Search

Cardiac amyloidosis is indeed a condition characterized by the deposition of amyloid proteins in the myocardium, leading to thickening and stiffening of the heart muscle. These abnormal protein deposits can interfere with the heart's normal functioning and may pose diagnostic challenges due to its varied clinical presentation and resemblance to other heart condition. Here, we present a case of 55-year-old female patient of uncontrolled hypertensions for 15 years. About 15 years ago, she presented with chest pain and was diagnosed with cardiomyopathy (CM) characterized by low left ventricle (LV) function of unknown cause. Despite being on antihypertensive treatment, the patient continued to experience chest heaviness with persistent elevate blood pressure. An echocardiogram revealed increased LV septal wall thickness, valvular thickening, and biatrial dilation. Subsequently, cardiac magnetic resonance imaging (CMR) was performed, which revealed left atrium enlargement and asymmetrical myocardial wall thickening, particularly at the septum. White blood axial image revealed thickened inter atrial septum, while late gadolinium enhancement (LGE) magnetic resonance (LGE MR) images showed patchy LGE at the base relative to the apex of the myocardium, highlighting the base-to-apex gradient, subendocardial pattern enhancement at apical lateral wall, and transmural pattern enhancement of the mid anteroseptal and inferoseptal wall. Additionally, a short axis time to invert T1 scout image of left ventricle displayed an abnormal nulling pattern initially in the myocardium, followed by the blood pool, and finally the spleen. These findings collectively led to the diagnosis of cardiac amyloidosis.

The widespread use of imidacloprid (IMI) in pest control presents significant environmental challenges due to its persistence and low removal efficiency. This study introduces magnetic Covalent Organic Frameworks (COFs) functionalized with Fe₃O₄ nanoparticles (Fe₃O₄@HMN-COF, Fe₃O₄@MAN-COF, and Fe₃O₄@SIN-COF) as efficient adsorbents for IMI removal from water. These COFs, engineered with nitrogen-rich structures and extensive π-electron systems, achieve superior adsorption through π-π interactions, hydrophobic interactions, and hydrogen bonding. Characterization via FT-IR, XRD, and nitrogen sorption isotherms confirmed their high hydrophilicity, stability, and large surface areas. The magnetic properties of the COFs facilitated easy separation from water, enhancing practicality. Kinetic studies for all COFs indicated a pseudo-second-order model, suggesting chemisorption, with adsorption capacities of 600 mg/g for Fe₃O₄@HMN-COF, 480 mg/g for Fe₃O₄@MAN-COF, and 375 mg/g for Fe₃O₄@SIN-COF. Thermodynamic analyses revealed spontaneous and endothermic adsorption processes. Reusability tests showed minimal capacity loss over multiple cycles, underscoring their practical applicability. Practical tests in honey and fruit samples confirmed high efficacy, demonstrating the COFs' versatility. The study also optimized the photocatalytic degradation of imidacloprid using these COFs, with Fe₃O₄@HMN-COF achieving 98.5 % efficiency under optimal conditions (10 mg L−1 IMI, 0.01 g catalyst dose, pH 11, 30 °C, UV light). These findings highlight the potential of magnetic COFs for sustainable environmental remediation of pesticide-contaminated water.

ABSTRACT: Aflatoxin B1 (AFB1) is a significant pollutant found in food and feed, posing a threat to public health. The objective of this study was to assess the effect of Lactiplantibacillus plantarum (LACP) against AFB1 in growing rabbits by investigating growth, serum metabolites, immunity, antioxidant capacity, and inflammatory response. A total of 60 growing male rabbits (721.5 ± 2.68g) were allocated to 4 experimental groups. The control group receiving only a basal diet, the AFB1 group (0.3 mg AFB1/kg diet), the LACP group (1 × 109 cfu/g /kg diet), and the combination group (1 × 109 cfu/g + 0.3 mg AFB1/kg diet; AFB1+ LACP) for 8 wk. The administration of AFB1 alone significantly decreased the final body weight, body gain, and feed intake, while significantly increasing the feed conversion ratio (P < 0.05). A significant decline in total proteins and globulins, along with elevated levels of hepatic enzymes (AST, ALP, ALT, and GGT) and renal function markers (creatinine and uric acid), were observed in the AFB1-contaminated group (P < 0.05). Immunoglobulins (IgG and IgM) were significantly decreased, alongside a significant elevation of triglycerides, direct bilirubin, and indirect bilirubin in growing rabbits fed diets with AFB1 (P < 0.05). Supplementing the AFB1 diet with LACP restored the growth reduction, improved liver (AST, ALP, ALT, and GGT) and kidney (creatinine and uric acid) functions, and enhanced immune markers in rabbit serum (P < 0.05). Antioxidant indices (SOD, GSH, and CAT) were significantly decreased in the AFB1 group (P < 0.05). However, the addition of LACP to the AFB1-contaminated diets improved antioxidant capacity and malondialdehyde (MDA) and protein carbonylation (PC) in hepatic tissues of rabbits (P < 0.05). Serum interlukin-4 (IL-4) and interferon gamma (IFN‐γ) levels were significantly increased in the AFB1 group (P < 0.05), but the addition of LACP significantly reversed this elevation. AFB1 downregulated the expression of immune-inflammatory genes such Nrf2, IL-10, and BCL-2 genes, while up-regulating the caspase-3 (CASP3) gene (P < 0.05). Supplementing AFB1 diet with LACP significantly decreased the expression of immune-inflammatory genes (Nrf2, IL-10, and BCL-2) and reduced the expression of the apoptotic-related gene CASP3. This study highlights the potential of L. plantarum (1 × 109 cfu/g /kg diet) as a protective agent against AFB1 in growing rabbits by enhancing antioxidant and immune function and reducing apoptosis and inflammation pathways.

Background: Globally, resistance to antimicrobial drugs is a major hazard to public health. Infections that were once easily treatable with antibiotics are becoming harder to control, leading to prolonged illnesses, increased mortality rates, and higher healthcare costs. Aim: This study intended to assess the antimicrobial, specifically the anti- Methicillin-resistant Staphylococcus aureus (MRSA) , and anticancer properties of different extracts obtained from A. herba-alba (AHA). Methods: The antibacterial tests of AHA were performed on two Gram-negative bacterial strains (Escherichia coli and Klebsiella pneumonia), two Gram-positive bacterial strains (Methicillin-resistant Staphylococcus aureus (MRSA) and Staphylococcus aureus). Initial screening for antibacterial activities was conducted using the agar-disc diffusion technique. Subsequently, the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined through the broth-dilution assay. The anticancer test was carried out in vitro on a human colorectal carcinoma cell line (HCT-116) using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a tetrazole) )MTT( method. Results: Among all extracts, n-hexane extract of AHA was the most effective against S. aureus with the highest inhibition zone (24.67 mm) comparing to standard antibiotic (erythromycin, 24.00 mm) followed by the methanolic extract against MRSA (24.00 mm). The methanol extract of AHA showed the highest antibacterial activity against MRSA. The results of MIC and MBC of the AHA methanol extract against MRSA were 1.17±1.09 mg/mL and 9.375±0.0 mg/mL, respectively demonstrated therapeutically significant antibacterial activity. Ethyl acetate extract has no antibacterial activity against E. coli and K. pneumonia. The findings indicated that the methanol extract of AHA exhibited the highest efficacy against the colorectal carcinoma cell line (HCT-116), with an IC50 value of 126.61±13.35 µg/mL. Conclusion: These findings suggest that methanol extract of AHA could be considered as a potential agent to serve as a source of antibacterial and anticancer compounds. [Open Vet J 2024; 14(4.000): 990-1001]

Background: The concept of success is typically established by the researcher or the practitioner rather than the patient, who has the greatest stake in the outcome of the prosthodontics therapy. Aim: To assess patient satisfaction and oral health-related quality of life (OHRQoL) in following full mouth rehabilitation with implant-supported prostheses (ISP). Methods and Materials: Thirty-two patients who underwent full mouth rehabilitation with ISP were included in this study. The Oral Health Impact Profile-14 (OHIP-14) questionnaire was used for the assessment of patient satisfaction and OHRQoL following full mouth rehabilitation with ISP. Results: The functional limitation among study participants before, 1 month, and 3 months after ISP was 2.1 ± 1.3, 1.5 ± 0.8, and 1.4 ± 0.9, respectively. There was a significant reduction in functional limitation, psychological disability, and social disability before and 3 months after ISP. Conclusion: There is a significant improvement in patient satisfaction and OHRQoL in following full mouth rehabilitation with ISP.

Background: Currently, one of the most prevalent oral abnormalities is malocclusion. There is a rising percentage of patients who are willing to undertake orthodontic procedures. Aim: To evaluate the impact of orthodontic treatment on the morphology of temporomandibular joint (TMJ) in patients with malocclusion associated with TMJ abnormality such as skeletal class II deep bite malocclusion using CBCT. Methods and Materials: In total, 80 patients who underwent orthodontic treatment for skeletal class II deep bite malocclusion over a duration of 3 years were included. Parameters of the morphology of the condyle and glenoid fossa on CBCT scan both before and after orthodontic therapy were measured. Results: The maximum cross-sectional area of the condyle decreased from 99.84 ± 18.89 mm2 to 81.32 ± 16.80 mm2 after orthodontic treatment. The anterior condyle oblique inclination increased from 34.14 ± 2.98° to 36.52 ± 3.41° after orthodontic therapy. The articular eminence to the FH plane angle increased from 29.65 ± 2.53° to 33.29 ± 4.18° after orthodontic therapy. Conclusion: Orthodontic treatment is significantly correlated with improvement in TMJ health in patients of malocclusion.

Chronic exposure to opioids can lead to downregulation of astrocytic glutamate transporter 1 (GLT-1), which regulates the majority of glutamate uptake. Studies from our lab revealed that beta-lactam antibiotic, ceftriaxone, attenuated hydrocodone-induced downregulation of GLT-1 as well as cystine/glutamate antiporter (xCT) expression in central reward brain regions. In this study, we investigated the effects of escalating doses of morphine and tested the efficacy of novel synthetic non-antibiotic drug, MC-100093, and ceftriaxone in attenuating the effects of morphine exposure in the expression of GLT-1, xCT, and neuroinflammatory factors (IL-6 and TGF-β) in the nucleus accumbens (NAc). This study also investigated the effects of morphine and beta-lactams in locomotor activity, spontaneous alternation percentage (SAP) and number of entries in Y maze since opioids have effects in locomotor sensitization. Mice were exposed to moderate dose of morphine (20 mg/kg, i.p.) on days 1, 3, 5, 7, and a higher dose of morphine (150 mg/kg, i.p.) on day 9, and these mice were then behaviorally tested and euthanized on Day 10. Western blot analysis showed that exposure to morphine downregulated GLT-1 and xCT expression in the NAc, and both MC-100093 and ceftriaxone attenuated these effects. In addition, morphine exposure increased IL-6 mRNA and TGF-β mRNA expression, and MC-100093 and ceftriaxone attenuated only the effect on IL-6 mRNA expression in the NAc. Furthermore, morphine exposure induced an increase in distance travelled, and MC-100093 and ceftriaxone attenuated this effect. In addition, morphine exposure decreased the SAP and increased the number of arm entries in Y maze, however, neither MC-100093 nor ceftriaxone showed any attenuating effect. Our findings demonstrated for the first time that MC-100093 and ceftriaxone attenuated morphine-induced downregulation of GLT-1 and xCT expression, and morphine-induced increase in neuroinflammatory factor, IL-6, as well as hyperactivity. These findings revealed the beneficial therapeutic effects of MC-100093 and ceftriaxone against the effects of exposure to escalated doses of morphine.

Abstract The genus Enterobacter belongs to the ESKAPE group, which includes Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. This group is characterized by the development of resistance to various antibiotics. In recent years, Enterobacter cloacae (E. cloacae) has emerged as a clinically important pathogen responsible for a wide range of healthcare-associated illnesses. Identifying Enterobacter species can be challenging due to their similar phenotypic characteristics. The emergence of multidrug-resistant E. cloacae is also a significant problem in healthcare settings. Therefore, our study aimed to identify and differentiate E. cloacae using Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) as a fast and precise proteomic analytical technique. We also tested hospital-acquired E. cloacae isolates that produce Extended-spectrum beta-lactamases (ESBL) against commonly used antibiotics for treating urinary tract infections (UTIs). We used a total of 189 E. cloacae isolates from 2300 urine samples of patients with UTIs in our investigation. We employed culturing techniques, as well as the BD Phoenix™ automated identification system (Becton, Dickinson) and Analytical Profile Index (API) system for the biochemical identification of E. cloacae isolates. We used the MALDI Biotyper (MBT) device for peptide mass fingerprinting analysis of all isolates. We utilized the single peak intensities and Principal Component Analysis (PCA) created by MBT Compass software to discriminate and cluster the E. cloacae isolates. Additionally, we evaluated the sensitivity and resistance of ESBL-E. cloacae isolates using the Kirby Bauer method. Out of the 189 E. cloacae isolates, the BD Phoenix system correctly identified 180 (95.24%) isolates, while the API system correctly identified 165 (87.30%) isolates. However, the MBT accurately identified 185 (98.95%) isolates with a score of 2.00 or higher. PCA positively discriminated the identified E. cloacae isolates into one group, and prominent peaks were noticed between 4230 mass-to-charge ratio (m/z) and 8500 m/z. The ESBL-E. cloacae isolates exhibited a higher degree of resistance to ampicillin, amoxicillin-clavulanate, cephalothin, cefuroxime, and cefoxitin. Several isolates were susceptible to carbapenems (meropenem, imipenem, and ertapenem); however, potential future resistance against carbapenems should be taken into consideration. In conclusion, MALDI-TOF MS is a powerful and precise technology that can be routinely used to recognize and differentiate various pathogens in clinical samples. Additionally, the growing antimicrobial resistance of this bacterium may pose a significant risk to human health.

Abstract Background This study examines the multifaceted factors influencing academic performance among dental students in Saudi Arabia, exploring the complex relationships between demographic, educational, and psychological variables and students' Grade Point Averages (GPAs) to enhance global dental education admission strategies. Methods Data on demographics, academic performance indicators (including GPA, high school grades, test scores), accommodation type, parental education, suspension history, and English proficiency were collected through an English-language electronic questionnaire from 900 dental students across multiple institutions in Riyadh. The study employed Pearson’s correlation analysis to examine relationships between GPA and various academic and demographic factors. A detailed regression analysis, using a stepwise selection based on Akaike’s information criteria (AIC), identified significant GPA predictors and evaluated the average marginal effects of pre-admission variables on GPA, alongside rigorous diagnostic checks to validate the model’s robustness. Results The study revealed a complex interplay of factors impacting GPA among dental students. High school grades, achievement, and aptitude test scores showed moderate positive correlations with GPA, while negative correlations were observed with age and number of times suspended. Regression analysis highlighted age, marital status, high school grades, and test scores as key predictors, with complex interaction effects demonstrating the layered influences of these factors. For instance, the negative impact of age on GPA was moderated by high school grade and aptitude test score. The analysis also highlighted the significant marginal effects of various pre-admission variables on GPA, such as the negative average impact of age and the positive impact of high school grades. Conclusions This study provides valuable insights into the multifaceted determinants of academic success in dental education. Our findings underscore the significant roles of high school grades, achievement, and aptitude test scores, as well as the nuanced influence of age and marital status on GPA. These results advocate for a holistic approach in evaluating candidates for dental programs and have broader implications for global dental education, emphasizing the need for comprehensive admission strategies.

Learning the Arabic language through gamified methods is beneficial, particularly for beginners. Gamification provides an enjoyable and challenging experience for the learners, motivating them to become committed and participate in the classroom activity. The students develop a more competitive spirit and anticipate their chances of achieving high scores for each game level and ranking high against fellow learners. Game elements such as feedback and audio pronunciations assist in user engagement with the teacher and other learners. This systematic literature review critically synthesizes past literature to create an understanding of the application and effectiveness of gamified learning strategies for Arabic language learning. PRISMA technique was used to conduct a systematic review, and after final scrutiny, 15 articles were shortlisted for review. The findings suggested that gamification improves learner motivation, engagement, and achievement in mastery of Arabic vocabulary and grammar among non-native speakers. The degree of motivation is influenced by the teacher’s perception, attitude, enthusiasm, and commitment to gamified learning strategies. The findings of this systematic review can help language instructing institutions to emphasize gamification to enhance the motivation of learners and increase their learning abilities. Moreover, it can be helpful for instructors of the Arabic language, and they can realize the importance of gamification in teaching Arabic to non-native speakers.

Abstract The study aims to assess groundwater resources in Sinai's central area using remote sensing, geoelectric, and well-logging data, utilising techniques for modelling hydrogeological frameworks and evaluating desert regions' groundwater potential. Its utilized satellite image sources, soil maps, and geological maps to map the effects of various factors on groundwater potentiality recharge, dividing it into five zones. Eighteen deep VES stations were used to examine the upper part of the groundwater aquifer in Central Sinai, Egypt, comparing it with available borehole information (Well-1, and JICA-1) to establish subsurface geology and hydro-geology positioning. Borehole data, VES interpretation results, hydro-geophysical maps, and four geoelectrical cross-sections were used to visualize the rearward expansion of eight lithological units, groundwater-bearing sections, and aquifer-filled thicknesses. From interpretation data output reveal three zones with significant recharge and storage potential, including two groundwater aquifers. The shallow aquifer has a saturation thickness of the fractured limestone of 35–250 m, while the deep aquifer Nubian sandstone is detected at depths ranging from 660–1030 m. NW–SE and NE–SW faults likely recharge conduits connecting shallow and deep aquifers, providing sites with acceptable groundwater potential for living, agriculture, and development in Sinai.

Aim: To explore nurses’ readiness to prescribe medications under supervision and identify associations between prescribing practices under supervision and demographic characteristics in Saudi Arabia. Design: A cross-sectional study. Methods: Using convenience sampling, this study used a 32-item survey to collect data on nurses prescribing medications under supervision between December 2022 and March 2023. Results: A total of 379 nurses were recruited from different regions in Saudi Arabia. Approximately 7% (n = 30) of the participants were prescribing medications independently, and 70% (n = 267) expressed their likelihood of becoming prescribers. The highest motivating factors to become prescribers were improvement of patient care (52.2%) and contribution to the multidisciplinary team (52.0%). Most participants (60%–81%) agreed that prescribing medications under supervision would improve potential outcomes at the system, nurse, and patient levels. Availability of appropriate mentors or supervisors (72.9%) was the highest rated facilitating factor, followed by support of nursing colleagues (72%). Based on demographic characteristics, findings revealed significant differences in the: a) likelihood and motivators of becoming prescribers; b) required minimum qualification, years of experience, and continuing professional education hours to become prescribers; and c) type of organizations delivering educational programs for nurse prescribing. Conclusion: Majority of nurses in Saudi Arabia favored becoming prescribers, and motivating factors were mostly relevant to optimizing patient care outcomes. Having the proper supervision was rated as the most facilitating factor for nurse prescribing. Nurses’ views on potential outcomes, facilitating factors, and possible motivators varied based on nurses’ demographical characteristics. Implications for the professional and/or patient care: Nurses favored prescribing under supervision to improve patient care outcomes, which is an opportunity to expand the benefits of health services, including easy access to healthcare. Impact: Results revealed that nurses support the implementation of prescribing practice under supervision. Thus, the findings may inform practice change in Saudi Arabia to allow prescribing under supervision, which was perceived to have a positive impact on patient care outcomes. Reporting Method: This study adhered to STROBE guidelines.

BackgroundCompassion satisfaction (CS) is a phenomenon that has been studied among the helping professions, such as nursing and social work and has been linked to stress, burnout, compassion fatigue, and vicarious trauma. Social work educators may also experience these same issues, yet more research is needed on how they might counter the negative impacts associated with this type of work by utilizing their experiences of CS.ObjectivesA phenomenological study was carried out to explore and describe how social work educators in higher education experiences CS.MethodsEleven in-depth interviews with social work educators were conducted, and constructivist grounded theory techniques were utilized to analyze the data.ResultsSocial work educators experienced CS within the education and personal realms, which encompassed four different elements: achievement, support, balance, and empathy.DiscussionThe four elements of CS were utilized by social work educators in this study as coping strategies to enhance their experience of CS, thus encountering threats to CS, such as institutional barriers, interaction with administrators and colleagues, and work overload.ConclusionInterventions fostering compassion satisfaction and reducing compassion fatigue, burnout, and stress should be considered, including interventions that increase the sense of accomplishment, promote holistic self-care, encourage administrative and collegial support, and improve work-life balance.

Background Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.Methods Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.Results Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23–3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.Conclusion In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Introduction: Kinesiotaping is a typical method used in physical therapy. It has the potential to boost muscle strength and performance when used properly The aim of the study is to determine the immediate effect of 35% tension Kinesiotaping on handgrip strength in healthy males.Methods: The study involved 60 healthy males (physical therapy students) between the ages of 20 and 23. The participants were randomly assigned to 1 of 2 groups: the tension Kinesiotaping group (tKT), undergoing taping at a 35%tension, or the control group, receiving the identical taping technique but without tension. All participants' handgrip strength was measured using a hand-held dynamometre. The measurements were taken before and after taping for 30 minutes.Results: Only in the tension Kinesiotaping group was there substantial improvement in handgrip strength (tKT). There were no significant differences in the control group before and after 30 minutes (p=0.970), but significant results were noted in the tKT group after applying kinesiotape with a 35% tension (p

This work explored the activities of bergamot oil nano-emulsion (NBG) in modulating blood biochemical parameters, redox status, immunity indices, inflammation markers, semen quality, testicular changes and the expression of HSPs genes in stressed rabbit bucks. Twenty-four mature rabbit bucks (5 months) were randomly divided into three groups; control group (NBG0) received 1 ml of distilled water, while the other two groups received NBG orally at doses of 50 and 100 mg/kg (bw) twice a week. The present study's findings revealed that treated groups had lower values of total and direct bilirubin, triglyceride, lactate dehydrogenase, and creatinine compared with NBG0 group (p

Introduction: Ondansetron is a drug that is routinely prescribed for the management of nausea and vomiting associated with cancer, radiation therapy, and surgical operations. It is mainly metabolized in the liver, and it might accumulate in patients with hepatic impairment and lead to unwanted adverse events. Methods: A physiologically based pharmacokinetic (PBPK) model was developed to predict the exposure of ondansetron in healthy and liver cirrhosis populations. The population-based PBPK simulator PK-Sim was utilized for simulating ondansetron exposure in healthy and liver cirrhosis populations. Results: The developed model successfully described the pharmacokinetics of ondansetron in healthy and liver cirrhosis populations. The predicted area under the curve, maximum systemic concentration, and clearance were within the allowed twofold range. The exposure of ondansetron in the population of Child–Pugh class C has doubled in comparison to Child–Pugh class A. The dose has to be adjusted for liver cirrhosis patients to ensure comparable exposure to a healthy population. Conclusion: In this study, the developed PBPK model has described the pharmacokinetics of ondansetron successfully. The PBPK model has been successfully evaluated to be used as a tool for dose adjustments in liver cirrhosis patients.

Therapeutic and/or preventive interventions using phytochemical constituents for ischemic heart disease have gained considerable attention worldwide, mainly due to their antioxidant activity. This study investigated the cardioprotective effect and possible mechanism of juglone, a major constituent of the walnut tree, using an isoproterenol (ISO)-induced myocardial infarction (MI) model in rats. Rats were pretreated for five (5) days with juglone (1, 3 mg/kg, i.p) and atenolol (1 mg/kg, i.p) in separate experiments before inducing myocardial injury by administration of ISO (80 mg/kg, s.c) at an interval of 24 h for 2 consecutive days (4th and 5th day). The cardioprotective effect of juglone was confirmed through a lead II electrocardiograph (ECG), cardiac biomarkers (cTnI, CPK, CK-MB, LDH, ALT and AST) and histopathological study. The results of our present study suggest that prior administration of juglone (1 and 3 mg/kg) proved to be effective as a cardioprotective therapeutic agent in reducing the extent of myocardial damage (induced by ISO) by fortifying the myocardial cell membrane, preventing elevated T-waves, deep Q-waves in the ECG, heart to body weight ratio, infarction and also by normalizing cardiac marker enzymes (cTnI, CPK, CK-MB, LDH, ALT and AST) and histopathological changes, such as inflammation, edema and necrosis. In conclusion, this study has identified phytochemical constituents, in particular juglone, as a potential cardioprotective agent.

The study investigates EFL (English as a Foreign Language) learners' opinions, attitudes and the challenges of incorporating AI-powered teaching and learning. It also examines how their ideas and attitudes are affected by demographic variables. 258 students were selected using a random sampling method from a population comprising students studying in different levels of programs at the College of Science and College of Business Administration, Prince Sattam bin Abdul-Aziz University, KSA. A questionnaire was self-developed using some modified items from prior studies as the study looks at how certain independent variables (e.g., study level, residential background and parents' educational level) affect the dependent variable (e.g., learners' opinions, attitudes and challenges for AI-powered learning and teaching). The quantitative approach (descriptive quantitative design) revealed that Saudi EFL students held a high level of positive opinions and attitudes towards AI-powered learning. However, the analysis found that many students thought implementing AI-powered learning was challenging. A one-way ANOVA showed no significant difference based on respondents' residential background and parental education. However, respondents differed significantly based on their level or year of study. The study findings will assist administrators and course teachers in using AI-powered technologies to overcome challenges and prepare students for achievement in the English language.

This study was conducted in order to reveal the level of instructional leadership behavior scores of school administrators working in public secondary schools according to the opinions of teachers and to examine them in terms of various variables. The working group of this research, which was designed in the converging parallel pattern of the mixed method, was formed through easily accessible sampling. 383 teachers in the central districts of Mersin province formed the quantitative data study group and 5 teachers formed the qualitative data study group. The semistructured interview form prepared by the researcher and the "Instructional Leadership Scale" developed by Alig-Meilcarek (2003) and adapted to Turkish by Sahin (2011) were used as data collection tools. Kolmogorov Smirnov test was applied for normality test. Kolmogorov Smirnov value is <0.05. Skewness value is between -+ 3 values and the kurtosis value is between +-10 values. Kline (2011) mentioned that normality tests can be performed if the normal distribution has a skewness value of ± 3 and a kurtosis value of ± 10. Since the quantitative data showed a normal distribution, they were analyzed by independent T-test analysis, while the qualitative data were analyzed with the help of content analysis. When the research findings were evaluated, it was found that there was no significant difference between the school administrators' instructional leadership scores according to the gender of the participants.

Objectives: This study examined residents’ attitudes and practices regarding the relevance of spirituality in psychiatry within Saudi residency training programs; their experiences and comfort levels in addressing patients’ spiritual concerns; and their interest and past learning experiences in this area of training and practice. Methods: This cross-sectional study targeted trainees and recent graduates of residency programs across Saudi Arabia. The study materials consisted of an electronic questionnaire that was adapted with permission. Results: The total number of respondents was 71 out of 180 potential participants (39.44%). Most residents (64.8%) felt that it was appropriate to inquire about the spiritual aspects of patients’ lives and that it was essential to address spiritual problems or needs that patients may have within the clinical setting (71.8%). Many participants (40.80%) described themselves as being both religious and spiritual. Most respondents (94.4%) did not receive any training on spirituality and psychiatry, and 80.3% said they would like to learn more about the subject. Conclusions: Our findings indicate that residents have an overall high level of personal spirituality and that they feel it is relevant in clinical practice. However, they have not had much training in this area and are interested in learning more. Educational initiatives would be beneficial for improving the effectiveness of residents and patient care in this untapped area of spirituality in psychiatry.

This investigation delves into the potential use of halogen bonding to enhance both the short-circuit current (JSC) and overall efficiency of dye-sensitized solar cells (DSSCs). Specifically, we synthesized two distinct dyes, SQI-F and SQI-Cl, and characterized them using FT-IR, 1HNMR, 13C NMR, and mass spectroscopy. These dyes are based on the concept of incorporating halogen atoms within unsymmetrical squaraine structures with a donor–acceptor–donor (D-A-D) configuration. This strategic design aims to achieve optimal performance within DSSCs. We conducted comprehensive assessments using DSSC devices and integrated these synthesized dyes with iodolyte electrolytes, denoted as Z-50 and Z-100. Further enhancements were achieved through the addition of CDCA. Remarkably, in the absence of CDCA, both SQI-F and SQI-Cl dyes displayed distinct photovoltaic characteristics. However, through sensitization with three equivalents of CDCA, a significant improvement in performance became evident. The peak of performance was reached with the SQI-F dye, sensitized with three equivalents of CDCA, and paired with iodolyte Z-100. This combination yielded an impressive DSSC device efficiency of 6.74%, an open-circuit voltage (VOC) of 0.694 V, and a current density (JSC) of 13.67 mA/cm2. This substantial improvement in performance can primarily be attributed to the presence of a σ-hole, which facilitates a robust interaction between the electrolyte and the dyes anchored on the TiO2 substrate. This interaction optimizes the critical dye regeneration process within the DSSCs, ultimately leading to the observed enhancement in efficiency.

Abstract Background Natural phenolic compounds and Phenolics-rich medicinal plants are also of great interest in the management of diabetes. The current study was aimed to analyze phenolics in P. hydropiepr L extracts via HPLC-DAD analysis and assess their anti-diabetic potentials using in-vitro and in-silico approaches. Methods Plant crude methanolic extract (Ph.Cme) was evaluated for the presence of phenolic compounds using HPLC-DAD analysis. Subsequently, samples including crude (Ph.Cr), hexane (Ph.Hex), chloroform (Ph.Chf), ethyl acetate (Ph.EtAc), butanol (Ph.Bt), aqueous (Ph.Aq) and saponins (Ph.Sp) were tested for α-glucsidase and α-amylase inhibitory potentials and identified compounds were docked against these target enzymes using Molecular Operating Environment (MOE) software. Fractions were also analyzed for the nutritional contents and acute toxicity was performed in animals. Results In HPLC-DAD analysis of Ph.Cme, 24 compounds were indentfied and quantified. Among these, Kaemferol-3-(p-coumaroyl-diglucoside)-7-glucoside (275.4 mg g− 1), p-Coumaroylhexose-4-hexoside (96.5 mg g− 1), Quercetin-3-glucoronide (76.0 mg g− 1), 4-Caffeoylquinic acid (58.1 mg g− 1), Quercetin (57.9 mg g− 1), 5,7,3′-Trihydroxy-3,6,4′,5′-tetramethoxyflavone (55.5 mg g− 1), 5-Feruloylquinic acid (45.8 mg g− 1), Cyanidin-3-glucoside (26.8 mg g− 1), Delphinidin-3-glucoside (24 mg g− 1), Quercetin-3-hexoside (20.7 mg g− 1) were highly abundant compounds. In α-glucosidase inhibition assay, Ph.Sp were most effective with IC50 value of 100 μg mL-1. Likewise in α-amylase inhibition assay, Ph.Chf, Ph.Sp and Ph.Cme were most potent fractions displayed IC50 values of 90, 100 and 200 μg mL-1 respectively. Docking with the α-glucosidase enzyme revealed top ranked conformations for majority of the compounds with Kaemferol-3-(p-coumaroyl-diglucoside)-7-glucoside as the most active compound with docking score of − 19.80899, forming 14 hydrogen bonds, two pi-H and two pi-pi linkages with the Tyr 71, Phe 158, Phe 177, Gln 181, Arg 212, Asp 214, Glu 276, Phe 300, Val 303, Tyr 344, Asp 349, Gln 350, Arg 439, and Asp 408 residues of the enzyme. Likewise, docking with α-amylase revealed that most of the compounds are well accommodated in the active site residues (Trp 59, Tyr 62, Thr 163, Leu 165, Arg 195, Asp 197, Glu 240, Asp 300, His 305, Asp 356) of the enzyme and Cyanidin-3-rutinoside displayed most active compound with docking score of − 15.03757. Conclusions Phytochemical studies revealed the presence of highly valuable phenolic compounds, which might be responsible for the anti-diabetic potentials of the plant samples.

UAV remote identification is an emerging technology that allows ground observers to identify a drone in the airspace and obtain information about it and its operator. The goal is to enhance safe operation over people and at night and protect public privacy. Two modes are known for remote identification: broadcast-based and network-based. Although both modes’ technical implementation seems straightforward, remote identification is challenging because it includes multiple agents that follow different interests, such as safety, security, privacy, and businesses. Currently, enormous efforts for regulation, standardization, design, implementation, and testing are being made to put this technology forward. This paper aims to outline the landscape of these activities as a survey and tutorial to inform regulators, standardization organizations, industry, and researchers about the state of the art in this technology and to highlight its opportunities and challenges.

Background: The star fruit [Averrhoa carambola L (Oxalidaceae)] is traditionally used in the treatment of many ailments in many countries. It possesses several pharmacological activities, including antioxidant and anti-inflammatory effects. However, it contains the neurotoxic caramboxin and its high content of oxalic acid limits its consumption by individuals with compromised kidney function. This study assessed the anti-hyperlipidemic and antioxidant activities of different fractions of the methanolic extract of A. carambola leaves (MEACL).Methods: The antioxidant activity was investigated using FRAP, and ABTS and DPPH radical-scavenging assays and the inhibitory activity toward pancreatic lipase (PL) and HMG-CoA reductase was assayed in vitro. Acute hyperlipidemia was induced by poloxamer-407 (P-407) in rats and different fractions of MEACL (n-hexane, chloroform, n-butanol, ethyl acetate (EA), water, and chloroform) were orally administered. Cholesterol and triglycerides were determined at 0, 12, 24, and 48 h and LDL-C, vLDL-C, HDL-C, lipid peroxidation (LPO) and antioxidants were assayed after 48 h. The expression of ABCA1, ABCG5, ABCG8, LDL-R, SREBP-1, and SREBP-2 and the activity of HMG-CoA reductase were assayed in the liver of P-407-administered rats treated with the EA fraction.Results: The in vitro data revealed potent radical-scavenging activities of MEACL fractions with the most potent effect showed by the EA fraction that also suppressed the activities of HMG-CoA reductase and PL. In P-407-induced hyperlipidemic rats, all fractions prevented dyslipidemia as shown by the decrease in total cholesterol, triglycerides, LDL-C, vLDL-C and atherogenic index. MEACL and its fractions prevented LPO and boosted GSH, superoxide dismutase, glutathione peroxidase, and catalase in P-407-administered rats. The EA fraction showed more effective anti-hyperlipidemic and antioxidant effects than other fractions and downregulated SREBP-2 while upregulated ABCA1 and LDL-R and ameliorated LPL and HMG-CoA reductase in hyperlipidemic rats.Conclusion: MEACL showed in vitro and in vivo antioxidant activity and the EA fraction significantly ameliorated dyslipidemia in a rat model of P-407-induced acute hyperlipidemia by modulating LPL, PL, HMG-CoA reductase, and cholesterolgenesis-related factors. Therefore, the leaves of A. carambola represent a safe alternative for the star fruit particularly in kidney disease patients, and the EA is the most effective anti-hyperlipidemic and antioxidant fraction.

Background: Maternal diet quality, obesity, and abdominal obesity are known risk factors for hypertension in women. Objectives: This study assessed the factors associated with hypertension in women of child-bearing age in Odeda local government area communities, Abeokuta. Methods: A cross-sectional survey was conducted on 250 women (18–49 years) using systematic random sampling. Information on dietary intake was obtained using a 24-h dietary recall questionnaire. Food consumption (FCS), food variety (FVS), and dietary diversity scores (DDS) were assessed using validated questionnaires. Blood pressure, weight, height, waist and hip circumferences were assessed using standard procedures. Data were presented with frequency, percentage, median, interquartile range, and binary logistic regression was used to test for associated factors with hypertension at p

The exclusive breastfeeding (EBF) intention conceived by pregnant women is the most important predictor of breastfeeding (BF) initiation, duration, and continuation. This study explores the associated factors of EBF intention among pregnant women. This was a descriptive cross-sectional study conducted from November 2022 to January 2023 with 382 pregnant women who came to the outpatient clinic in the Maternal and Children Hospital (MCH). Four instruments were used for data collection: the Infant Feeding Intention scale, the Gender-Friendly BF Knowledge scale (GFBKS), the Iowa Infant Feeding Attitude scale (IIFAS), and the basic data questionnaire. The study findings indicated that 51.8% and 75.9% of gravida women had adequate knowledge and a positive attitude regarding BF. Furthermore, 56.3% of the participants had a high intention for EBF. Binary logistic regression illustrated that occupational status, antenatal care, plan for the current pregnancy, BF practice, last child delivery mode, medical disorder during the current pregnancy, age, BF knowledge, and attitude are potential predictors. The goodness of fit test revealed that 46.8% of the EBF intention could be anticipated through the positive pre-mentioned factors. The low EBF intention is modifiable by addressing the previously positive predictors. BF educational interventions should be tailored based on EBF intention predictors in order to be effective and lead to behavior change.

الملخص: فيروس كورونا ٢٠١٩ (كوفيد-١٩) هو مرض وبائي شديد العدوى وفي الغالب يكون مصحوبا بالحمى والأعراض التنفسية، ولكنه قد يأتي متنكرا بمتلازمة الشريان التاجي الحادة، أو ألم أو تورم للساق مع تجلط وريدي، أو فقدان الوعي مع تخثر وريدي دماغي، أو ارتباك، أو ضعف الأطراف مع احتشاء الدماغ، أو ألم العصب الوجهي، أو التهاب ملتحمة العين الحاد، أو ألم الحفرة الحرقفي اليمنى مثل التهاب الزائدة أو ألم الخصية. هنا قدمنا حالة لمريض ذكر في ٤٢ من عمره كان يعاني من أعراض كوفيد-١٩ خفيفة، وتطورت إلى احتشاء في عضلة القلب بسبب تخثر في الشريان التاجي الأيسر. تمت معالجة المريض بالأدوية وتحسنت حالته. يجب أن يكون أطباء الطوارئ يقظين للأعراض غير الاعتيادية التي قد يأتي بها مرضى كوفيد-١٩ وخاصة أثناء الجائحة. Abstract: The coronavirus disease 2019 (COVID-19) is a highly contagious novel infection that predominantly presents with fever and respiratory symptoms. However, COVID-19 can masquerade as an acute coronary syndrome, leg pain or swelling with venous thrombosis, loss of consciousness with cerebral venous thrombosis, confusion, limb weakness with brain infarction, facial neuralgia, acute conjunctivitis, acute appendicitis, and testicular pain. We report on a 42-year-old man who presented with mild symptoms of COVID-19. The patient's electrocardiogram showed an ST-segment elevation myocardial infarction (STEMI) due to a left coronary thrombosis. The patient was managed conservatively with medicines and had an uneventful recovery. Emergency physicians should have a high index of suspicion for the unusual presentations of COVID-19.

This study was conducted to determine the perceptions of children, one of whose relatives was undergoing chemotherapy treatment and who participated in education at the House of Compassion, about the patient and hospital perceptions and their views on the House of Compassion. Case study design, one of the qualitative research designs, was used. Criterion sampling, one of the purposeful sampling types, was used to determine the study group. The study group consisted of 20 children who participated in the training at the House of Compassion in a hospital in Ankara and one of whose relatives was undergoing chemotherapy treatment. In the study, "Demographic Information Form" was used to collect information about children and parents, "Child Interview Form" and "Children's Pictures" were used to determine children's perceptions of patients, hospital and House of Compassion. The data obtained were analyzed using the descriptive analysis technique. As a result of the research, it was observed that children knew the definition of the hospital, the personnel working in the hospital, and the practices carried out, and emphasized the healing and therapeutic aspects of the hospital. Children reported coming to the House of Compassion to play games, have fun, and have a good time. It was determined that children felt happy and sound in the House of Compassion and that they liked the House of Compassion. As a result, it can be said that the House of Compassion has positive effects on children's perceptions of the patient and the hospital.

Technological advancements have led to the emergence of the Fourth Industrial Revolution (4IR). Students' readiness to use 4IR technologies is thus essential for the development of knowledgeable, competent, and skilled graduates. However, ensuring students' readiness to use 4IR technologies is quite challenging, leading to a need to understand the factors that influence readiness in this regard. In this study, a research model was developed for examining effects of students' technical skills, attitudes, and knowledge on their readiness to use 4IR technologies. Data were collected from 182 students through an online survey. A two-step data analysis was then performed using AMOS. A confirmatory factor analysis was conducted to assess the research model, and SEM was then applied to examine the hypotheses and relationships between the constructs. The results demonstrated that students' technical skills, attitudes, and knowledge levels significantly influenced their readiness to use 4IR technologies. Recommendations for policy and decision makers in higher education were drawn from this research to increase students' readiness for adopting and using 4IR technologies.

ObjectivesTo study the clinical characteristics and outcomes of patients experiencing an ischemic stroke during Ramadan vs. non-Ramadan months in a tertiary academic center in an Islamic country.MethodsWe retrospectively reviewed all patients with ischemic stroke (IS) in Ramadan and non-Ramadan months for four consecutive years (February 2016–June 2019). All demographics, vascular risk factors, laboratory results, modified Rankin Scale (mRS) at admission and discharge, National Institute Stroke Scale (NIHSS), and in-hospital complication data were collected for all patients.ResultsOne thousand and 58 patients were included (non-Ramadan, n = 960; during Ramadan, n = 98). The mean age during Ramadan was 59 ± 13 years. Most non-Ramadan IS patients during Ramadan were male (68.5%; 57.1%, respectively). There was no statistical difference in vascular risk factors and medical history between the two groups. However, Ramadan patients had higher median NIHSS scores at discharge (p = 0.0045). In addition, more ICU admissions were noted among Ramadan patients (p = 0.009). In the gender-specific analysis for Ramadan patients, we found a statistically significant difference in smoking and urinary tract infection (p = 0.006, p = 0.005, respectively).ConclusionBased on our results, there was no difference, in general, between patients with IS during Ramadan and non-Ramadan months. However, IS patients had higher NIHSS scores at discharge and more ICU admissions during Ramadan. Last, we suggest future studies with larger sample sizes, longer duration, and including all types of strokes.

Objectives: The aim of this study was to investigate the variables that may affect treatment continuation in children aged 6 to 12 years who were newly diagnosed with ADHD. Methods: A total of 132 children diagnosed with ADHD and their parents participated in the study. Sociodemographic and clinical risk factors affecting continuation of treatment were examined using logistic regression analysis. Results: Multiple model examination revealed that greater age increased the risk of treatment discontinuation 1.824 times (p = 0.003) while a lower total length of paternal education increased the risk of discontinuation (1/0.835) 1.198 times (p = 0.022). Other variables emerging as significant in the univariate model lost that significance in the multiple model. Conclusions: Understanding the variables associated with medication discontinuation in ADHD in different populations and taking these variables into account in the development of health policies, will be useful in improving the long-term devastating effects of the disorder.

This study investigated the flexural performance of steel fibre beams reinforced with smooth and deformed reinforcement, both experimentally and numerically. As part of the experimental investigation, five full-scale reinforced concrete beams were constructed with plain and steel fibre concrete and were tested under 4-point flexural monotonic loading. The amount of fibre and the condition of the rebar were the main parameters studied. The test’s outcome built up a numerical model to simulate the actual performance of the reinforced concrete beams under tested loading. Afterward, a parametric study was conducted to get a better understanding of the behaviour of the steel fibre concrete beams. The experimental results show that the cracking load was not affected by the steel reinforcement conditions, whether smooth or deformed. Moreover, 9% of the ultimate deflection was caused by tension stiffening and 3% due to the steel fibre content in steel fibre concrete beams. Finally, the concrete compressive strength was found to have less of an effect on the ultimate deflection than the ultimate load.

This paper presents the effect of non-uniform reinforcement ratio along the beam length on the flexural behaviour experimentally and numerically. Within the experiment, four reinforced concrete beams each had a different reinforcement ratio. However, three of four beams had a similar reinforcement ratio in the constant moment zone (0.012). Cracking load, load carrying and deflection were monitored through the test. A nonlinear finite element software was implemented to simulate the experimental behaviour. Followed up by a parametric study. It was found that, in reinforced concrete beams, the tension stiffening depends on the concrete area in the tension zone not the reinforcement ratio. FEA predicts the reinforced concrete beams behaviour within a good agreement. Finally, the findings show that, determining variable amount of reinforcement ratio along the beam length will not sacrifice the flexural behaviour, but it will reduce the quantity of the steel reinforcement and the overall cost.