitive function and implicate H2A.Z as a potential therapeutic target for memory disorders. AGCACCTGCGATCCTTTCC GCTTACCTTTCACCACCCTGT CGCGTGTGTGCTGGTTATTT, As a first step in exploring the role of H2A.Z in cognitive function, we used immunohistochemistry to confirm its expression throughout the hippocampus (Extended Data Fig. 1a-c). Next, we showed [...]

Kv4.2 is the primary pore-forming subunit encoding A-type currents in many neurons throughout the nervous system, and it also contributes to the transient outward currents of cardiac myocytes. A-type currents in the dendrites of hippocampal CA1 pyramidal neurons are regulated by activation of ERK/MAPK, and Kv4.2 is the likely pore-forming subunit of that current. We showed previously that Kv4.2 is directly phosphorylated at three sites by ERK/MAPK (T602, T607, and $616). In this study we determined whether direct phosphorylation of Kv4.2 by ERK/ MAPK is responsible for the regulation of the A-type current observed in neurons. We made site-directed mutants, changing the phosphosite serine (S) or threonine (T) to aspartate (D) to mimic phosphorylation. We found that the T607D mutation mimicked the electrophysiological changes elicited by ERK/MAPK activation in neurons: a rightward shift of the activation curve and an overall reduction in current compared with wild type (WT). Surprisingly, the $616D mutation caused the opposite effect, a leftward shift in the activation voltage. [K.sup.+] channel-interacting protein (KChIP)3 ancillary subunit coexpression with Kv4.2 was necessary for the T607D effect, as the T607D mutant when expressed in the absence of KChIP3 was not different from WT Kv4.2. These data suggest that direct phosphorylation of Kv4.2 at T607 is involved in the dynamic regulation of the channel function by ERK/MAPK and an interaction of the primary subunit with KChIP is also necessary for this effect. Overall these studies provide new insights into the structure-function relationships for MAPK regulation of membrane ion channels. [K.sup.+] channel-interacting protein; kinase; neurons; A-type current

I. Introduction A. [K.sup.+] Channel Overview II. Molecular Structure A. Mechanisms of voltage-sensing B. Mechanisms of inactivation C. The T1 domain and [K.sup.+] channel multimerization III. Subcellular Localization and Trafficking [...]