Search

Meng-Dan Zhao,1 Jin-Lin Cheng,2 Jing-Jing Yan,1 Feng-Ying Chen,1 Jian-Zhong Sheng,3 Dong-Li Sun,1 Jian Chen,4 Jing Miao,4 Run-Ju Zhang,1 Cai-Hong Zheng,1 He-Feng Huang1,5 1Women’s Hospital, School of Medicine, Zhejiang University, Hangzhou, 2State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, The First Affiliated Hospital, College of Medicine, 3Department of Pathophysiology, School of Medicine, 4The First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, 5International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, People’s Republic of China Abstract: To identify a new drug candidate for treating endometriosis which has fewer side effects, a new polymeric nanoparticle gene delivery system consisting of polyethylenimine-grafted chitosan oligosaccharide (CSO-PEI) with hyaluronic acid (HA) and small interfering RNA (siRNA) was designed. There was no obvious difference in sizes observed between (CSO-PEI/siRNA)HA and CSO-PEI/siRNA, but the fluorescence accumulation in the endometriotic lesion was more significant for (CSO-PEI/siRNA)HA compared with CSO-PEI/siRNA due to the specific binding of HA to CD44. In addition, the (CSO-PEI/siRNA)HA nanoparticle gene therapy significantly decreased the endometriotic lesion sizes with atrophy and degeneration of the ectopic endometrium. The epithelial cells of ectopic endometrium from rat models of endometriosis showed a significantly lower CD44 expression than control after treatment with (CSO-PEI/siRNA)HA. Furthermore, observation under an electron microscope showed no obvious toxic effect on the reproductive organs. Therefore, (CSO-PEI/siRNA)HA gene delivery system can be used as an effective method for the treatment of endometriosis. Keywords: chitosan-PEI, hyaluronic acid, AQP2-siRNA, endometriosis, targeted therapy

The intermediate epoxy alcohols prepared via a Payne rearrangement can be trapped with arylselenide anions, giving mixtures of ring-opened products. The 1-arylseleno-2,3-diols are generally favored over the 3-arylseleno-1,2-diols in this process although the reaction of trisubstituted epoxyalcohols, for example, 17, differs from those of disubstituted epoxyalcohols, for example, 21.

© 2014 Elsevier Ltd. The intermediate epoxy alcohols prepared via a Payne rearrangement can be trapped with arylselenide anions, giving mixtures of ring-opened products. The 1-arylseleno-2,3-diols are generally favored over the 3-arylseleno-1,2-diols in this process although the reaction of trisubstituted epoxyalcohols, for example, 17, differs from those of disubstituted epoxyalcohols, for example, 21.

Objective: To investigate the effects of astragaloside IV (AS-IV) on podocyte injury of diabetic nephropathy (DN) and reveal its potential mechanism., Methods: In in vitro experiment, podocytes were divided into 4 groups, normal, high glucose (HG), inositol-requiring enzyme 1 (IRE-1) α activator (HG+thapsigargin 1 µmol/L), and IRE-1α inhibitor (HG+STF-083010, 20 µmol/L) groups. Additionally, podocytes were divided into 4 groups, including normal, HG, AS-IV (HG+AS-IV 20 µmol/L), and IRE-1α inhibitor (HG+STF-083010, 20 µmol/L) groups, respectively. After 24 h treatment, the morphology of podocytes and endoplasmic reticulum (ER) was observed by electron microscopy. The expressions of glucose-regulated protein 78 (GRP78) and IRE-1α were detected by cellular immunofluorescence. In in vivo experiment, DN rat model was established via a consecutive 3-day intraperitoneal streptozotocin (STZ) injections. A total of 40 rats were assigned into the normal, DN, AS-IV [AS-IV 40 mg/(kg·d)], and IRE-1α inhibitor [STF-083010, 10 mg/(kg·d)] groups (n=10), respectively. The general condition, 24-h urine volume, random blood glucose, urinary protein excretion rate (UAER), urea nitrogen (BUN), and serum creatinine (SCr) levels of rats were measured after 8 weeks of intervention. Pathological changes in the renal tissue were observed by hematoxylin and eosin (HE) staining. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) and Western blot were used to detect the expressions of GRP78, IRE-1α, nuclear factor kappa Bp65 (NF-κBp65), interleukin (IL)-1β, NLR family pyrin domain containing 3 (NLRP3), caspase-1, gasdermin D-N (GSDMD-N), and nephrin at the mRNA and protein levels in vivo and in vitro, respectively., Results: Cytoplasmic vacuolation and ER swelling were observed in the HG and IRE-1α activator groups. Podocyte morphology and ER expansion were improved in AS-IV and IRE-1α inhibitor groups compared with HG group. Cellular immunofluorescence showed that compared with the normal group, the fluorescence intensity of GRP78 and IRE-1α in the HG and IRE-1α activator groups were significantly increased whereas decreased in AS-IV and IRE-1α inhibitor groups (P<0.05). Compared with the normal group, the mRNA and protein expressions of GRP78, IRE-1α, NF-κ Bp65, IL-1β, NLRP3, caspase-1 and GSDMD-N in the HG group was increased (P<0.05). Compared with HG group, the expression of above indices was decreased in the AS-IV and IRE-1α inhibitor groups, and the expression in the IRE-1α activator group was increased (P<0.05). The expression of nephrin was decreased in the HG group, and increased in AS-IV and IRE-1α inhibitor groups (P<0.05). The in vivo experiment results revealed that compared to the normal group, the levels of blood glucose, triglyceride, total cholesterol, BUN, blood creatinine and urinary protein in the DN group were higher (P<0.05). Compared with DN group, the above indices in AS-IV and IRE-1α inhibitor groups were decreased (P<0.05). HE staining revealed glomerular hypertrophy, mesangial widening and mesangial cell proliferation in the renal tissue of the DN group. Compared with the DN group, the above pathological changes in renal tissue of AS-IV and IRE-1α inhibitor groups were alleviated. Quantitative RT-PCR and Western blot results of GRP78, IRE-1α, NF-κ Bp65, IL-1β, NLRP3, caspase-1 and GSDMD-N were consistent with immunofluorescence analysis., Conclusion: AS-IV could reduce ERS and inflammation, improve podocyte pyroptosis, thus exerting a podocyte-protective effect in DN, through regulating IRE-1α/NF-κ B/NLRP3 signaling pathway., (© 2024. The Chinese Journal of Integrated Traditional and Western Medicine Press and Springer-Verlag GmbH Germany, part of Springer Nature.)

Ferroptosis is a form of cell death resulting from the disruption of iron metabolism within cells and excessive accumulation of lipid peroxides. Research indicates that, under the influence of various pathogenic factors, ferroptosis impacts the male reproductive system and fertility by affecting the synthesis of testicular hormones and regulation of cellular functions through different pathways and numerators. This paper provides an overview of the action mechanisms of ferroptosis in the testis and its correlation with pathogenicity, offering some new insights into the treatment of male reproductive system diseases.

Objectives: This study aimed to systematically assess the methodological quality and key recommendations of the guidelines for the diagnosis and treatment of liver failure (LF), furnishing constructive insights for guideline developers and equipping clinicians with evidence-based information to facilitate informed decision-making., Data Sources: Electronic databases and manual searches from January 2011 to August 2023., Study Selection: Two reviewers independently screened titles and abstracts, then full texts for eligibility. Fourteen guidelines were included., Data Extraction and Synthesis: Two reviewers extracted data and checked by two others. Methodological quality of the guidelines was appraised using the Appraisal of Guidelines for Research and Evaluation II tool. Of the 14 guidelines, only the guidelines established by the Society of Critical Care Medicine and the American College of Gastroenterology (2023) achieved an aggregate quality score exceeding 60%, thereby meriting clinical recommendations. It emerged that there remains ample room for enhancement in the quality of the guidelines, particularly within the domains of stakeholder engagement, rigor, and applicability. Furthermore, an in-depth scrutiny of common recommendations and supporting evidence drawn from the 10 adult LF guidelines unveiled several key issues: controversy exists in the recommendation, the absence of supporting evidence and confusing use of evidence for recommendations, and a preference in evidence selection., Conclusions: There are high differences in methodological quality and recommendations among LF guidelines. Improving these existing problems and controversies will benefit existing clinical practice and will be an effective way for developers to upgrade the guidelines., Competing Interests: This study was supported by the National Natural Science Foundation of China (no. 82160106) to Dr. Yang and Yunnan's Young Academic and Technical Leaders Reserve Talent Project (no. 202105AC160049) to Dr. Sun. The remaining authors have disclosed that they do not have any potential conflicts of interest, (Copyright © 2024 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the Society of Critical Care Medicine and Wolters Kluwer Health, Inc.)

Chronic nonbacterial prostatitis (CNP) is one of the most common diseases in urology and andrology, with a complex etiology and a high incidence rate. Traditional Chinese medicine plays an important role in the treatment of CNP and can produce therapeutic effects through various action mechanisms. This article presents an overview of recent studies on the specific mechanisms of traditional Chinese medicine acting on CNP, including the mechanisms underlying its effects of anti-infection, anti-inflammation, immune regulation, improvement of urodynamics, endocrine regulation, improvement of microcirculation, and regulation of gut microbiota, aiming to provide some reference for the clinical application and basic studies of traditional Chinese medicine in the treatment of CNP.

Background: Glutamine is crucial for the activation and efficacy of T cells, and may play a role in regulating the immune environment. This study aimed to investigate the potential role of glutamine in the activation and proliferation of induced regulatory T cells (iTregs)., Methods: CD4 + CD45RA + T cells were sorted from peripheral blood mononuclear cells and cultured to analyze iTreg differentiation. Glutamine was then added to the culture system to evaluate the effects of glutamine on iTregs by determining oxidative phosphorylation (OXPHOS), apoptosis, and cytokine secretion. Additionally, a humanized murine graft-versus-host disease (GVHD) model was constructed to confirm the efficacy of glutamine-treated iTregs in vivo., Results: After being cultured in vitro, glutamine significantly enhanced the levels of Foxp3, CTLA-4, CD39, CD69, IL-10, TGF-β, and Ki67 (CTLA-4, IL-10, TGF-β are immunosuppressive markers of iTregs) compared with that of the control iTregs (P < 0.05). Furthermore, the growth curve showed that the proliferative ability of glutamine-treated iTregs was better than that of the control iTregs (P < 0.01). Compared with the control iTregs, glutamine supplementation significantly increased oxygen consumption rates and ATP production (P < 0.05), significantly downregulated Annexin V and Caspase 3, and upregulated BCL2 (P < 0.05). However, GPNA significantly reversed the effects of glutamine (P < 0.05). Finally, a xeno-GVHD mouse model was successfully established to confirm that glutamine-treated iTregs increased the mice survival rate, delayed weight loss, and alleviated colon injury., Conclusion: Glutamine supplementation can improve the activity and immunosuppressive action of iTregs, and the possible mechanisms by which this occurs are related to cell proliferation, apoptosis, and OXPHOS., (Copyright © 2023. Published by Elsevier B.V.)

Objective: Intestinal fibrosis is a refractory complication of inflammatory bowel disease (IBD). Tumor necrosis factor ligand-related molecule-1A (TL1A) is important for IBD-related intestinal fibrosis in a dextran sodium sulfate (DSS)-induced experimental colitis model. This study aimed to explore the effects of TL1A on human colonic fibroblasts., Methods: A trinitrobenzene sulfonic acid (TNBS)-induced experimental colitis model of LCK-CD2-TL1A-GFP transgenic (Tg) or wild-type (WT) mice was established to determine the effect and mechanism of TL1A on intestinal fibrosis. The human colonic fibroblast CCD-18Co cell line was treated concurrently with TL1A and human peripheral blood mononuclear cell (PBMC) supernatant. The proliferation and activation of CCD-18Co cells were detected by BrdU assays, flow cytometry, immunocytochemistry and Western blotting. Collagen metabolism was tested by Western blotting and real-time quantitative polymerase chain reaction (RT-qPCR)., Results: The level of collagen metabolism in the TNBS+ethyl alcohol (EtOH)/Tg group was greater than that in the TNBS+EtOH/WT group. Transforming growth factor-β1 (TGF-β1) and p-Smad3 in the TNBS+EtOH/Tg group were upregulated as compared with those in the TNBS+EtOH/WT group. The proliferation of CCD-18Co cells was promoted by the addition of human PBMC supernatant supplemented with 20 ng/mL TL1A, and the addition of human PBMC supernatant and TL1A increased CCD-18Co proliferation by 24.4% at 24 h. TL1A promoted cell activation and increased the levels of COL1A2, COL3A1, and TIMP-1 in CCD-18Co cells. Treatment of CCD-18Co cells with TL1A increased the expression of TGF-β1 and p-Smad3., Conclusion: TL1A promotes TGF-β1-mediated intestinal fibroblast activation, proliferation, and collagen deposition and is likely related to an increase in the TGF-β1/Smad3 signaling pathway., (© 2024. Huazhong University of Science and Technology.)

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin ( SPAST ) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain ( COL6A3 ) (NM&#95;004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM&#95;014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM&#95;004006; exon11):c.1150-17&#95;1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST : c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND., Competing Interests: The authors declare that they have no competing interests., (Copyright: © 2024 Chen et al.)

Objective: To investigate the safety and application value of combining Laennec extracapsular occlusion with ICG fluorescence imaging in laparoscopic anatomic hepatectomy., Methods: Complete laparoscopic dissection was performed outside the Laennec sheath, blocking Glisson's pedicle of the corresponding liver segment or lobe. An appropriate amount of indocyanine green (ICG) dye was intravenously injected, and the boundary line between the pre-cut liver segment and liver lobe was identified using fluorescence laparoscopy. Complete resection of the liver segment or lobe was performed based on anatomical markers. Clinical data, including operation time, intraoperative blood loss, postoperative hospital stay, and postoperative complications, were collected., Results: A total of 14 cases were included in the study, including seven cases of primary liver cancer, three cases of metastatic liver cancer, three cases of intrahepatic bile duct calculi, and one case of hepatic hemangioma. All 14 patients underwent anatomic hepatectomy under fluorescent laparoscopy, with four cases involving the right liver, seven cases involving the left liver, two cases involving the right anterior lobe, and one case involving the right posterior lobe., Conclusion: Combining laparoscopic follow-up of the Laennec membrane with Glisson outer sheath block and intraoperative ICG fluorescence imaging provides real-time guidance for locating the resection boundaries during anatomic hepatectomy. This approach helps in controlling intraoperative bleeding, reducing operation time, and ensuring high safety. It holds significant value in clinical application., (© 2024 The Authors. ANZ Journal of Surgery published by John Wiley & Sons Australia, Ltd on behalf of Royal Australasian College of Surgeons.)

Background: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported., Materials and Methods: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation., Results: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM&#95;002470.4: c.3377A>G; p. (E1126G) and NM&#95;002470.4: c.5161-2A>C. It was indicated that the NM&#95;002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM&#95;002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts., Conclusions: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations., (© 2024 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.)

Polycyclic aromatic hydrocarbon-fused [n]helicene derivatives (PAH-fused [n]helicenes) have been widely investigated due to their excellent photoelectric and chiroptical properties. Herein, a series of pyrene-fused helicenes were synthesized by a photocyclization reaction and characterized by 1 H/ 13 C NMR spectroscopy and single crystal X-ray diffraction. All compounds and their vinyl precursors were studied as emitting materials. The experimental results reveal that these compounds possess reasonable emission efficiency (Φ FL  = 97% for 3a) and tunable optical properties, and a wide emission band from bluish violet for 3c (401 nm) to green-yellow for 4c (530 nm) was observed. The detailed investigation indicated that an efficient, structure-controlled strategy was established to develop pyrene-based [n]helicene materials., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Background: To systematically evaluate the methodological quality of the current up-to-date guidelines pertaining to choledocholithiasis, we conducted a comprehensive analysis of key recommendations and corresponding evidence, focusing on the heterogeneity among these guidelines., Method: Systematic searches across various databases were performed to identify the latest guidelines. The identified guidelines, which met the inclusion criteria, underwent evaluation using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) tool. The key recommendations and evidence from the included guidelines were extracted and reclassified using the Oxford Centre for Evidence-Based Medicine (OCEBM) grading system, and the obtained results were analyzed., Results: Nine guidelines related to choledocholithiasis were included in this study, out of which 4 achieved an overall standardized score of more than 60%, indicating their suitability for recommendation. Upon closer examination of the main recommendations within these guidelines, we discovered significant discrepancies concerning the utilization of similar treatment techniques for different diseases or different treatment methods under comparable conditions, and discrepancies in the recommended treatment duration. High-quality research evidence was lacking, and some recommendations either failed to provide supporting evidence or cited inappropriate and low-level evidence., Conclusion: The quality of guidelines pertaining to choledocholithiasis is uneven. Recommendations for the treatment of choledocholithiasis demonstrate considerable disparities among the guidelines, particularly regarding the utilization of endoscopic retrograde cholangiopancreatography as a treatment method and the management approaches for difficult stone cases. Improvements by guideline developers for these factors contributing to the heterogeneity would be a reasonable approach to further update the guidelines for cholangiolithiasis., Competing Interests: The authors declare no conflicts of interest., (Copyright © 2023 The Author(s). Published by Wolters Kluwer Health, Inc.)

Soil minor and trace elements are vital regulators of ecological processes that sustain alpine ecosystem functions. In this study, the vertical pattern and driving factors of element concentrations in alpine soils of the Tibetan Plateau were investigated. Three snow mountains (Meili, Baima, and Haba) part of the Hengduan Mountain range, were selected as the study area to determine the vertical distribution of 12 typical elements (Cr, Ni, Cu, Fe, Mn, Zn, Cd, Pb, Ca, Sr, As, and Se) in topsoil with increasing and decreasing elevation, as well as the dominant driving factors of their spatial heterogeneity. Results showed that all elements, except Se, showed strong vertical heterogeneity, among which Cr, Ni, Cu, and Fe showed peak concentrations at 2700-3000 m; the highest concentrations of Mn and Zn were at 3200 m and 2700 m, with Cd and Pb at 2500 m. Ca and Sr levels gradually decreased with increasing elevation. According to the structural equation model and random forest analysis, the vertical heterogeneity of soil elements is directly regulated by the variability of climate and soil properties due to changes in elevation. A three-way PERMANOVA further quantized the contributions of climate and soil properties on vertical heterogeneity of all soil elements, which were 35.2 % and 50.5 %, respectively. This study used various statistical tools to reveal the dominant factors affecting the vertical heterogeneity of soil elements. These findings provided a scientific overview of element distribution on the Tibetan Plateau and significant references for the vertical distribution of elements in the topsoil of other snow mountains worldwide., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

A range of studies have shown that prenatal maternal stress (PNMS) exposure is associated with offspring autistic-like behaviors, however the potential pathways remain unexplored. This study aimed to evaluate the mediating role of parent-child interactions in early life in the association between PNMS exposure and preschoolers' autistic-like behaviors. Data from 65,928 child-parent dyads were obtained via a primary caregiver-reported questionnaire administered as part of the Longhua Child Cohort Study. To strengthen confidence in the reliability of the results, the analyses were initially conducted on a random selection of 70% of the total sample, and then validated on the remaining 30% of the sample. Analysis of covariance and multiple linear models were employed to estimate the associations between PNMS exposure, parent-child interactions in early life, and children's autistic-like behaviors. The results showed that PNMS exposure was positively associated with the presence of autistic-like behaviors at preschool age. The total indirect effect of the frequency of positive parent-child interactions in early life accounted for 9.69% or 8.99% of the variance of the association. Our findings indicate that parent-child interactions in early life might function as potential mediators of the association between PNMS and the increased risk of offspring autistic-like behaviors.

Defects in migration and invasion caused by dysregulation of trophoblast epithelial-mesenchymal transformation (EMT) are one of the key factors in the pathogenesis of preeclampsia (PE). RNA-binding motif protein 25 (RBM25) is an RNA-binding protein involved in a variety of cellular processes, including cell proliferation, apoptosis, cell migration and invasion, and EMT. However, the expression and function of RBM25 in placental of PE remain unclear. In this study, we reveal that the expression of RBM25 is significantly elevated in PE placental tissue. RBM25 depletion and over-expression in trophoblast cells increase and decrease, respectively, cell migration and invasion by regulating EMT marker E-cadherin and Vimentin expression. Mechanistically, Grhl2 is involved in RBM25-regulated trophoblast cell migration, invasion, and EMT through RBM25-facilitated mRNA stabilization. Furthermore, the upregulation of Grhl2 enhances the expression of RBM25 through transcription and forms a positive feedback regulation in the progression of PE. These findings suggest that upregulation of RBM25 induces dysregulation of trophoblast EMT by enhancing positive feedback regulation of Grhl2 and RBM25, leading to defects in cell migration and invasion. Targeting this newly identified regulatory axis may provide benefits in the prevention and treatment of PE., Competing Interests: Declaration of conflicting interestsThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Electronic screens have become an integral part of modern life, accompanied with growing concerns for children's neuropsychological development. This study aimed to evaluate the associations between measures of early life screen exposure and hyperactive behaviors among preschool children. The study also aimed to investigate their cumulative effects and the critical window for these associations. A cross-sectional survey was conducted among 52 625 mother-child dyads at preschools in LongHua District of Shenzhen, China. A self-administered structured questionnaire was used to assess socio-demographic characteristics, duration of children's electronic screen exposure in each of the first 3 years following birth and the presence of current hyperactive behaviors. A series of logistic regression models were used to examine the relationship between previous screen time and current hyperactive behaviors. A crossover analysis was used to explore the critical window for a significant relationship between screen time and hyperactive behaviors. We found that exposure to electronic screens in the first 3 years of life was associated with hyperactive behaviors in preschool children. A cumulative effect was shown in children with an average daily screen time less than 60 min, with adjusted ORs increasing from 1.262 to 1.989 as screen exposure years increased from 1 to 3 years. A critical window was identified in that children in the first 2 years after birth were vulnerable to electronic screen exposure. Exposure to televisions, mobile phones, and computers were all related to elevated risks for hyperactive behaviors. In conclusion, early screen exposure appears to increase the risk for hyperactive behaviors in preschool children with the presence of a cumulative effect, a critical window and different electronic screens having similar effects.

The 16S rRNA gene has been extensively used as a molecular marker to explore evolutionary relationships and profile microbial composition throughout various environments. Despite its convenience and prevalence, limitations are inevitable. Variable copy numbers, intragenomic heterogeneity, and low taxonomic resolution have caused biases in estimating microbial diversity. Here, analysis of 24,248 complete prokaryotic genomes indicated that the 16S rRNA gene copy number ranged from 1 to 37 in bacteria and 1 to 5 in archaea, and intragenomic heterogeneity was observed in 60% of prokaryotic genomes, most of which were below 1%. The overestimation of microbial diversity caused by intragenomic variation and the underestimation introduced by interspecific conservation were calculated when using full-length or partial 16S rRNA genes. Results showed that, at the 100% threshold, microbial diversity could be overestimated by as much as 156.5% when using the full-length gene. The V4 to V5 region-based analyses introduced the lowest overestimation rate (4.4%) but exhibited slightly lower species resolution than other variable regions under the 97% threshold. For different variable regions, appropriate thresholds rather than the canonical value 97% were proposed for minimizing the risk of splitting a single genome into multiple clusters and lumping together different species into the same cluster. This study has not only updated the 16S rRNA gene copy number and intragenomic variation information for the currently available prokaryotic genomes, but also elucidated the biases in estimating prokaryotic diversity with quantitative data, providing references for choosing amplified regions and clustering thresholds in microbial community surveys. IMPORTANCE Microbial diversity is typically analyzed using marker gene-based methods, of which 16S rRNA gene sequencing is the most widely used approach. However, obtaining an accurate estimation of microbial diversity remains a challenge, due to the intragenomic variation and low taxonomic resolution of 16S rRNA genes. Comprehensive examination of the bias in estimating such prokaryotic diversity using 16S rRNA genes within ever-increasing prokaryotic genomes highlights the importance of the choice of sequencing regions and clustering thresholds based on the specific research objectives., Competing Interests: The authors declare no conflict of interest.

This study aims to identify biomarkers of intestinal repair and provide potential therapeutic clues for improving functional recovery and prognostic performance after intestinal inflammation or injury. Here, we conducted a large-scale screening of multiple transcriptomic and scRNA-seq datasets of patients with inflammatory bowel disease (IBD), and identified 10 marker genes that potentially contribute to intestinal barrier repairing: AQP8, SULT1A1, HSD17B2, PADI2, SLC26A2, SELENBP1, FAM162A, TNNC2, ACADS, and TST . Analysis of a published scRNA-seq dataset revealed that expression of these healing markers were specific to absorptive cell types in intestinal epithelium. Furthermore, we conducted a clinical study where 11 patients underwent ileum resection demonstrating that upregulation of post-operative AQP8 and SULT1A1 expression were associated with improved recovery of bowel functions after surgery-induced intestinal injury, making them confident biomarkers of intestinal healing as well as potential prognostic markers and therapeutic targets for patients with impaired intestinal barrier functions., Competing Interests: The authors declare no competing interests., (© 2023 The Author(s).)

Due to the unclear quality of the current guidelines, users may be confused about how to diagnose and treat achalasia. The objective of this work is to systematically evaluate the methodological quality of the current guidelines for diagnosing and treating achalasia and to determine the heterogeneity among recommendations. We systematically searched literature databases to retrieve relevant guidelines for the diagnosis and treatment of achalasia. The Appraisal of Guidelines for Research and Evaluation II tool was used to evaluate the quality of the included guidelines. Key recommendations in the guidelines were extracted, and the reasons for the heterogeneity of the key recommendations between different guidelines were further analyzed. Seven guidelines on the diagnosis and treatment of achalasia are included in this study. The overall score of three guidelines exceeded 60%. The average score in domain 5 was the lowest, at 41.8%. The average scores in domain 2, domain 3, and domain 6 were also low, at 45.4%, 57.1% and 56.9%, respectively. The main recommendations and quality of evidence for different guidelines vary greatly, mainly due to the different emphases among different guidelines, the lack of systematic retrieval, or the unfairness of evidence use in some guidelines. There are considerable differences in the methodological quality of diagnosis and treatment guidelines for achalasia. Additionally, the differences in the main recommendations and evidence support among guidelines are also obvious. Guideline developers should improve the above related factors to decrease the heterogeneity, and they should further formulate or update the guidelines for the diagnosis and treatment of achalasia., (© The Author(s) 2022. Published by Oxford University Press on behalf of International Society for Diseases of the Esophagus. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Objective: To evaluate the quality of surgical guidelines on bariatric/metabolic surgery., Methods: Four independent reviewers used the AGREE II (The Appraisal of Guidelines for Research and Evaluation II) tool to assess the methodological quality of the included guidelines and conducted a comparative analysis of the main recommendations for surgical methods of these guidelines., Results: Nine surgical guidelines were included in this study. Five articles with AGREE II scores over 60% are worthy of clinical recommendation. The field of rigor of development was relatively low, with an average score of 50.82%. Among 15 key recommendations and the corresponding best evidence in the guidelines, only 4 key recommendations were grade A recommendations., Conclusions: The quality of metabolic and bariatric guidelines is uneven, and there is much room for improvement., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Qin, Yang, Zheng, An, Yang, Du, Wang, Zhao, Li, Sun, Sun and Lin.)

The ability of the human liver to both synthesize extracellular matrix(ECM), as well as regulate fibrogenesis, are integral functions to maintaining homoeostasis. Chronic liver injury stimulates fibrogenesis in response to the imbalance between ECM accumulation and fibrosis resolution. Liver disease that induces fibrogenesis is associated with multiple risk factors like hepatitis infection, schistosomiasis, alcohol, certain drugs, toxicants and emerging aetiology like diabetes and obesity. The activation of hepatic stellate cells (HSCs), whose function is to generate and accumulate ECM, is a pivotal event in liver fibrosis. Simultaneously, HSCs selectively promote regulatory T-cells (Tregs) in an interleukin-2-dependent pattern that displays a dual relationship. On the one hand, Tregs can protect HSCs from NK cell attack, while on the other hand, they demonstrate an inhibitory effect on HSCs. This paper reviews the dual role of Tregs in liver fibrogenesis which includes its promotion of immunosuppression, as well as its activation of fibrosis. In particular, the balance between Tregs and the Th17 cell population, which produce interleukin (IL)-17 and IL-22, is explored to demonstrate their key role in maintaining homoeostasis and immunoregulation. The contradictory roles of Tregs in liver fibrosis in different immune microenvironments and molecular pathways need to be better understood if they are to be deployed to manage this disease., (© 2023. The Author(s).)

Soil respiration and extracellular enzyme activity are important components of the material cycle of mountain ecosystems and play key roles in maintaining ecosystem functions. To explore the coupling relationship between soil functions and environmental factors, the soil functional indicators, environmental factors, and effects of altitude on the soil function of 36 soil samples from 12 altitudes of the Meili Mountain were analyzed. The results showed that there were significant differences in soil respirations and enzyme activities among altitudes of Meili Mountain, and high-altitude areas had higher soil functions. Soil functions increased with altitudinal difference. PCA analysis showed that the first three axes explained 56.7%, 17.4%, and 8.7% of the variance in soil functional elevation change, respectively, indicating that the functional changes related to carbon and phosphorus were higher than those related to nitrogen. There were significant correlations between environmental factors and soil functional indicators; soil function indicators had stronger correlations with soil physicochemical properties than with climatic factors. Altitude mainly affected soil function indirectly by affecting soil physicochemical properties and climatic factors. These results have great scientific significance for improving the understanding of the material cycle and ecological function of the Meili Mountain ecosystem and provide an important reference for in-depth study of the altitude distribution pattern and evolution characteristics of the soil function of the mountain ecosystem.

Purpose: To understand the methodological quality of recent guidelines for laparoscopic surgery and endoscopic management for colon cancer and to analyze the heterogeneity and possible reasons for the main recommendations., Methods: A systematic and comprehensive search of databases and relevant websites was conducted to collect guidelines for laparoscopic surgery for colon cancer in the last 10 years that met the inclusion criteria. The AGREE II manual was used to evaluate the included guidelines and to assess and analyze the heterogeneity and reasons for key recommendations about the surgery., Results: A total of fifteen guidelines were included in this study. Only two guidelines had an overall score greater than 60% and were recommended for clinical use. Eleven guidelines had an overall score of 30-60%, and two guidelines had an overall score of less than 30%. Further analysis of the reasons for heterogeneity in the guideline recommendations and evidence was performed for nine guidelines. This study found that only 36.1% of the evidence levels recommended in the guidelines were high. Significant heterogeneity exists in the main recommendations, mainly because the relevant content is not mentioned or described in detail., Conclusion: The quality of guidelines for laparoscopic colon cancer surgery is variable, and there is significant heterogeneity among key recommendations. And the level of evidence underlying the recommendations was generally not high. Further guideline updates should address the causes of the above heterogeneity., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Background: To systematically evaluate the quality of the guidelines for the diagnosis and treatment of Helicobacter pylori infection and to analyze the differences and reasons for the key recommendations in the guidelines., Methods: Databases and websites were systematically searched to obtain guidelines for the diagnosis and treatment of Helicobacter pylori infection. Four independent reviewers used the Guideline Evaluation Tool (AGREE II) to evaluate the included guidelines. The intraclass correlation coefficient (ICC) and Fleiss' kappa coefficient were used to measure the consistency of evaluation guidelines between guide reviewers. Differences between guidelines and the reasons for the differences were analyzed by comparing the recommendations of different guidelines and the evidence supporting the recommendations., Results: A total of 17 guidelines for Helicobacter pylori infection were included in this study. The AGREE II scores of these guidelines were low overall, with 4 of them had a score of over 60%, which indicates that the guidelines are recommended, and 13 of them having a score ranging from 30 to 60%, which indicates that the guidelines are recommended but need to be revised, while no guideline had a score of 30% or less, which indicates that they were not recommended. The analysis of these guidelines found that there were some differences in the main recommendations. Not all guidelines recommend sequential therapy as the recommended therapy. Whether bismuth quadruple therapy should be used as the recommended first-line therapy is unclear. The antibiotic resistance rate is different in different regions. Combined with the local antibiotic sensitivity test, the eradication rate of Helicobacter pylori can be improved., Conclusion: There are significant differences in the quality of Helicobacter pylori infection guidelines and the key recommendations. Improving the deficiencies of existing guidelines is an effective way to develop high-quality guidelines and make reasonable recommendations for the treatment of Helicobacter pylori infection in the future., (© 2022 John Wiley & Sons Ltd.)

Background: The inflammatory response induced by intestinal ischaemia‒reperfusion injury (I/R) is closely associated with infectious complications and mortality in critically ill patients, and the timely and effective clearance of apoptotic cells is an important part of reducing the inflammatory response. Studies have shown that the efferocytosis by phagocytes plays an important role. Recently, studies using small intestine organoid models showed that macrophage efferocytosis could promote the repair capacity of the intestinal epithelium. However, no studies have reported efferocytosis in the repair of I/R in animal models., Results: We used an in vivo efferocytosis assay and discovered that macrophage efferocytosis played an indispensable role in repairing and maintaining intestinal barrier function after I/R. In addition, the specific molecular mechanism that induced macrophage efferocytosis was Cth-ERK1/2 dependent. We found that Cth drove macrophage efferocytosis in vivo and in vitro. Overexpression/silencing Cth promoted/inhibited the ERK1/2 pathway, respectively, which in turn affected efferocytosis and mediated intestinal barrier recovery. In addition, we found that the levels of Cth and macrophage efferocytosis were positively correlated with the recovery of intestinal function in clinical patients., Conclusion: Cth can activate the ERK1/2 signalling pathway, induce macrophage efferocytosis, and thus promote intestinal barrier repair. Video Abstract., (© 2023. The Author(s).)

Objective: To systematically evaluate the guidelines for the diagnosis and treatment of radioactive enteritis, compare their differences and reasons and provide some reference for updating them., Methods: This study used guidelines related to radiation enteritis by searching a database. Four independent reviewers used the AGREE II evaluation tool to evaluate the quality of the included guidelines, collate their main recommendations, and analyze the highest evidence supporting the main recommendations., Results: Six diagnostic and therapeutic guidelines for radiation enteritis were included in this study, one of which, the American Society for Gastrointestinal Endoscopy guidelines, had an overall score of over 60%, which is worthy of clinical recommendation. In the diagnosis and treatment of radioactive rectal injury, the recommendations for hemorrhagic endoscopic treatment are mature and mainly include (I) argon plasma coagulation; (II) formalin treatment; (III) bipolar electrocoagulation; (IV) heater probe; (V) radiofrequency ablation; and (VI) cryoablation., Conclusion: The methodological quality of radioactive enteritis guidelines is unequal; even in the same guidelines, different domains have a large difference. For radioactive rectal damage diagnosis, a type of endoscopic treatment recommendation is more mature, but the overall diagnosis and treatment of radioactive enteritis still lacks high-quality research evidence., (© 2023. The Author(s).)

With the improvement of laparoscopic surgery, the feasibility and safety of laparoscopic hepatectomy have been affirmed, but intraoperative hepatic venous system hemorrhage and carbon dioxide gas embolism are the difficulties in laparoscopic hepatectomy. The incidence of preoperative hemorrhage and carbon dioxide gas embolism could be reduced through preoperative imaging evaluation, reasonable liver blood flow blocking method, appropriate liver-breaking device, controlled low-center venous pressure technology, and fine-precision precision operation. In the case of blood vessel rupture bleeding in the liver vein system, after controlling and reducing bleeding, confirm the type and severity of vascular damage in the liver and venous system, take appropriate measures to stop the bleeding quickly and effectively, and, if necessary, transfer the abdominal treatment in time. In addition, to strengthen the understanding, prevention and emergency treatment of severe CO2 gas embolism in laparoscopic hepatectomy is also the key to the success of surgery. This study aims to investigate the methods to deal with hepatic venous system hemorrhage and carbon dioxide gas embolization based on author's institutional experience and relevant literature. We retrospectively analyzed the data of 60 patients who received laparoscopic anatomical hepatectomy of hepatic vein approach for HCC. For patients with intraoperative complications, corresponding treatments were given to cope with different complications. After the operation, combined with clinical experience and literature, we summarized and discussed the good treatment methods in the face of such situations so that minimize the harm to patients as much as possible., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Qu, Wu, Feng, Shi, Chen, Sun, Duan, Chen and He.)

Introduction: Serum vitamin D 3 concentration is associated with the risk of insulin resistance. Zinc has also been reported to be associated with a lower risk of insulin resistance. In addition, zinc is an essential cofactor in the activation of vitamin D 3 . However, the effect of dietary zinc intake on the relationship between vitamin D 3 and insulin resistance risk has not been fully studied. Therefore, we designed this cross-sectional study to assess the impact of changes in zinc intake on the relationship between vitamin D 3 and insulin resistance risk., Study Design and Methods: This study analyzed data from the national Health and Nutrition Examination Survey (NHANES) from 2005 to 2018, involving 9,545 participants. Participants were stratified by zinc intake category (low zinc intake <9.58 mg/ day; High zinc intake: ≥9.58 mg/ day)., Results: In this cross-sectional study, serum vitamin D 3 levels were independently associated with the risk of insulin resistance in both the low and high Zinc intakes (β: -0.26, 95%Cl: -0.56~0.04 vs. β: -0.56, 95%Cl: -1.01~-0.11). In addition, this association was influenced by different dietary zinc intakes (interaction P < 0.05)., Conclusions: Our results suggest that zinc intake may influence the association between serum vitamin D 3 and the risk of insulin resistance. Further randomized controlled trials are needed to provide more evidence of this finding., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Hu, Lin, Cai, Sun, Yang, Guo, Zhang and Sun.)

There is growing evidence that cooking oil fumes (COFs) are harmful indoor air pollutants. However, there is a dearth of research investigating whether maternal COFs exposure during pregnancy may affect children's autistic-like behaviors in China. This study aimed to explore this association, and examine the effects of different cooking fuels and ventilation methods used by mothers on the presence of autistic-like behaviors. This study analyzed the survey data of the Longhua Child Cohort Study in 2017 with a total of 62,372 mothers enrolled in this study. A self-administrative questionnaire was used to collect information on socio-demographic characteristics, cooking habits during pregnancy, and autistic-like behaviors (measured using the Autism Behavior Checklist). After adjusting for potential confounders, the results showed that compared with children whose mothers never cooked during pregnancy, children whose mothers cooked sometimes, often, always during pregnancy had the higher risk of autistic-like behaviors. As the amounts of COFs exposed to and the frequency of cooking during pregnancy increased, the risk of a child's autistic-like behaviors also increased. Mothers using natural gas as cooking fuels had a lower risk of their child having autistic-like behaviors, compared with mothers using coal or other cooking fuels. Furthermore, pregnant women using ventilation measures during cooking significantly decreased likelihood of the presence of autistic-like behaviors in their children. These results suggest that maternal exposure to COFs during pregnancy may increase the likelihood of the presence of autistic-like behaviors in offspring. These findings support a recommendation that pregnant women should avoid exposure to COFs and use clean fuels and ventilation equipment in kitchens to reduce the risk of autistic-like behaviors in children., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Although environmental tobacco smoke (ETS) exposure is considered to be a severe public health problem and a modifiable risk factor for preterm birth (PTB), we still lack a comprehensive understanding of the PTB risk associated with trimester-specific prenatal ETS exposure. This study aimed to examine the accumulation of risk across trimester ETS exposure and the critical window of the association between maternal ETS exposure during pregnancy and PTB. A total of 63,038 mother-child pairs were involved in the analysis of the 2017 survey of Longhua Child Cohort Study. Information about socio-demographic characteristics, prenatal ETS exposure, and birth outcomes were collected using a self-report questionnaire. A series of logistic regression models were employed to assess the associations between prenatal ETS exposure and PTB. We found that maternal ETS exposure during pregnancy significantly increased the risk of PTB and this association increased with both the average level of daily ETS exposure and the number of trimesters of ETS exposure. Moreover, mothers who were initially exposed to ETS in the 1st trimester of pregnancy had significant higher risk of PTB (OR = 1.34, 95% CI: 1.25-1.44). Furthermore, mothers exposed to ETS in the 1st trimester only (OR = 1.26, 95%CI: 1.04-1.50), in both 1st and 2nd trimester (OR = 1.35, 95%CI: 1.08-1.67) and throughout pregnancy (OR = 1.35, 95%CI: 1.24-1.46) experienced a significantly high risk of PTB. Prenatal maternal ETS exposure during only the 2nd trimester also resulted in a high risk of PTB with marginal significance (OR = 1.33, 95% CI:0.78-2.13). To conclude, the 1st and early 2nd trimester might be the critical window for prenatal ETS exposure causing PTB., (Copyright © 2022 Elsevier Inc. All rights reserved.)

Background: Some guidelines for management of Hirschsprung's disease (HSCR, HD) have been developed, but their quality is vague. This study will systematically assess the quality of guidelines and analyze the key recommendations and the best evidence for guidelines., Methods: Applicable guidelines were retrieved using a systematic search of databases. The Appraisal of Guidelines for Research and Evaluation II (AGREE II) tool was used to assess the quality of the guidelines. Then, the recommendations and evidence for the included guidelines were extracted and compared., Results: A total of nine guidelines were included in this study, and only one had an overall standardized score of more than 60%, indicating that it is worthy of recommendation. The problems identified included ambiguous and low-quality evidence; obvious distributional heterogeneity among the recommendations; a lack of in-depth discussion on the interpretation of staging, diagnostic methods, conservative treatment, and surgical staging of disease., Conclusion: The quality of guidelines varies widely, and there is a lack of high-quality professional opinions and supporting evidence for the main recommendations. At present, only comprehensive guidelines can be considered high-quality and there is still room for improvement., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Objective: To systematically assess the current related methodological quality of guidelines for the diagnosis and treatment of Clostridioides difficile infection (CDI), revealing the heterogeneity and reasons for guideline recommendations for the diagnosis and treatment of CDI., Methods: We searched electronic databases systematically between 2017 and 2021 to find the latest guidelines for the diagnosis and treatment of CDI. The Appraisal of Guidelines for Research and Evaluation (AGREE II) tool was used for quality assessment of the included guidelines. The main recommendations for the diagnosis and treatment of CDI in the guidelines were extracted and evaluated for consistency, and the level of evidence supporting these recommendations was further extracted and analysed., Results: Fourteen guidelines for the diagnosis and treatment of CDI were finally included in this study. There were four guidelines, BSG and HIS, ASCRS, IDSA AND SHEA, and NICE, with an overall score of more than 60%, which is worthy of clinical recommendation. Further analysis of the consistency of the main recommendations for the diagnosis and treatment of CDI in the guidelines showed that the recommendations differed among guidelines. There are no unified classification criteria for the severity of CDI in current studies; some recommendations for the diagnosis and treatment of CDI do not provide evidence to support the recommendations, most recommendations cite low levels of evidence, and there is a lack of high-quality research evidence., Conclusion: The quality of guidelines for the diagnosis and treatment of CDI is uneven. Recommendations on the diagnosis and treatment of CDI have also varied in the guidelines for the past 5 years. Improvements of the aforementioned factors associated with causing heterogeneity would be a rational approach by guideline developers to further update guidelines for the diagnosis and treatment of CDI., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Gu, Li, Yang, Yang, He, He and Sun.)

Introduction: Dietary vitamin A concentrations correlate with depression. Zinc has been reported to be associated with lower depression. In addition, zinc is an important cofactor in the activation of vitamin A. However, there are few studies investigating relationships between of dietary zinc intake, dietary vitamin A intake and depression., Materials and Methods: The data for this study came from the National Health and Nutrition Examination Survey (NHANES) from 2005 to 2018 and involved 70,190 participants. We stratified participants by recommended dietary zinc intake (recommended dietary zinc intake for women: 8 mg/day, recommended dietary zinc intake for men: 11 mg/day). We further assessed the association between vitamin A and depression in participants with low and high zinc intake (interaction test) using univariate logistic regression of intake participants., Result: In the female population we grouped the population into low and high zinc intake groups using the recommended dietary zinc intake of 8 (mg/day), with an increase in total vitamin A, the risk of depression was significantly lower in the low zinc intake group (OR: 0.85 95 CI: 0.76-0.96), while the risk of depression was increased in the high zinc intake group (OR: 1.05 95 CI: 0.95 to 1.17). Thus, in the female population, there was a significant interaction between insufficient vitamin an intake and depression (interaction likelihood ratio test of p = 0.011). In the male population we grouped the population by the recommended dietary zinc intake of 11(mg/day). Again, the population was divided into two groups with low and high zinc intake, however we did not find significant results for the interaction ( p = 0.743 for the interaction likelihood ratio test)., Conclusion: Our findings suggest that zinc intake may influence the relationship between dietary vitamin A and depression. Of course, our findings require further randomized controlled trials to enhance the credibility., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Hu, Lin, Zou, Gan, Ji, Guo, Li, Guo, Xu, Sun and Yi.)

Background: The prediction of hepatocellular carcinoma (HCC) survival is challenging because of its rapid progression. In recent years, necroptosis was found to be involved in the progression of multiple cancer types. However, the role of necroptosis in HCC remains unclear., Methods: Clinicopathological parameters and transcriptomic data of 370 HCC patients were obtained from TCGA-LIHC dataset. Prognosis-related necroptosis genes (PRNGs) were identified and utilized to construct a LASSO risk model. The GEO cohorts (GSE54236 and GSE14520) were used for external validation. We evaluated the distribution of HCC patients, the difference in prognosis, and the accuracy of the prognostic prediction of the LASSO risk model. The immune microenvironment and functional enrichment of different risk groups were further clarified. Finally, we performed a drug sensitivity analysis on the PRNGs that constructed the LASSO model and verified their mRNA expression levels in vitro. Results: A total of 48 differentially expressed genes were identified, 23 of which were PRNGs. We constructed the LASSO risk model using nine genes: SQSTM1 , FLT3 , HAT1 , PLK1 , MYCN , KLF9 , HSP90AA1 , TARDBP , and TNFRSF21 . The outcomes of low-risk patients were considerably better than those of high-risk patients in both the training and validation cohorts. In addition, stronger bile acid metabolism, xenobiotic metabolism, and more active immune cells and immune functions were observed in low-risk patients, and high expressions of TARDBP , PLK1 , and FLT3 were associated with greater drug sensitivity. With the exception of FLT3 , the mRNA expression of the other eight genes was verified in Huh7 and 97H cells . Conclusions . The PRNG signature provides a novel and effective method for predicting the outcome of HCC as well as potential targets for further research., Competing Interests: There are no potential conflicts of interest for the authors to disclose., (Copyright © 2022 Xin Gao et al.)

Background: While the relationship between blood pressure and blood lead has been studied more extensively, the effect of high-density lipoprotein (HDL) concentration on this relationship remains uncertain. Therefore, this study aimed to determine the effect of HDL concentration on the relationship between blood lead and blood pressure., Methods: The research used cross-sectional data from the 2005 to 2014 National Health and Nutrition Examination Survey (NHANES), which included 16,451 participants aged 20-60 years. Multivariable linear regression was used to evaluate the correlation among blood lead, systolic blood pressure (SBP), and diastolic blood pressure (DBP). HDL concentration was determined by low HDL concentration (≤ 49 mg/dl) and high HDL concentration (>49 mg/dl) stratified. The effect of HDL concentration was assessed by an interaction test between blood lead and SBP in multivariable linear regression., Results: In this cross-sectional research, we identified a positive correlation between blood lead and SBP, but not DBP. The relationship between blood lead and SBP was different in the group with low and high HDL concentrations (β: 0.21 95% Cl:-0.05-0.46 vs. β:0.47 95% Cl: 0.15-0.79). In addition, high HDL significantly altered the positive correlation between blood lead and SBP ( P -value of interaction < 0.001)., Conclusion: The study suggests an interaction between HDL and blood lead in elevating SBP, which may have important clinical implications., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Hu, He, Zhong, Gao, Guo, Feng, Huang, Yang and Sun.)

Background: Recent studies have emphasized the emerging importance of long noncoding RNAs (lncRNAs) in colorectal cancer (CRC). However, the functions and regulatory mechanisms of numerous lncRNAs in CRC have not been fully elucidated., Aim: To explore the functional role and underlying molecular mechanisms of lncRNA TNFRSF10A-AS1 in CRC., Methods: TNFRSF10A-AS1 expression was measured by quantitative real-time polymerase chain reaction in CRC, and the relationship between TNFRSF10A-AS1 levels and the clinicopathological features of CRC patients was analyzed. The effect of TNFRSF10A-AS1 expression on CRC proliferation and metastasis was examined in vitro and in vivo . Mechanistically, we investigated how TNFRSF10A-AS1 is involved in CRC as a competitive endogenous RNA., Results: TNFRSF10A-AS1 was expressed at a high level in CRC and the upregulation of TNFRSF10A-AS1 was associated with advanced T grade and tumor size in CRC patients. A functional investigation revealed that TNFRSF10A-AS1 enhanced the proliferation, migration ability and invasion ability of colon cancer cells in vitro and in vivo . A mechanistic analysis demonstrated that TNFRSF10A-AS1 acted as a miR-3121-3p molecular sponge to regulate HuR expression, ultimately promoting colorectal tumorigenesis and progression., Conclusion: TNFRSF10A-AS1 exerts a tumor-promoting function through the miR-3121-3p/HuR axis in CRC, indicating that it may be a novel target for CRC therapy., Competing Interests: Conflict-of-interest statement: There are no conflicts of interest to report., (©The Author(s) 2022. Published by Baishideng Publishing Group Inc. All rights reserved.)

In this study, we aimed to evaluate phthalate metabolite levels in pregnant women, to explore the factors influencing exposure, and to assess phthalate metabolite levels in relation to thyroid hormone synthesis. We recruited 463 pregnant women and collected urine, blood, and questionnaire data at participant's first prenatal examination. Ten phthalate metabolites were analyzed: mono-isobutyl phthalate (MiBP); mono-methyl phthalate (MMP); mono-ethyl phthalate (MEP); mono-n-butyl phthalate (MnBP); mono-n-octyl phthalate (MOP); mono-benzyl phthalate (MBzP); and the metabolite of di-2-ethylhexyl phthalate (DEHP), which were mono (2-ethylhexyl) phthalate, mono-(2-ethyl-5-oxohexyl) phthalate, and mono-(2-ethyl-5-carboxypentyl) phthalate. Multivariable generalized estimating equation models and linear mixed models were used to predict urinary biomarker concentrations and to assess the associations between phthalate exposure and thyroid hormones. Positive associations were found between phthalate metabolites and lower education (MEP and MOP), living near the road (MEP, MnBP, and ∑DEHP), and consuming more puffed food (MEP and MBzP). In addition, MnBP (percent change [%△] = 4.25; 95% confidence interval [CI] = 0.32, 8.18) and ∑DEHP (%△ = 5.12; 95% CI = 1.25, 8.99) were positively associated with thyroid-stimulating hormones, although MEP and MnBP were inversely associated with free thyroxine and total triiodothyronine. Our findings suggest that certain habits and behaviors were predictive of the positive presence of phthalate metabolites and that certain phthalate esters are associated with altered thyroid hormone levels., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Introduction: US college students smoke hookah and vape nicotine at higher rates than other young adults. Density and/or proximity of hookah lounges and vape shops near colleges has been described, but this study is the first to test whether tobacco retailers spatially cluster near college campuses., Aims and Methods: We created and linked spatial shapefiles for community colleges and 4-year colleges in California with lists of hookah lounges, vape shops, and licensed tobacco retailers. We simulated 100 datasets, placing hookah lounges, vape shops, and tobacco retailers randomly in census tracts in proportion to population density. A modified version of Ripley's K-function was computed using the radius (r) from each retailer within retail category., Results: In 2018-2019, 50.5% of hookah lounges (n = 479), 42.5% of vape shops (n = 2467), and 42.0% of all tobacco retailers (n = 31 100) were located within 3 miles of a community college. Spatial clustering was significant (p < .05) from at least 0.4 miles for hookah lounges, 0.1 mile for vape shops, and 0.3 miles for all tobacco retailers. For 4-year colleges, approximately 46.8% of hookah lounges, 31.3% of vape shops, and 31.6% of all tobacco retailers were located within 3 miles. Clustering was significant from 0.2 miles for hookah lounges and 1.3 miles for all tobacco retailers but was not significant for vape shops., Conclusions: Evidence that some types of tobacco retailers cluster near community colleges and 4-year colleges implies greater accessibility and exposure to advertising for students. It is also concerning because a higher probability of underage tobacco sales presumably exists near colleges., Implications: Prior studies infer that hookah lounges and vape shops cluster near colleges from the density and closer proximity to campuses. This study modified a traditional test of spatial clustering and considered community colleges separately from 4-year universities. Spatial clustering of hookah lounges and all licensed tobacco retailers was evident near both types of campuses, but vape shops clustered only near community colleges. Place-based strategies to limit tobacco retail density could expand state and local laws that prohibit tobacco sales near schools to include retailers near college campuses. In addition, college environments should be a target for reducing hookah smoking and nicotine vaping., (© The Author(s) 2022. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Objective To explore the potential targets of triclosan in the treatment of nonalcoholic fatty liver disease(NAFLD) and to provide new clues for the future research on the application of triclosan. Methods The targets of triclosan and NAFLD were obtained via network pharmacology.The protein-protein interaction network was constructed with the common targets shared by triclosan and NAFLD.The affinity of triclosan to targets was verified through molecular docking.Gene ontology(GO) annotation and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment were carried out to analyze the key targets and the potential mechanism of action.NAFLD model was established by feeding male C57BL/6J mice with high-fat diet for 12 weeks.The mice were randomly assigned into a model group and a triclosan group [400 mg/(kg·d),gavage once a day for 8 weeks].The hematoxylin-eosin(HE) staining was used for observation of the pathological changes and oil red O staining for observation of fat deposition in mouse liver.Western blotting was employed to detect the protein level of peroxisome proliferator-activated receptor alpha(PPARα) in the liver tissue. Results Triclosan and NAFLD had 34 common targets,19 of which may be the potential targets for the treatment,including albumin(ALB),PPARα,mitogen-activated protein kinase 8(MAPK8),and fatty acid synthase.Molecular docking predicted that ALB,PPARα,and MAPK8 had good binding ability to triclosan.KEGG pathway enrichment showcased that the targets were mainly enriched in peroxisome proliferator-activated receptor signaling pathway,in which ALB and MAPK8 were not involved.Triclosan alleviated the balloon-like change and lipid droplet vacuole,decreased the lipid droplet area,and up-regulated the expression level of PPARα in mouse liver tissue. Conclusion PPARα is a key target of triclosan in the treatment of NAFLD,which may be involved in fatty acid oxidation through the peroxisome proliferator activated receptor signaling pathway.

Background: Colitis-associated colorectal cancer (CAC) is a serious complication of inflammatory bowel disease (IBD). microRNA-320 (miRNA-320) promotes intestinal mucosal barrier repair in IBD and inhibits tumor progression. However, the role of miRNA-320 in the progression of CAC remains to be defined. We studied the mechanisms of miRNA-320 in the progression of CAC in mice., Methods: CAC was induced in mice (C57BL/B6) by the administration of azoxymethane (AOM) and dextran sulfate sodium (DSS), and the mice were given a lentiviral vector (LV) overexpressing mmu-miRNA-320. The level of miRNA-320 was analyzed by quantitative real-time polymerase chain reaction (qPCR). Colonic inflammation, histological analysis, and tumorigenesis were evaluated. Ki-67 in colonic tissues was examined by immunohistochemistry. B-cell lymphoma-extra large (BCL-xl) and proliferating cell nuclear antigen (PCNA) expression was examined by Western blot. Furthermore, the proliferation, migration, and invasion of colorectal cancer (CRC) cells were evaluated. The levels of interleukin-6 receptor (IL-6R), signal transducer and activator of transcription 3 (STAT3), and phosphorylated-signal transducer and activator of transcription 3 (p-STAT3) were examined by Western blot and qPCR., Results: miRNA-320 was downregulated in CAC mice (0.57±0.13 vs. 1.00±0.12, t =-5.95, P<0.001). miRNA-320 decreased the disease activity index (DAI) scores, improved colonic inflammation, and inhibited tumor formation (tumor number: 8.00±2.90 vs. 13.67±2.73, t =-3.49, P<0.01) in mice with CAC. miRNA-320 suppressed the expression of BCL-xl, PCNA, and Ki-67 (0.38±0.07 vs. 0.69±0.08, t =-7.30, P<0.001). miRNA-320 inhibited colon cancer cell proliferation, migration, and invasion. miRNA-320 significantly inhibited the levels of IL-6R [colon tissue messenger RNA (mRNA): 4.06±1.44 vs. 10.05±1.55, t =-6.94, P<0.001], STAT3, and p-STAT3 in vivo and in vitro . Silencing IL-6R expression partially reversed the IL-6R/STAT3-suppressing and tumor-inhibiting effect of miRNA-320., Conclusions: miRNA-320 inhibits tumorigenesis in mice with CAC by suppressing IL-6R/STAT3 expression, and IL-6R is a target gene of miRNA-320., Competing Interests: Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-237/coif). The authors have no conflicts of interest to declare., (2022 Journal of Gastrointestinal Oncology. All rights reserved.)

Indoor air pollution is a recognized risk factor for a range of negative health outcomes. This study aimed to investigate the association between maternal prenatal exposure to indoor air pollution and the presence of autistic-like behaviors among preschool children. Data were obtained from the Longhua Child Cohort Study in 2017, in which we enrolled a total of 65 317 preschool children. Associations between maternal exposure to four sources of indoor air pollution (e.g., cooking, environmental tobacco smoke (ETS), mosquito coils, and home decoration) during pregnancy and preschool children's autistic traits were analyzed using multivariate logistic regression. Our results showed that maternal exposure to indoor air pollution from four different sources during pregnancy was associated with the presence of children's autistic-like behaviors. There was dose-response relationship between the accumulative exposure to the four different indoor air pollution sources and the risk of autistic-like behaviors. Furthermore, we found a significant additive interaction between prenatal exposure to both cooking and mosquito coil incense on the risk of autistic-like behaviors. Maternal prenatal exposure to the indoor air pollution from four sources might increase with the risk of autistic-like behaviors being present among preschool children, with an additive interaction effect between some pollution sources., (© 2021 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Objective: Few studies have evaluated the association between children's exposure to environmental tobacco smoke (ETS) in early life (during pregnancy, from birth to one year and from one to three years) and autistic-like behaviors. This study aimed to explore this association., Methods: This cross-sectional study analyzed data collected in 2017 as part of the Longhua Child Cohort Study. Autistic-like behaviors were measured using the Autism Behavior Checklist (ABC). Data on ETS exposure and autistic-like behaviors of children were collected via self-administered questionnaires completed by the mothers. Multivariate logistic regression models were undertaken to assess the associations., Results: Of the 65,243 participants included in this study, 1958 children met criteria for having autistic-like behaviors. The results showed that children were more likely to exhibit autistic-like behaviors when they were exposed to ETS in early life (AOR = 1.38; 95% CI = 1.26-1.52), compared to preschoolers without ETS exposure at any period of their early life. Compared with their unexposed counterparts, children who were exposed to ETS during gestation (AOR = 1.42; 95% CI = 1.29-1.57), or from birth to one year old (AOR = 1.42; 95% CI = 1.19-1.69) had significantly increased risk of autistic-like behaviors. In addition, with the increase in duration of exposure and average number of cigarettes smoked in the child's immediate environment, the risk of autistic-like behaviors increased., Conclusion: Our study indicated that children's ETS exposure in early life was significantly associated with autistic-like behaviors. When children's exposure to cigarettes in early life increased in duration and number, the likelihood of the presence of autistic-like behaviors was higher., (Copyright © 2021 Elsevier Inc. All rights reserved.)

Objective: To collect and evaluate the diagnostic approach of inflammatory bowel disease (IBD) guidelines and provide useful feedback for guideline developers and evidence-based clinical information to help physicians make decisions., Methods: Diagnostic guidelines for IBD were retrieved by performing systemic and manual searches. Qualified clinical practice guidelines (CPGs) were included and then evaluated by four well-trained evaluators using the AGREE II instrument. To reduce the bias generated in this process, we used the Measurement Scale of Rate of Agreement (MSRA) tool to interpret the results. Guidelines with good recommendation distributions among the diagnostic field were further reclassified and evaluated., Results: Fifteen diagnostic CPGs for IBD were identified and evaluated, and 70.3% (11/15) of the CPGs were above the recommended level. We observed heterogeneity among the diagnostic CPGs for IBD and discrepancies among different domains in one specific guideline. Potential improvements were identified in the fields of stakeholder involvement, rigour of development and applicability. By further analysing the heterogeneity of the recommendations and evidence in 5 UC-CPGs, we found the following issues: no discussion of diagnosing severe complications of UC, disputed significance of serologic and genetic diagnoses of UC, insufficient attention towards medical histories/physical examinations/differential diagnoses and discrepancy in classification criteria., Conclusion: The included diagnostic CPGs for IBD were generally of good quality, but heterogeneity was identified. Addressing these issues will provide useful feedback for the guideline updating process, and it will also benefit current clinical practice and eventually patient outcome., (© 2021 John Wiley & Sons Ltd.)

Along with the economic and technological development and growing demand for high-quality drinking water, direct drinking water has gained general popularity in China. However, no authoritative policy has been issued, giving a clear definition of direct drinking water and existing standards and regulations concerning direct drinking water are not definitive in nature. Existing water quality parameters are not well supported and sometimes even contradict each other. We elaborated, in this paper, the history of direct drinking water in China and systematically reviewed the existing regulations and standards related to direct drinking water. We also compared and analyzed the important microbiology, toxicology, sensory perception and general chemistry parameters in the standards. This paper is the first ever attempt at an in-depth analysis of the chaotic state of the direct drinking water industry. We have also highlighted the problems in the current standards and regulations for direct drinking water. Our study provides a basis for market regulation and the supervision and management of direct drinking water. In addition, the paper provides helpful information for laying down a definition of direct drinking water, calling for and approving of project proposals concerning the establishment of national standards for direct drinking water, and actually formulating the standards. We have made a number of suggestions: A. defining direct drinking water clearly and formulating the national standards for direct drinking water as soon as possible; B. conducting research on water quality benchmarks to provide scientific support for the formulation of the national standards for direct drinking water; C. giving more attention to the formulation of standards concerning microbiology parameters and their limits and giving consideration to the inclusion of parameters concerning viruses., (Copyright© by Editorial Board of Journal of Sichuan University (Medical Sciences).)