Search

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years and implementing them with classical plant virology techniques results to a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (familyBromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and severalFabaceaeandRosaceaeplant species. Such a very diverse host association is atypical for ilarviruses, thus warranted further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared to other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, while the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 inSolanum villosumand its mechanical and graft transmissibility to solanaceous species were demonstrated. Near identical SnIV1 genomes from the inoculum (S. villosum) and inoculatedNicotiana benthamianawere sequenced, thus partially fulfilling Koch’s postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infectedN. benthamianaleaf tissues. Overall, this study provided information to better understand the diversity, distribution, and pathobiology of SnIV1, but whether it could emerge as a destructive pathogen remains uncertain.FundingEU Horizon 2020 Marie Skłodowska-Curie Actions Innovative Training Network (H2020 MSCA-ITN) project no. GA 813542Administration of the Republic of Slovenia for Food Safety, Veterinary Sector and Plant Protection and Slovenian Research Agency (ARRS) funding no. P4-0165, P4-0407, J4-4553Balik Scientist Program (Republic Act 11035) of the Department of Science and Technology– Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development (DOST–PCAARRD), Republic of the PhilippinesThe Belgian FPS Health Food Chain Safety and Environment under Project RT18/3 SEVIPLANT

International audience; Grapevine virus L (GVL) is a recently described vitivirus (family Betaflexiviridae) with a positive-sense single-stranded RNA genome. It has so far been reported from China, Croatia, New-Zealand, the United States and Tunisia (Debat et al. 2019; Diaz-Lara et al. 2019; Alabi et al. 2020; Ben Amar et al. 2020). It has significant genetic variability (up to 26% of nucleotide divergence between isolates) and the existence of four phylogroups has been proposed (Alabi et al. 2020). In the frame of a project investigating the possible links between grapevine trunk diseases and grapevine virome, viral high throughput sequencing (HTS)-based testing was performed on symptomatic and asymptomatic grapevines collected in July 2019 in vineyards of four areas in France (Bourgogne, Charentes, Gard, Gironde) corresponding to five cultivars of Vitis vinifera (Cabernet franc, Cabernet Sauvignon, Chardonnay, Sauvignon, Ugni blanc). Total RNAs were purified from powder of 105 trunk wood samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and RNA-seq libraries were prepared using Zymo-Seq RiboFree Total RNA Library Prep Kit (Ozyme, Saint Cyr l’Ecole, France). HTS was performed on a S4 lane of Illumina NovaSeq 6000 using a paired-end read length of 2x150 bp. The trimmed sequence reads obtained from Chardonnay plants CH30-75M (99.9 M) and CH37-19S (114 M) from a vineyard in Gard were analyzed using CLC Genomics Workbench v21 (Qiagen, Courtaboeuf, France) and revealed complex mixed infections. Besides contigs representing a complete GVL genome (average scaffold coverage: 6,197x and 2,970x, respectively), contigs from grapevine rupestris stem pitting virus (1,697x ; 1,124x), grapevine virus A (82x ; 95x), grapevine pinot gris virus (1,475x ; 866x), grapevine leafroll-associated virus 3 (5,122x ; 1,042x), hop stunt viroid (13,783x ; 29,514x) and grapevine yellow speckle viroid 1 (690x ; 1158x) were also identified. Plant CH37-19S was also co-infected by grapevine rupestris vein feathering virus (164x). The GVL contigs integrated respectively 320,000 and 152,000 reads (corresponding to 0.32% and 0.11% of filtered/trimmed reads, respectively). The GVL genomic sequences from each sample (7,616 nt) have been deposited in GenBank (Accession nos. OK042110 and OK042111, respectively). The two contigs are nearly identical (99.9% nt identity) and share respectively 97.5% and 95.9% with GVL-KA from the USA (MH643739) and GVL-RS from China (MH248020), the closest isolates present in GenBank. To confirm the presence of GVL, the original grapevines were resampled in the field and total RNAs were extracted as described above from cambial scrappings and leaves. Total RNAs were used for RT-PCR tests using primers targeting a 279-bp fragment corresponding to the 3’ end of the coat protein gene and part of the nucleic acid binding protein gene (Debat et al. 2019). The Sanger-derived sequences from the amplicons shared 100% nt identities with the corresponding sequences of the HTS assembled genomes, confirming the presence of GVL in both tissues of both grapevine samples. To our knowledge, this represents the first report of the occurrence of GVL in vineyards in France. Given the complex mixed infection present in the two analyzed grapevines, no conclusions can be drawn on the pathogenicity of GVL. Further efforts are needed to better understand GVL distribution and its potential pathogenicity to grapevine. References Alabi, O J., et al. 2020. Arch. of Virol. 165:1905-1909. Ben Amar, A., et al. 2020. Plant disease 104:3274. Debat, H., et al. 2019. Eur J Plant Pathol. 155:319. Diaz-Lara, A., et al. 2019. Arch. of Virol. 164:2573. Acknowledgments The authors are grateful to the “Plan National Dépérissement du Vignoble” (Mycovir project) for the financial support

As part of a cereals virome project high throughput sequencing (HTS)-based viral indexing was performed on plants with symptoms of barley yellow dwarf disease collected in June (2017-2020) in the main French cereals production areas. Total RNAs from 32 individual plants were purified (RNeasy Plant Mini Kit, Qiagen, Courtaboeuf, France) and Illumina sequenced (2x150 nt) following ribodepletion (Genewiz-Azenta, Leipzig, Germany). Following quality trimming, reads for each sample were de novo assembled (CLC Genomics Workbench 21, Qiagen) [1] and contigs annotated by BlastX analysis. In four winter barley samples collected in 2018 (18-58, 18-325 and 18-326) and 2019 (19-30A), besides contigs representing diverse viruses such as barley yellow dwarf viruses-PAV and PAS, Hordeum vulgare endornavirus, cereal yellow dwarf virus-RPV (18-326), wheat dwarf virus (18-325 and 18-326) and a novel Polerovirus (18-58 and 18-326), large contigs with high identity to barley virus G (BVG) were identified. BVG, a tentative Polerovirus, was initially reported in barley in South Korea in 2016 [2] and has so far been identified in a few other hosts including wheat, oat, maize, proso and foxtail millets as well as switchgrass. It has been reported from the USA and Australia [3] and, in Europe, from the Netherlands, Germany, Hungary and Greece [4]. Large BVG scaffolds representing near complete genomes could be reconstructed for each sample, integrating a total of 128.339, 7.188, 8.078 and 20.073 reads, for samples 19-30A, 18-58, 18325 and 18-326 respectively. Given that between 17.2 and 20.5 million reads had been obtained per sample, these values translate into between 0.04% (18-58 and 18-325) and 0.6% (19-30A) of total reads, and to average coverages of between 158x (18-58) and 2866x (19-30A) for the genomic scaffolds. The four assembled sequences (5584-5610 nt) have been deposited in GenBank (ON419453-ON419456). They are nearly identical (98.4 to 99.5% nt identity) and share between 97.7% and 98.5% nt identity with a barley reference isolate from the South Korea (NC_029906). To confirm the presence of BVG, a primer pair was designed based on available BVG sequences. Primers BVG-F(5'-CTAGCCCAACGAGTTGCGGG-3') and BVG-R(5'-GGTACAGAAGCTCTACGGTTC-3') amplifying a 394 nt were used in a two-step RT-PCR on new RNA extracts obtained from the 18-325 and 18-326 infected plants. The amplicons were directly sequenced and showed respectively 99.2% (ON419457, 18-325) and 100% (18-326) nt identity with the corresponding de novo scaffolds. The four analyzed samples have been collected respectively in 2018 (18-58, 18-325, 18-326) and 2019 (19-30A) in three different regions of France (Auvergne-Rhône-Alpes, Occitanie and Centre-Val de Loire), indicating a wide distribution and a persistence over time of BVG in France. To our knowledge, this represents the first report of a natural infection of BVG in cultivated winter barley in France. Presence of BVG may have been overlooked in a range of situation, as indicated by its retrospective discovery in a 34 years old Australian sample [3], possibly explaining its broad distribution in France. While the mixed infection status of the analyzed plants precludes any conclusion on its pathogenicity in French cereals, BVG has been reported to be associated with a range of symptoms in various hosts so that further studies to evaluate its prevalence and impact in France and to begin to understand its epidemiology are clearly warranted by the present results.

Dioscorea mosaic associated virus (DMaV) is a member of the genus Sadwavirus, family Secoviridae, that is associated with mosaic symptoms in Dioscorea rotundata in Brazil. The genome of a DMaV isolate detected in D. trifida in Guadeloupe was sequenced by high-throughput sequencing. Using an RT-PCR-based detection assay, we found that DMaV infects D. alata, D. bulbifera, D. cayenensis-rotundata, D. esculenta, and D. trifida accessions conserved in Guadeloupe and Côte d'Ivoire and displays a very high level of molecular diversity in a relatively small region of the genome targeted by the assay. We also provide evidence that DMaV is also present in D. rotundata in Benin and in D. alata in Nigeria.

International audience; A novel geminivirus was identified in France and Spain in asymptomatic plants of white clover (Trifolium repens) and shrub medick (Medicago arborea). Its genome has the hallmarks of a capulavirus, and its relationship to other capulaviruses was confirmed by phylogenetic analysis. White clover isolates formed a tight cluster in the phylogenetic tree, while shrub medick isolates formed two distinct, more divergent groups with sequence identity values close to the species cutoff. These three groups have likely participated in recombination events involving alfalfa leaf curl virus and French bean severe leaf curl virus. The name "trifolium virus 1" (TrV1) is proposed for this new Capulavirus. Three TrV1 genotypes (TrV1-A, TrV1-B, and TrV1-C) were clearly distinguished.

International audience; An emerging systemic necrosis disease of corn salad was first observed in the Nantes region of France in the late 2000’s. Classical virology and high-throughput sequencing approaches demonstrated that the disease is associated with four different necroviruses, tobacco necrosis virus A (TNVA), tobacco necrosis virus D (TNVD), olive mild mosaic virus (OMMV) and a novel recombinant Alphanecrovirus for which the name corn salad necrosis virus (CSNV) is proposed. Satellite tobacco necrosis virus (STNV) was also frequently observed. Koch’s postulates were completed for all four agents, each one alone being able to cause systemic necrosis of varying severity in corn salad. OMMV was the most frequently observed virus and causes the most severe symptoms. TNVA was the second, both in terms of prevalence and symptom severity while TNVD and CSNV were only rarely observed and cause the less severe symptoms. The emergence of this systemic disease may have been favoured by the short and repeated cropping cycles used for corn salad, possibly allowing the selection of necrovirus isolates with an improved ability to systemically invade this specialty crop.