Search

In 2021 and 2022, virus-like symptoms were observed in several cultivars of industrial hemp (Cannabis sativa) in two fields in central Washington, USA. Affected plants had a range of symptoms at different developmental stages, with young plants having severe stunting with shortened internodes and reduced flower mass. Young leaves of infected plants also showed light green to total yellowing, and twirling with twisting margins (Fig. S1). Infections of older plants caused less foliar symptoms that consisted of mosaic, mottling, and mild chlorosis on a few branches with tacoing of older leaves. To assess if symptomatic hemp plants were infected with Beet curly top virus (BCTV) as reported earlier (Giladi et al., 2020; Chiginsky et al., 2021), symptomatic leaves were collected from 38 plants, and the extracted total nucleic acids tested by PCR to amplify a 496-base pair (bp) fragment specific to BCTV coat protein (CP) using primers BCTV2-F 5'-GTGGATCAATTTCCAG-ACAATTATC-3' and BCTV2-R 5'-CCCATAAGAGCCATATCA-AACTTC-3' (Strausbaugh et al. 2008). BCTV was found in 37 of the 38 plants. To further assess the virome of symptomatic hemp plants, total RNA was extracted from symptomatic leaves of four plants using Spectrum total RNA isolation kits (Sigma-Aldrich, St. Louis, MO) and subjected to high-throughput sequencing on an Illumina Novaseq platform in paired-end mode (University of Utah, Salt Lake City, UT). The raw reads (33 to 40 million per sample) were trimmed based on quality and ambiguity and resulting paired-end reads of ≈142 bp length were assembled de novo into a pool of contigs (CLC Genomics Workbench 21, Qiagen Inc.). Virus sequences were identified through BLASTn analysis in GenBank (https://www.ncbi.nlm.nih.gov/blast). One contig of 2,929 nucleotides (nt) obtained from one sample (accession no. OQ068391) showed 99.3% identity with BCTV-Wor strain reported from sugar beet in Idaho (accession no. KX867055 Strausbaugh et al., 2017). Another contig of 1,715 nt from a second sample (accession no. OQ068392) shared 97.3% identity with BCTV-CO strain (accession no. KX867022). Two contig sequences of 2,876 nt (accession no. OQ068388) and 1,399 nt (accession no. OQ068389) obtained from the 3rd and 4th samples showed 97.2% and 98.3% identity, respectively, with Citrus yellow vein-associated virus (CYVaV, accession no. MT893740.1) reported in industrial hemp from Colorado (Chiginsky et al., 2021). Contigs of 256 nt sequence (accession no. OQ068390) obtained from the 3rd and 4th samples also showed 99-100% identity with Hop Latent viroid (HLVd) sequences in GenBank (accessions OK143457 and X07397). These results indicated single infections of BCTV strains and co-infection of CYVaV and HLVd in individual plants. To confirm theagents, symptomatic leaves were collected from 28 randomly selected hemp plants and tested by PCR/RT-PCR using primers specific to BCTV (Strausbaugh et al., 2008), CYVaV (Kwon et al., 2021) and HLVd (Matoušek et al., 2001). Amplicons specific to BCTV (496 bp), CYVaV (658 bp) and HLVd (256 bp) were detected in 28, 25, and 2 samples, respectively. BCTV CP sequences obtained by Sanger sequencing from seven samples showed 100% sequence identity with BCTV-CO and BCTV-Wor strains in six and one samples, respectively. Similarly, sequences of CYVaV- and HLVd-specific amplicons showed 100% identity with corresponding sequences in GenBank. To the best of our knowledge, this is the first report of two strains of BCTV (BCTV-CO and BCTV-Wor), CYVaV, and HLVd infecting industrial hemp in Washington state.

More than 720,000 patients with end-stage renal disease in the United States require life-sustaining dialysis treatment. In this population of typically older patients with a high morbidity burden, hospitalization is frequent at a rate of about twice per patient-year. Aside from frequent hospitalizations, which is a major source of death risk, overall mortality in dialysis patients is higher than other comparable populations, including Medicare patients with cancer. Thus, understanding patient- and facility-level risk factors that jointly contribute to longitudinal hospitalizations and mortality is of interest. Towards this objective, we propose a novel methodology to jointly model hospitalization, a binary longitudinal outcome, and survival, based on multilevel data from the United States Renal Data System (USRDS), with repeated observations over time nested in patients and patients nested in dialysis facilities. In our approach, the outcomes are modeled through a common set of multilevel random effects. In order to accommodate the USRDS data structure, we depart from the literature on joint modeling of longitudinal and survival data by including multilevel random effects and multilevel covariates, at both the patient and facility levels. An approximate Expectation-Maximization algorithm is developed for estimation and inference where fully exponential Laplace approximations are utilized to address computational challenges.

Copyright of Österreichisches Religionspädagogisches Forum (ÖRF) is the property of Osterreichisches Religionspadagogisches Forum and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Revista CienciaUAT is the property of Universidad Autonoma de Tamaulipas and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

I discuss a published paper in political science that made a claim that aroused skepticism. The reanalysis is an example of how we, as consumers as well as producers of science, can engage with published work. This can be viewed as a sort of collaboration performed implicitly between the authors of a published paper and later researchers who want to understand or use the published work. [ABSTRACT FROM AUTHOR]

Pineapple (Ananas comosus) is a perennial economically important tropical fruit in Guangxi Province, China. Between September to November 2022, the rot of heart leaves of pineapple was found on 6.7 hectares of pineapple, NaLang village Jiangxi Town, Jiangnan District, Nanning City and on 200 hectare Liutian Village, Wangmao Town, Bobai County, Yulin City. The disease incidence of the investigated 10500 plants was from 20% to 30%. The basal heart leaves near the soil surface showed symptoms of water-soaked lesions and soft rot. The infected heart leaves were easily pulled out. As the disease developed, 800 plants of the investigated diseased plants collapsed and died. The diseased leaves from each district were surface-disinfected for 3 min with 1.0% hypochlorite solution, then rinsed three times in sterile water, and plated to carrot agar medium (CA media) (Luo et al. 2012). Inoculated dishes were incubated at 28°C in the dark. After 5 days, Eight mycelium colonies were recovered from diseased tissue. Colonies developing on CA exhibited white cottony mycelium which was aseptate. Numerous sporangia and chlamydospores were visible after 10-15 d later. The chlamydospores were spherical in shape and measured an average of 25.8 to 37.5 μm. The shape of the sporangia was papillate, oval or spherical, and 34.5 to 58.2 μm. These characteristics were consistent with the description of Phytophthora (Stamps et al. 1990). For molecular identification, the direct colony PCR method (Lu et al. 2012) was used to amplify the ITS of rDNA, β-tubulin (Tu), and elongation factor (EF) locus of the 2 strains NNPN1 from Nanning city and YLPN1 from Yulin city using the primer pairs of ITS4/ITS5, T1/T2 (O'Donnell et al. 1997) and EF1/EF2 (O'Donnell et al. 1998). The resulting sequences were deposited in GenBank (OR612028 and OR612029 for ITS; OR620158 and OR620159 for elongation factor; OR620160 and OR620161 for β-tubulin). BLAST searches with the three gene sequences revealed the greatest similarity with the sequences of some Phytophthora sp. The complete genome sequences of highly similar Phytophthora sp. were downloaded and the sequences of the corresponding 3 genes of each genome was extracted by Bioedit software. Phylogenetic trees were constructed in MEGA 11 using the maximum likelihood (ML) method based on the concatenated sequences of ITS, EF1α, and Tubulin (Figure 1). The 2 isolates grouped with P. nicotianae in the phylogenetic tree. The morphology and multi-gene phylogenetic analysis indicated that the new isolate was P. nicotianae. Tests of pathogenicity were performed according to Koch's postulates using the P. nicotianae strains NNPN1 and YLPN1. Fresh wounds were made symmetrically with a sterile needle on 2 tender basal leaves of pineapple plants (Bali variety) at the 8- to 10-leaf stage and each wound was covered with a piece of mycelium disc from each isolate. Control seedlings were inoculated identically except CA medium disc was used to cover the wound. Plants were placed in pots in a greenhouse at 28°C and 90% relative humidity. After 12 days, soft rot was observed clearly on the base of heart leaves of 9 inoculated plants, while the 9 control plants appeared normal. The pathogenicity tests were conducted three times with similar results. The strains were then reisolated from the infected plants and found to be Phytophthora sp. as those of the inoculum by morphology. P. nicotianae was previously reported as the causal agent of heart rot of pineapple in Guangdong and Hainan Province of China (Luo et al. 2012; Shen et al. 2013). To our knowledge, this is the first report of P. nicotianae on pineapple in Guangxi province in China. Identification of the pathogen of heart rot disease on pineapple is vital to reduce yield losses of the disease using effective control method.

Daylily (Hemerocallis citrina) is widely cultivated in China as vegetable and medicine. Its flower buds are nutritious vegetables rich in ascorbic acid, mineral elements and et al (Wang et al. 2024). Whereas, little is known about the pathogen identification in daylily. In April 2023, leaf spot symptoms were observed on 20% daylily seedlings in Dazhou city (30.91° N, 106.87° E), Sichuan province, China. The symptomatic leaves were superficially disinfected with 70% ethanol for 20 s, rinsed twice in sterile dH2O and subsequently disinfected with 1% NaClO for 40 s, and rinsed twice in sterile dH2O again. The disinfected leaves were cut into pieces (5 × 5 mm), placed on PDA amended with streptomycin sulfate (50 mg/L), and incubated in dark at 25 ℃ for two days. The fungal isolates, displaying morphological features of Fusarium species (Leslie and Summerell 2006), were purified through transferring single spores. Consequently, two distinct type fungal isolates were obtained. Cultured on PDA, Type Ⅰ (Q22, Q26, Q27) and Type Ⅱ (Q29, Q29-1) isolates showed similar growth phenotypes. Type Ⅰ and Ⅱ isolates' cultures were initially white but gradually became yellow, and scarlet diffusible pigments were produced with time (Fig. S1). On SNA medium, Type Ⅰ isolates produced macroconidia with 3 to 6 septa, which measured 5.56±0.54 × 48.65±6.12 µm (n = 50). While, Type Ⅱ isolates' macroconidia contained 3 to 11 septa that measured 4.08±0.93 × 51.40±12.83 µm (n = 50) (Fig. S1). All the isolates were properly preserved in our lab. To further identify these isolates, DNA fragments of Beta-tubulin (TUB2) (Glass and Donaldson 1995), translation elongation factor-1 alpha (TEF1) (Rehner and Buckley 2005), and DNA-directed RNA polymerase II largest (RPB1) (Hofstetter et al. 2007) and second largest subunit (RPB2) (O'Donnell et al. 2012) were amplified and sequenced. BLASTN analyses of TUB2 (PP266396 ~ PP266398), TEF1 (PP404039 ~ PP404041), RPB1 (PP404042 ~ PP404044) and RPB2 (PP408000 ~ PP408002) of Type Ⅰ isolates showed 99.35 ~ 100% identity to those of F. asiaticum NRRL 13818 (AF212745.1, MW233069.1, MW233240.1, JX171573.1). Type Ⅱ isolates' sequences (PP408003 ~ PP408010) showed their homology with those of F. meridionale NRRL 28436 (AF212730.1, MW233092.1, MW233263.1, MW233435.1) at 100% identity. The phylogenetic tree based on combined datasets of TUB2, TEF1, RPB1 and RPB2 of Fusarium species confirmed that Type Ⅰ and Ⅱ isolates were F. asiaticum and F. meridionale, respectively (Fig. S2). Seedlings of cultivar "chuanhuanghua No.1" (n = 5) in a greenhouse (25°C, relative humidity 90%) were inoculated with conidial suspension (3 × 105 conidia / mL). Controls were treated with sterile dH2O. Fifteen days post-inoculation, natural symptoms appeared on inoculated leaves (Fig. S3). Whereas, non-inoculated controls were disease-free. The pathogenicity assay was repeated three times. F. asiaticum and F. meridionale were successfully re-isolated from diseased leaves and verified using morphological and molecular methods described above, fulfilling Koch's postulates. F. ussurianum, a Fusarium graminearum species complex (FGSC) member, and F. proliferatum were identified as causal agents of leaf spot on daylily in China (Chen et al. 2024; Li et al. 2018). To our knowledge, this is the first report of F. asiaticum and F. meridionale causing leaf spot on daylily worldwide. Our studies demonstrate that FGSC members are the common pathogens causing leaf spot on daylily in Sichuan, China.

Fusarium dry rot is a ubiquitous disease of potato affecting tubers in storage and at planting. A greater understanding of the current Fusarium species composition associated with Fusarium dry rot in the Pacific Northwest (PNW) will aid in refinement of current management strategies. In this study, the identity of 327 single-spore Fusarium isolates recovered from PNW tuber samples was confirmed using molecular phylogenetic analyses based on partial sequences of tef and pho loci. Of the twenty species recovered, Fusarium sambucinum was the most prevalent (44.6%), followed by Fusarium oxysporum (13.8%). Selected isolates were tested for pathogenicity to potato tubers. Pathogenicity was confirmed for fourteen species of Fusarium, including seven species not previously reported as Fusarium dry rot pathogens in the region. On potato cv. 'Russet Burbank' (RB), inoculation with isolates of F. sambucinum resulted in the largest lesions (19.5-27.7 cm2), followed by isolates of F. avenaceum, F. cerealis, F. culmorum, F. flocciferum, F. graminearum, F. oxysporum, F. redolens, F. sporotrichioides, and F. venenatum (2.0-13.1 cm2). Inoculation with F. acuminatum, F. equiseti, F. solani, and F. stercicola resulted in the smallest lesions (0.1 to <2.0 cm2). An isolate of F. redolens caused lesions that were 5.7-fold larger on potato cv. 'Dark Red Norland' compared to those on RB (13.1 and 2.6 cm2, respectively), indicating variety selection may play a role in managing Fusarium dry rot. Diversity of Fusarium species pathogenic to potato in the PNW is greater than previously reported. Management strategies should consider potato variety, pathogen species, and isolate aggressiveness.

Italian ryegrass ( Lolium multiflorum ) is widely grown for forage in Southwest China. In December 2023, black leaf spots were observed on Italian ryegrass in a 10 hm 2 field in Hongya County, Sichuan Province, China (29°52'11''°N, 103°16'16''°E). The disease developed sporadically with an incidence rate of < 1%. Leaves showed typical symptoms of small, black spots. For isolation, six samples (about 0.5 cm × 1 cm) were cut with a sterilized blade at the junction of diseased and healthy tissues from two different plants. They were surface disinfected in 75% ethanol for 40s, rinsed thrice in sterilized distilled water, air-dried, plated on potato dextrose agar (PDA), and incubated in the dark at 25°C for 3-7 days. A Pestalotiopsis -like fungus with similar colony characteristics was consistently isolated from all samples. Pure cultures were obtained with the single-spore technique (Cai et al. 2009), and two strains (LJH17 and LJH18) were selected for further study. After 5 days in the dark at 25°C, colonies on PDA were cottony, whitish, 70-78 mm in diameter, with an entire edge. The reverse side of the colonies appeared white to light yellow. Conidia were fusoid, straight to slightly curved, 4-septate, with 2-4 (mostly 3) tubular apical appendages, measuring 17.3 to 25 × 6.1 to 9.9 μm (mean ± SD = 20.7 ± 2.3 × 7.9 ± 0.7 µm; n = 50; LJH17). For further identification, the internal transcribed spacer regions 1 and 2 and 5.8S nuclear ribosomal RNA (ITS), partial β-tubulin ( tub2 ) and translation elongation factor 1-α ( tef1 ) genes from the two pure strains GMCC000083 (=LJH17; GMCC, Grassland Microbiome Culture Collection) and LJH18 were amplified with the primer pairs ITS1/ITS4 (White et al. 1990), T1/Bt2b (Glass and Donaldson 1995; O'Donnell and Cigelnik 1997), and EF1-728F/EF2 (Carbone and Kohn 1999; O'Donnell et al. 1998). Sequences were deposited in GenBank (PP779763, PP781949, and PP781950 for LJH17; and PQ013725, PQ015095, and PQ015096 for LJH18). BLAST analysis showed 100% identity across all three segments with ex-type isolate LC4344 of Pestalotiopsis lushanensis (Liu et al. 2017). A randomized accelerated maximum likelihood (RAxML) phylogenetic tree based on concatenated ITS, tub2 , and tef1 alignments showed that our two strains clustered with the previously reported P. lushanensis strains ((Liu et al. 2017; Jiang et al. 2022) (Fig. S1F). Eight-week-old healthy plants were grown from Italian ryegrass seeds in pots, with three plants per pot. Following our previous spray inoculation procedures (Xue et al. 2020): fresh 5-day-old mycelia from each strain were prepared as mycelial suspensions at about 2.5 × 10 4 CFU/ml, and conidial suspensions were adjusted to about 2 × 10 5 conidia/ml. For each strain (LJH17 and LJH18), five pots were separately spray-inoculated with conidial and mycelial suspensions (about 2 ml/pot). Five pots served as non-inoculated controls were sprayed with sterilized distilled water. All pots were individually covered with transparent polyethylene bags for 5 days to maintain high relative humidity and placed in a greenhouse at 23-29°C. After incubation for 15 days, both conidial and mycelial suspensions produced black spots on the plants (Fig. S1), resembling those previously observed in the field. No symptoms were observed in the control plants. Pathogenicity tests were conducted thrice using the same method. The same fungus was reisolated from the lesions and confirmed via the morphological and molecular methods described above, thus fulfilling Koch' s postulates. To our knowledge, this is the first report of P. lushanensis causing black leaf spot on Italian ryegrass in China or worldwide. This finding may aid in diagnosing, identifying the pathogen, and controlling the disease on Italian ryegrass.

Citrus-associated rhabdovirus (CiaRV), putatively classified in the Cytorhabdovirus genus as a strain of Cytorhabdovirus caricae , was first reported in China in 2021. Budwood from an asymptomatic kumquat ( Citrus japonica Thunb.) collected in the Northern Territory, Australia in November 2021 a daughter tree was propagated from this budwood onto Carrizo citrange ( Citrus ×insitorum Mabb.) rootstock and grown in a controlled environment greenhouse at the Elizabeth Macarthur Agricultural Institute (EMAI). Green bark tissue (100 mg) was sampled from the daughter plant and total RNA was extracted using Invitrogen Trizol TM Reagent (ThermoFisher Scientific, Australia), with DNA removed using DNaseI (Bioline, Australia). The Ramaciotti Centre for Genomics (Sydney, Australia) completed library preparation using a Truseq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, California, United States) and high throughput sequencing using an Illumina NovaSeq6000 sequencing system resulting in 128,234,594 raw reads (2x150bp). The data was trimmed using BBduk (Bushnell 2017) and de novo assembled using rnaSPAdes (v3.15.5) (Bushmanova et al. 2019). The resulting contigs were analysed using a local NCBI ref&#95;viruses&#95;rep&#95;genomes BLAST database (downloaded 15 December 2023). There were eight contigs showing 95-99% identity to citrus leaf blotch virus (CLBV), family Betaflexiviridae (NC&#95;003877), and three contigs (length - 6646, 6044, 1144 nucleotides; coverage - 2043, 174, 214x, respectively) generated showed 80.6, 78.6 and 83% identity to C. caricae (NC&#95;055504). These contigs were analysed using the NCBI BLASTn database online and were 94.5% (MT302546), 90.7% (MT302546) and 94.7% (MT302545) identical to CiaRV isolates from China. Mapping of reads to MT302546 using Geneious Prime (Biomatters, New Zealand) resulted in a consensus sequence (PP998055) of a CiaRV genome with 92.8% identity to both MT302545 and MT302546 isolates. To confirm the presence of CiaRV in the sample, two primer sets, LF117/LR120 (Zhang et al. 2021) and CiaRV-F/CiaRV-R (Huang et al. 2023), were engaged to amplify regions of the L gene or nucleocapsid protein gene respectively. Bidirectional amplicon sequencing was followed by alignment using Geneious Prime (Biomatters) to the consensus sequence obtained by HTS, resulting in 100% identity. A further 176 citrus samples from Australia were tested by RT-PCR using the CiaRV-F/CiaRV-R primers that partially amplify the nucleoprotein (N) gene. Four trees (3 × kumquat, 1 × lemon ( Citrus ×limon (L.) Osbeck)) were found to contain CiaRV including a kumquat which was held at EMAI as a living control for CLBV for over 20 years. Bidirectional Sanger sequencing was completed for each of the four positive samples with >99% similarity of each to the original sample. CiaRV was first detected in citrus ( Citrus spp.), passionfruit ( Passiflora edulis Sims) and paper bush ( Edgeworthia chrysantha Lindl.) trees (Zhang et al. 2021) with no symptoms in infected citrus and foliar symptoms observed in the latter two hosts. The papaya virus E strain of C. caricae causes mild leaf vein clearing in Macroptilium lathyroides . When co-infected with cowpea severe mosaic virus (CPSMV), severe leaf mosaic is observed (Cornejo-Franco et al. 2022), noting that CPSMV causes mild leaf mottling in single infection of the host. The likely transmission of CiaRV by whitefly (Zhang et al. 2021), may result in the transmission of CiaRV to other hosts and possible mixed infections, increasing symptom severity. To our knowledge, this is the first report of CiaRV outside of China and it likely has been present in Australia for decades, possibly imported in budwood.

Amorphophallus konjac, commonly known as konjac, has significant economic and medicinal value, particularly in Asian countries (Gao et al. 2022). In July 2024, an outbreak of leaf blight was observed in a one-hectare field in Fuyuan (25.67°N; 104.25°E), Yunnan, China. The disease manifested as brown lesions starting at the leaf tips or edges, which rapidly darkened and expanded, leading to leaf necrosis. In severe cases, the disease affected the overall plant health, reducing corm yield and quality significantly. To isolate the causal agent, six diseased leaves from six plants were surface disinfected, and the junction region of healthy and diseased tissues was excised and homogenized in a 15-ml sterile centrifuge tube with 2 ml of sterile distilled water. The resulting bacterial suspension was serially diluted to 10-5 and 200 μl of the diluted sample was spread on LB agar plates. Three pure cultures (designated MY1, MY2, and MY3) were obtained through successive streaking. The isolated colonies were light yellow, convex, and nearly round in shape. Genomic DNA from the three pure isolates was extracted and used to amplify partial sequences of 16S ribosomal RNA (16S rRNA) with primers 27F/1492R (Brady et al. 2008), the beta-subunit of RNA polymerase (rpoB) using primers CM81-F/CM32b-R (Polz and Cavanaugh 1998), and the DNA gyrase subunit B (gyrB) with primers UP-1/UP-2r (Yamamoto and Harayama 1995). The sequences for 16S rRNA (accession nos. PQ288765-PQ288767), rpoB (PQ304887-PQ304889), and gyrB (PQ304884-PQ304886) were deposited in GenBank. Nucleotide BLAST analysis showed that the rpoB, gyrB and 16S rRNA sequences of isolate MY1 shared 99.36, 98.89 and 99.86% identity with those of K. cowanii strains (EU629168, CP107077 and OR121838), respectively. Furthermore, a multigene phylogenetic analysis revealed a strongly supported clade including strain MY1, MY2, MY3 and other K. cowanii isolates. To test pathogenicity, a greenhouse experiment was conducted using five four-month-old healthy A. konjac plants grown in pots. For each plant, three leaves were inoculated with a bacterial suspension of strain MY1 (108 CFU/ml) via leaf infiltration. Another set of three leaves were infiltrated with sterile water as controls. These plants were enclosed in plastic bags for 24 hours post-inoculation. Inoculated plants initially exhibited brown lesions with a yellow halo, which subsequently developed into dark symptoms within seven days. Control plants remained symptom-free. This experiment was repeated three times with consistent results. K. cowanii was reisolated from infected leaves and identified based on Sanger sequencing of 16S rRNA, thus fulfilling Koch's postulates. In recent years, K. cowanii has been confirmed to cause fruit blotch on Trichosanthis fructus (Chen et al. 2024), stalk rot in foxtail millet (Han et al. 2023), bacterial wilt on patchouli (Zhang et al. 2022), and bacterial blight on soybean (Krawczyk and Borodynko-Filas 2020). To our knowledge, this is the first report of K. cowanii causing leaf blight on A. konjac worldwide. This study identifies a previously unrecognized disease affecting konjac production. The identification of the causal agent provides essential information for the diagnosis and management of this disease.

More than 55% of U.S. lettuce (Lactuca sativa L.) production is in California, with Monterey Co. being the largest producer. Stunted mature romaine 'Valencia' and 'Stomper' and iceberg 'Frazier' lettuces with wilted outer leaves were collected from five commercial fields in Monterey Co. in spring 2023 and 2024. Brown internal stem and crown lesions progressed into sunken cavities and plant collapse. Incidence was approximately 5 to 75%. Margins of discolored stem and crown tissue were surface sterilized and plated on PARP-CMA (Jeffers and Martin 1986) and colonies resembling Phytophthora were recovered. Papillate sporangia ranged from 42 to 67.5 × 25 to 45 μm (avg. 56.1 × 37.0 μm, n = 30) and a length/breadth ratio of 1.4 to 1.7 (avg. 1.5). Globose, intercalary or terminal chlamydospores, 20 to 45 µm in diameter (avg. 32.6 µm, n = 30), and oospores, 17 to 29 μm in diameter (avg. 23.9 μm, n = 30) formed on 10 to 12-day-old cultures. Sequences from the two primary barcodes, ITS and COI (Robideau et al. 2011) were obtained from isolates collected from five different host cultivars and locations, finding identical multi-locus genotypes. ITS chromatograms contained six double-peaks, indicating interspecific hybridization. COI found the lettuce isolates forming a clade with the provisional P. taxon castitis, in Subclade 8b where hybrids are common (Bertier et al. 2013). If P. taxon castitis ITS is used as one parental ITS haplotype, the other haplotype is 1 bp different from P. lactucae and P. pseudolactucae ITS, suggesting one is the other parent of this hybrid taxon, provisionally introduced here as P. taxon ×salinaslettuce with accessions PQ427275-9 (ITS), and PQ424946-50 (COI). Pathogenicity assays were conducted on lettuce cultivars 'Bondi', 'El Guapo', and 'Valencia' (seven-week-old; 473-ml pots; 5 pots each for 'Bondi' and 'El Guapo', and 2 pots for 'Valencia'). Phytophthora inoculum of isolate 5411 was prepared as described in Hao et al. (2019) with oat seed replaced with long grain rice. Ten milliliter inoculum was added into two 6-cm-deep holes on opposite sides of the main stem. A non-colonized mixture was added to an equal number of control plants. All plants were maintained in a growth chamber with a 12-h photoperiod at 20°C/18°C. After one week, 'Bondi' and 'El Guapo' inoculated plants were stunted, and after two weeks, older leaves were chlorotic and wilted. After three weeks, 80% of the plants collapsed. Dark brown internal lesions were seen along the stem, crown, and tap roots of the collapsed plants after four weeks. 'Valencia' inoculated plants were stunted with no internal tissue discoloration observed over the same period. No symptoms were observed on any control plants; P. taxon ×salinaslettuce was reisolated and confirmed via ITS sequence from symptomatic stems, crowns, and tap roots of 'Bondi' and 'El Guapo', as well as non-symptomatic feeder roots of all three cultivars. No Phytophthora was recovered from the controls. This is the first report of P. taxon ×salinaslettuce detection on lettuce; P. taxon castitis has been isolated from strawberry and carrot in Sweden and Canada (Bertier et al. 2013), while P. lactucae and P. pseudolactucae have only been reported on lettuce in Greece and Japan (Elena et al. 2006; Rahman et al. 2015). Plans are underway to confirm the hybrid status and parentage of P. taxon ×salinaslettuce using genomics. This emerging pathogen may cause severe economic losses in CA lettuce production during the winter and spring growing seasons.

Agave potatorum Zucc., also known as "agave tobalá", is an endemic species in the Mexican states of Oaxaca and Puebla and is one of the most important wild species for producing the Mexican alcoholic distillate called mezcal. In September 2021, symptoms of dry stem rot and subsequent death of plants were observed, in a commercial field of 10 acres located in the municipality of Villa Sola de Vega, Oaxaca, Mexico. The disease incidence was 45%. Twenty symptomatic agave stem plants were sampled to isolate the pathogen. Pieces (5 × 5 mm) of the symptomatic tissues from diseased plants were surface disinfested with 1% NaOCl (60 s) and 70% ethanol (1 min), rinsed with sterile water (2 × 60 s), placed on potato dextrose agar (PDA Bioxon®, Mexico), and incubated at 25°C for 6 days with natural light. Next, we prepared single-spore derived cultures on PDA and carnation leaf-piece agar (CLA). Fusarium -like colonies were consistently isolated on potato dextrose agar (PDA) and 14 monoconidial isolates were obtained. On PDA, aerial mycelium was white to beige with diffuse pink pigment in the center of the culture and colonies were appressed with a regular shape after 7 days of incubation at 25℃. Macroconidia (n=100) were falcate, almost straight, 1 to 4-septate, 18.5 to 47.9 × 3.9-5.7 μm. Microconidia (n=100) were ellipsoidal to subcylindrical, slightly curved, hyaline, 8 to 16 × 3.5 to 4.5 μm, 0 to 1-septate, and grouped in false heads. Chlamydospores were globose to subglobose, terminal or intercalary in hyphae, and were solitary or in chains. Morphological features were consistent with the description of Neocosmospora spp. (Crous et al. 2021; Sandoval-Denis et al. 2019). Three isolates were selected for multilocus phylogenetic analysis and pathogenicity tests. Isolates were deposited as IPN-AP1, IPN-AP2, and IPN-AP3 in the Culture Collection of Phytopathogenic Fungi of Plant Pathology Laboratory of the CIIDIR-Oaxaca of the Instituto Politécnico Nacional. For molecular identification, genomic DNA was extracted, and partial sequences of translation elongation factor 1-alpha ( EF1-α ) and the second largest subunit of RNA polymerase II ( rpb2 ) genes were amplified and sequenced with the primer sets EF1-728F/EF1-986R (Carbone and Kohn 1999) and RBP2-5F/RPB2-7R (Liu et al. 1999), respectively. A phylogenetic tree using concatenated EF1-α and rpb2 sequences was constructed for Neocosmospora spp. based on Maximum Likelihood. The phylogenetic analysis suggested that the three isolates belong to a new species, closely related to N. noneumartii , as they formed a sister clade with this species. The sequences were deposited in GenBank with accession nos. OP902594 to OP902596 for EF1-α , and OP902591 to OP902593 for rpb2 . A pathogenicity test for each isolate was performed by inoculating five healthy A. potatorum plants (1-year-old) grown in pots. Conidia were cultured on PDA for 7 days and the conidial solution was prepared with sterile water and adjusted to 1×10 5 spores/ml. A total of 1 ml of the conidial suspension was placed on the basal stem of each plant. Five plants mock-inoculated with sterilize water served as the controls. All plants were kept in a greenhouse for 45 days at temperatures ranging from 20 to 30°C. At 35 days after inoculation, dry stem rot was visible on the inoculated plants, whereas the control plants remained asymptomatic. The pathogenicity test was repeated twice with similar results. The fungi were reisolated from the infected plants and found to be morphologically identical to the isolates used for inoculation, fulfilling Koch's postulates. Neocosmospora spp., has been previously associated with dry root rot in Citrus sinensis in South Africa (Guarnaccia et al. 2021) as well as rot of Cactaceae and other succulent plants in Iran (Kamali-Sarvestani et al. 2022). To our knowledge, this is the first report of Neocosmospora sp. causing stem rot of A. potatorum in Mexico and worldwide. Further studies should focus on determining the distribution, impact, and management of this disease in the production areas of agave tobalá in Mexico.

Studies on susceptibility of the age of the pruning wound and effect of pruning time on infection by Botryosphaeriaceae in apple trees is scarce. This work aimed to determine the susceptibility of different ages of pruning wound (1, 15, 30 or 45 days after pruning) and the effect of pruning time during early (June) and late pruning (August) in apples cvs. Fuji and Gala on the infection of Diplodia mutila, D. seriata, Neofusicoccum arbuti and Lasiodiplodia theobromae. Additionally, seasonal conidial release of Botryosphaeriaceae spp. was monitored using Vaseline-coated glass slides in two orchard cv. Fuji and Gala during two consecutive growing seasons (2020-2021) in Maule region, Central Chile. The analysis of the variance of each pruning wound age showed significant interaction between the factors, Botryosphaeria isolate × apple cultivar (P= 0.0001). The isolates of N. arbuti and D. seriata were significantly more aggressive than the other isolates of Botryosphaeria, with mean values of 45.2 mm (one day of age) to 7.9 mm (45 days of age) and 31.0 mm (one day of age) to 6.6 mm (45 days of age), respectively. Independently of the Botryosphaeriaceae species, the pruning wound susceptibility considerably decreased as the age of the pruning wound increased, where fresh pruning wounds (1 and 15 days) are more susceptible than older pruning wounds (30 and 45 days). Our results indicated significant (P < 0.0001) interaction between Botryosphaeria isolates and pruning time for both cultivars. Necrotic lesions varied among the Botryosphaeriaceae species, where lesion length was significantly greater in the isolates of N. arbuti, D. mutila, and D. seriata inoculated in early pruning than inoculations conducted in late pruning. This study demonstrated a strong relationship between conidial release and rainfall, where 70.3% and 86.3% of the total conidia of Botryosphaeriaceae spp. were released during rainfall periods between June and August (winter). This work suggests that a delay in pruning times may be justified to reduce the risk of Botryosphaeria canker and dieback in apple trees in Maule region, Chile, considering rain-free days.

Corn (Zea mays L.) is the top grain crop by hectares grown in Delaware (DE). Increased pre- and post-emergence damping-off in corn caused by Pythium species have been observed in recent seasons. To date, no characterization studies have been performed to understand Pythium species diversity in DE. Symptomatic corn seedlings were collected from 33 fields across DE in 2019 and 2020. Isolates were obtained from infected root tissues and identified by molecular sequencing. In total, 14 species were recovered: P. aristosporum, P. arrhenomanes, P. attrantheridium, P. catenulatum, P. dissotocum, P. graminicola, P. inflatum, P. irregulare, P. oligandrum, P. periplocum, P.spinosum, P. sylvaticum, P. tardicrescens, and P. torulosum. The dominant species recovered was P. graminicola, accounting for 66% of the isolates. Five species were screened for fungicide sensitivity to calculate the EC50 of mefenoxam, ethaboxam, and picarbutrazox which are the most commonly used active ingredients to manage species of Pythium in corn seed treatment packages. All species tested were sensitive to mefenoxam and picarbutrazox. For ethaboxam, P. torulosum was the only species with an EC50 value > 10 µg ml 1. Ten species were screened for fungicide sensitivity to mefenoxam, ethaboxam, or picarbutrazox at 18, 21, and 25ºC. As temperatures increased, percent inhibition was reduced in 40, 70, and 80% of the species screened for sensitivity to ethaboxam, picarbutrazox, and mefenoxam, respectively. Nine of these species were screened for isolate aggressiveness in greenhouse panels to examine impact on emergence, shoot height, shoot weight, and root weight. While all species were recovered from inoculated roots, P. arrhenomanes, P. attrantheridium, P. spinosum, and P. sylvaticum had the greatest root weight reduction.

Pine ghost canker is a recently described disease affecting multiple pine species in urban forests of Southern California. Symptoms include wedged cankers with irregular margins and cryptic discoloration on cross-sections of branches, which can lead to severe dieback and potentially tree death. In this study, we identified and characterized five Neofusicoccum species ( N. luteum , N. mediterraneum , N. parvum , N. stellenboschianum , and N. vitifusiforme ) as the primary etiological agents of pine ghost canker. These pathogens were consistently isolated from multiple symptomatic pine samples ( n = 41) and identified by morphology and phylogenetic analyses using four DNA barcodes (rDNA ITS, tef1 , tub2 , and rpb2 ). Pathogenicity was confirmed on healthy branches of 15-year-old Monterey pines, where the five Neofusicoccum species, caused vascular lesions that were not significantly different in length. Secondary fungi ( Diaporthe , Diplodia , Neopestalotiopsis , and Pestalotiopsis spp.) were also recovered from symptomatic tissues but did not cause vascular lesions in pathogenicity tests. The optimal temperature for mycelial growth of N. luteum and N. parvum was 30 °C, whereas for N. mediterraneum , N. stellenboschianum and N. vitifusiforme , it was 25 °C. All five species were able to resume growth at room temperature (20 °C) after showing no growth during a 7-day exposure to 5 °C and 40 °C. This study constitutes the first report of N. luteum , N. stellenboschianum , and N. vitifusiforme causing pine ghost canker in California. Environmental factors such as warmer temperatures, irrigation, and pest infestations are discussed as drivers of disease expression in pine trees. Management practices are also proposed.

Syrian rue (Peganum harmala L) belongs to the family Zygophyllaceae and is mainly distributed in arid and semi-arid areas of Xinjiang, Gansu, Ningxia, Qinghai, and Inner Mongolia in China. It serves as a pioneer species in soil and water conservation, as well as in reclamation of wastelands, playing a crucial role in soil preservation and stabilization against sand encroachment. In 2023, a disease resembling root rot and wilt affected the quality and yield of Syrian rue in Xilingol (122.67°N, 42.78°E), Inner Mongolia, China. Symptoms ranged from yellowing to wilting, accompanied by darkening of the xylem in the roots. This disease was observed in approximately 50% of Syrian rue plants in desertification-prone grassland. A total number of 45 symptomatic root samples were collected from Syrian rue plants to isolate the pahogen. Small pieces of diseased tissue were surface sterilized with 75% alcohol for five seconds, rinsed twice with sterilized water, dried, and then placed on water agar and incubated for 72 h at 25℃ in darkness. A total of 45 isolates were obtained, showing identical morphology and sequences of the internal transcribed spacer region (ITS), translation elongation factor 1-alpha (EF1-α) and RNA polymerase II second largest subunit (RPB2) genes. Therefore, the isolate LTP-5 was used as the representative for further study. On potato dextrose agar (PDA), fungal colonies of LTP-5 exhibited yellow to light brown colore with white aerial mycelia and irregular growth after 7 days of incubation at 25℃. Conidia and chlamydospre development were observed in carboxymethylcellulose sodium medium. Chlamydospores were abundant, terminal or intergrown between hyphae, rough brown walls of 5.9 to 19.82 μm in diameter (n = 75) were observed in the culture. Macroconidia had 5 to 7 septa, thick in the middle and thin at both ends, measured 28.17 to 62.81 μm in length and 1.50 to 4.19 μm in width (n = 128). Microconidia were absent. The morphological characteristics were consistent with the descriptions of Fusarium equiseti (Nelson et al., 1983). The pathogen was further confirmed to be F. equiseti by sequence analysis of the ITS, EF1-α and RPB2 genes amplified using polymerase chain reaction (PCR) with the primers ITS4/ITS5 (White et al., 1990), EF-1/EF-2 (O'Donnell et al., 1998), and RPB2-5F2 /fRPB2-7cR (Zhen et al., 2017). The sequences showed 100% similarity to the F. equiseti strain in the NCBI GenBank with accession numbers MH054914.1, KJ396323.1, and KT213286.1 for ITS, EF1-α, and RPB2, respectively. The sequences of PCR products were submitted to GenBank with accession numbers PP814863.1 (ITS), PP831628.1 (EF1-α) and PP826937.1 (RPB2). Pathogenicity tests were conducted through a pot assay. Five Syrian rue seedlings were inoculated by immersing plant roots in a suspension of 1×107 spores/mL for 30 min and transplanting to pots containing autoclaved soil. Control plants were immersed in sterile water. The inoculated plants showed yellow and root rot but no symptoms were observed on control plants. The same fungus was successfully re-isolated and identified based on the morphological characterization and sequence analyses from the infected root tissue but not from non-inoculated plants. In addition, F. equiseti has been reported to cause disease on Sugar beet (Khan et al., 2021), Watermelon (Rahman et al., 2021), potato (Cui et al., 2021), and other plants. This is the first report confirming F. equiseti as causal agent of Syrian rue wilt and root rot in China.

The purple stem mustards (Brassica rapa subsp. chinensis var. purpuraria) (Govaerts R, 2003) are widely cultivated along Yangtze River Valley in China, which is famous for its flavorful and nutritious edible stalks (Wang et al., 2022). In February 2023, a disease of soft rot was observed in multiple purple stem mustards planting fields in Wuhan city, Hubei province, China (30.41°N, 114.22°E). Disease incidence rates were almost 20 to 30% in the planting area (5 ha in size), causing severe economic loss. Infected plants displayed water-soaked symptoms at the base of the petioles, emitting a foul soft rot odor. The severely infected petioles, stems and roots exhibit pus symptoms leading to plant death. To identify the causal agent, small pieces of soft rot symptomatic tissue were cut from the margin of necrotic lesions and surface disinfected with 75% (v/v) ethanol for 30 seconds, followed by three successive rinses with sterile distilled water. The exudates from the clipped tissues were serially diluted and then incubated onto nutrient agar (NA) plates to obtain purified strains at 28°C for 48 hours (Koike et al., 2002). After incubation, 15 strains were obtained and the colonies of all strains were Gram-negative, aerobic, small, round, convex, whitish to dull white, and had smooth slimy edges. Three single bacterial strains CT020801 - CT020803, which were individually isolated from three different diseased samples, were selected as representative strains for further study. Biochemical tests using the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA) revealed that these strains were positive for methyl red, pectin, dextrin, D-Cellobiose, β-galactosidase, citrate, and maltose, but negative for indole, arginine dihydrolase, urease, ornithine decarboxylase, and gelatinase tests. The 16S ribosomal RNA gene and the three housekeeping genes, atpD, rpoB, and recN were amplified using genomic DNA of Lelliottia amnigena NCTC12124T as the template, with specially designed primers. All amplified fragments were sequenced and deposited in GenBank with accession numbers OQ954706-OQ954707, OQ954713, and OQ953873-OQ953881. BLAST alignments of the 16S rRNA, atpD, rpoB and recN sequences revealed that the sequences of Strain CT020801-03 exhibited the highest identity (100%, ≥97.97%, ≥98.85% and ≥94.52%, respectively) with L. amnigena （Figure S2）. Phylogenetic tree analysis based on multilocus sequence joint 16S rRNA - atpD - rpoB - recN revealed that CT020801 - CT020803 and L. amnigena clustered together in the same clade (Carrie et al., 2013). These results were consistent with those reported for Lelliottia amnigena (Osei et al., 2022). To confirm pathogenicity, healthy base petioles of three-week-old purple stem mustards seedlings were stab inoculated with 20 μL bacterial suspensions (approximately 108 CFU/mL) and then incubated at 28°C and 80% relative humidity in a growth chamber. A sterile liquid NB medium served as the negative control. The test was repeated thrice with each test consisting of five seedlings per treatment. After three days, soft rot symptoms appeared on the stem bases of the inoculated plants, consistent with the initial symptoms observed in the field. Control plants showed no symptoms. The strains were successfully re-isolated from symptomatic plants and identified as L. amnigena, fulfilling Koch's postulates. L. amnigena, a member of the Enterobacter genus (Birlutiu et al., 2023; Brady et al., 2013; Izard et al., 1981), is commonly found in soil and has been identified as an opportunistic pathogen responsible for plant soft rot disease (Reyes-García et al., 2020; Schroeder et al., 2009; Wu et al., 2023). Previous studies have linked L. amnigena to soft rot disease in potato tubers in China. However, this study marks the first documented case of L. amnigena causing soft rot disease in purple stem mustards in China. This discovery expands the known host range of the pathogenic bacteria and will help to provide essential information for making effective measures to manage this disease.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

Sunflower is a short-season crop of the Asteraceae family and the Helianthus genus and is the fourth most important oilseed crop in the world. During a field campaign, unusual symptoms (necrosis and longitudinal cracking of the petiole) were observed in a sunflower crop grown in the region of Kavarna (Dobrich district, Bulgaria) and strains of the genus Xanthomonas were isolated. Results based on phylogenetic and phylogenomic analyses showed that they clustered with Xanthomonas euroxanthea CPBF 424T species, a pathogenic strain isolated from walnut buds in Portugal and responsible for causing walnut bacterial blight (WBB). The sunflower strain showed five out of eight X. euroxanthea-specific markers (XEA4-XEA8), a pattern also observed in some strains isolated from Solanum lycopersicum, Phaseolus vulgaris and rainwater sources, reinforcing the emergence of a recent lineage-driven by evolutionary adaptations to new plant hosts. This is the first report of X. euroxanthea in sunflower crops in Bulgaria, which represents a potential threat to production and its distribution should be monitored.

Lettuce (Lactuca sativa) is a leafy vegetable that belongs to the family Asteraceae. This cool-season crop grows well during Spring and Fall in China (Qi et al., 2021). In October 2023, a leaf disease with dark brown to black lesions was observed on lettuce (var. iceberg) in Yongning Town, Yanqing District, Beijing, China (40°53'N, 116°16'E). The disease incidence ranged from 10 to 40% in the surveyed greenhouse and field. Translucent and water-soaked brown spots were observed on the margins of leaf, then coalesced into large necrotic lesions surrounded by a chlorotic halo. Infected sections were soaked with 75% ethyl alcohol for 7 second, rinsed with sterile water for 15 second twice, and cut into pieces in the sterile water. The sample extracts were streaked on Nutrient agar medium. After incubation for 48 hours, 12 colonies were obtained and all the colonies were Gram-negative and aerobic with yellow, round-shape, smooth and glistening appearance. Four isolates SCZX1-SCZX4 with typical characteristics were selected for further identification tests. Pathogenicity test of SCZX1-SCZX4 was performed on the three-week-old lettuce (var. butterhead) by spraying with the bacterial suspension (108 CFU·ml-1). Inoculated lettuce were incubated at 26℃ and 70% relative humidity in the growth chamber. Another set of lettuce plants were mock inoculated with sterile distilled water. Three trials were carried out per isolate, and each treatment included fifteen lettuce plants. Symptoms appeared within 7-10 days after inoculation and are identical to those naturally infected lettuces. Negative control plants had no symptoms. The 16S rRNA region and two housekeeping genes (gyrB and atpD) of each isolate were amplified with universal primers F27/R1492 (Monciardini et al., 2006) and specific primers (Roach et al., 2018), respectively. According to BLAST analysis of each isolate (Genbank accession number PP027925, PP140779, PP140781 to PP140783, PP137422 to PP137428), BLAST searches of the obtained sequences revealed 100.0% of 16S rRNA region(1400/1400 nucleotides), 100.0% of gyrB(774/774 nucleotides), and 100.0% of atpD(768/768 nucleotides) identity and query coverage to Xhv CFBP 498 (Genbank accession number LR828257.1). Phylogenetic analysis revealed that SCZX1-SCZX4 clustered with the neopathotype strain Xhv LMG 938PT, which was isolated from a diseased L. sativa in Zimbabwe (Timilsina, S et al., 2015). Physiological and biochemical tests of SCZX1-SCZX4 were conducted by the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA), and the test results are consistent with the Xhv LMG 938PT (Morinière, L et al., 2020) and L1-L7 (Pernezny, K et al., 1995). Strains were re-isolated from re-inoculated lettuce, then re-identified as Xhv by the same method, fulfilling Koch's postulates. Bacterial leaf spot (BLS) is a worldwide-spread lettuce disease caused by numerous bacterial pathogens, including Xhv (Dia, N.C et al., 2022), Pseudomonas cichorii (Patel, N et al., 2021) and P. viridiflava (Alippi, A. M et al., 1999) etc. Xhv had been widely reported as the causal pathogen of BLS in Turkey (Sahin, F et al., 2000), United States (Bull, C.T et al., 2007), Saudi Arabia (Al-Saleh, M et al., 2008), and France (Morinière et al., 2020). However, the first report of Xhv causing BLS on lettuce in China is significant to provide pathogen information for growers in making effective measures to manage this disease.

Symphyotrichum subulatum (Michx.) G. L. Nesom (syn. Aster subulatus), an annual herb in the Asteraceae family, is native to North America. Nowadays, it has become an invasive weed in several provinces of China, including Jiangsu, Zhejiang, and Sichuan (Li and Xie, 2002). Despite being invasive, this species holds significance in Chinese medicine, where it is used for the external treatment of eczema and swollen sore poison (Hu, 2020). In June 2023, symptoms of powdery mildew were observed in S. subulatum populations in Deyang and Nanchong, Sichuan Province, China. About 32.73% among 55 surveyed S. subulatum plants showed signs of infection. Symptoms initially appeared as small, scattered white powdery patches on the leaves, which enlarged and coalesced over time. Subsequently, hyphal growth forming extensive conidia covered up to 90% of the leaf area on both surfaces (Fig. S1A, B), and the infected leaves withered and fell off (Fig. S1A). A specimen was archived at China West Normal University (SsPM-ZL). Conidiophores were cylindrical and erect, 66.4 to 183.2 µm (avg. 108.2±40.8 μm) in length (n=30) (Fig. S1C). Conidia, produced singly, were ellipsoid-ovoid to nearly cylindrical, measuring 29.5 to 36.7 μm in length (avg. 32.9±2.6 μm) and 16.0 to 19.9 μm in width (avg. 17.4±1.3 μm), lacking distinct fibrosin bodies (n=30) (Fig. S1D). Under a scanning electron microscope, turgid conidia displayed reticulate wrinkles on the surface, with gentle contractions or bulges at both poles (Fig. S1E, F). Based on these characteristics, the powdery mildew fungus was consistent with the genus Golovinomyces (Bradshaw et al. 2022a). To confirm the identity of the causal fungus of specimen (SsPM-ZL), the calmodulin (CAM), RNA polymerase II subunit (RPB2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glutamine synthetase (GS), and the internal transcribed spacer (ITS) were amplified using PMCAMF/R, PMRPB2F/R, PMGAPDH1/3R, PMGSF/R, and PM5/ITS4 primers (Bradshaw et al. 2022b), and deposited in GenBank (CAM: OR761878; RPB2: OR761881; GAPDH: OR761879; GS: OR761880; ITS: OR758452). BLAST analysis showed 99 to 100% identity with the sequences of Golovinomyces ambrosiae (FH00941234) for CAM (ON101658, 99.65%), RPB2 (ON119165, 100%), GS (ON075690, 99.78%), and ITS (ON073876, 99.47%). Phylogenetic analysis was performed in MEGAX with maximum likelihood method (Kumar et al. 2016) and clustered SsPM-ZL into the G. ambrosiae clade with a 100% bootstrap support value based on the concatenated sequences of CAM, RPB2, GAPDH, GS and ITS (Fig. S2). Combining morphological and phylogenetic analyses, SsPM-ZL was identified as Golovinomyces ambrosiae. To evaluate pathogenicity, leaves of 3 healthy potted S. subulatum plants (3 leaves per plant) were inoculated by gently pressing them with diseased leaves, while 3 non-contact plants were used as control. Plants in two groups were incubated in separate greenhouses maintained at 27±1°C, with a photoperiod of 14 hours and a relative humidity of 80%. After 7 days, the inoculated plants exhibited symptoms of powdery mildew (Fig. S1H, J), while the control plants remained asymptomatic (Fig. S1G, I). Morphological characteristics of the artificially induced powdery mildew were consistent with those on naturally infected plants. Powdery mildew caused by G. ambrosiae has been reported affecting Helianthus tuberosus (Huang et al. 2017) and Bidens pilosa (Mukhtar et al. 2022) in China. To our knowledge, this is the first report of powdery mildew caused by G. ambrosiae on S. subulatum in China. Our finding will provide the fundamental knowledge for future powdery mildew diagnosis and the development of potential control strategies.

In recent years, increasingly stringent pesticide regulations have made the development of new chemistries challenging. Under these regulations, the new fungicide ipflufenoquin (FRAC Code 52) was first released in Japan. Its mode of action is new; it inhibits dihydroorotate dehydrogenase (DHODH), a key enzyme in the biosynthesis of pyrimidine-based nucleotides. However, because it is a single-site inhibitor, the risk of resistance developing in pathogens must be carefully considered. The risk for dual use of DHODH inhibitors in agriculture and medicine has also become a great concern because a new antifungal olorofim is under development against human pathogens now and cross-resistance has recently been reported between ipflufenoquin and olorofim in Aspergillus fumigatus . In this study, the sensitivity to ipflufenoquin was examined in culture and in plants using "baseline" isolates, which had never been exposed to DHODH inhibitors. Isolates of Alternaria alternata , Botrytis cinerea , B. elliptica , Colletotrichum fioriniae , C. fructicola , C. nymphaeae , C. orbiculare , C. siamense , C. tropicale , C. truncatum , and Sclerotinia sclerotiorum were highly sensitive to ipflufenoquin in culture, but isolates of Coniella vitis , Corynespora cassiicola , Pseudocercospora fuligena , and Rhizoctonia solani were inherently resistant. Ipflufenoquin had low efficacy against C. cassiicola and C. vitis after inoculation of cucumber and grapevine leaves, respectively. To understand the mechanism of natural resistance, we analyzed the partial sequence of pyrE genes, which encode the DHODH enzyme, but did not find any differences in the deduced amino acids that were thought to be associated with resistance. Thus, mechanisms other than target-site mutations might be involved in the intrinsic resistance.

Trapa natans L., or water chestnut, is a currently globally distributed aquatic plant. The Yangtze River basin in China, a site origin of water chestnut (Fan et al., 2022), has extensive cultivation as a vegetable. In June 2021, a survey at the National Aquatic Vegetable Resource Garden in Wuhan, Hubei, China, revealed browning and wilting of water chestnut plants, with abundant white mycelia and brown to black sclerotia on leaves, indicative of southern blight ( Sclerotium rolfsii ). Field disease incidence a 1 ha area reached 70%, reducing fruit yield by 50%. About 10% of diseased plants showed blackening and rot from petioles to leaves. White sclerotial primordia and small brown to black sclerotia formed on the plant surfaces. By late August, symptoms exceeded 60%. To identify the pathogen, isolations were made from 243 sclerotial samples using 75% alcohol to disinfect, rinsed three times with water, and then incubated on potato dextrose agar (PDA) at 25℃. A total of 129 isolates were obtained, most of which exhibited characteristics of S. rolfsii . However, 21 isolates had sclerotia significantly smaller than those of S. rolfsii (1 to 1.5 mm in diameter). These isolates, cultured on PDA, produced abundant fluffy white aerial hyphae, 3 to 6 μm wide. Optimal mycelium growth was between 25 °C to 30 °C, with an average daily rate of 10 mm. White to light brown sclerotia appeared after 5 days and turned black within 10 to 14 days, averaging 0.34 mm in diameter (n=50). Some isolates produced a light brown pigment. These traits matched the description of S. hydrophilum (Bashyal et al. 2021). Isolates 221 and 238 were selected for molecular identification, with genomic DNA extracted from mycelia using the CTAB method. PCR amplification was conducted using ITS1/ITS4 and NS1/NS6 primers to target the internal transcribed spacer (ITS) and the small subunit ribosomal RNA gene (ssrRNA). Sequence analysis showed that the ITS sequence of isolate 221 (GenBank Acc. No. OR512512) had 99.84% sequence identity with S. hydrophilum Msh6 (GenBank Acc. No. FJ595946), and isolate 238 (GenBank Acc. No. PP035993) had 99.72% identity with S. hydrophilum Whcc-4 (GenBank Acc. No. PP035994). The ssrRNA sequences of both isolates (GenBank Acc. No. PP237261) had 99.69% identity with S. hydrophilum strain Hbq001 (GenBank Acc. No. KY995575), confirming their identification as S. hydrophilum . To assess pathogenicity, 16 water chestnut plants (cultivar Jia-yu Ling) at the rosette stage were placed individually in 32 cm diameter, 10 cm deep containers with fresh water. Eight plants were inoculated with 50 mature sclerotia from PDA cultures of isolates 221 and 238, and incubated at 25 °C for 14 days, with four plants per isolate. The remaining eight plants served as controls. Containers were covered to maintain 100% relative humidity at 25 °C to 32 °C for 3 days. This procedure was repeated twice. After 7 days, inoculated plants developed dark brown lesions on petioles that spread to leaves by 15 days post-inoculation. Fungi isolated from diseased leaves resembled isolates 221 and 238, fulfilling Koch's postulates. S. hydrophilum infecting at least 19 genera of plants, including rice (Zhong et al. 2018), wild rice, water lily (Kernkamp et al. 1977) and watershield (Fu et al. 2024). This is the first report of S. hydrophilum infecting water chestnut ( T. natans ) in central China, identifying it as a co-pathogen with S. rolfsii . Their combined presence may heighten plant mortality and threaten water chestnut cultivation.

Geotrichum candidum Link (1809) is a yeast-like fungus that causes sour rot of peach (Prunus persica). Outbreaks of the disease have occurred since 2021 in peach fruit kept in cold storage despite post-harvest treatments with propiconazole at a commercial farm in South Carolina (SC). A total of 58 isolates, 40 from symptomatic fruit from cold storage in Saluda County (SC packing house isolates), 11 from three SC orchards in Saluda County, Spartanburg County, and Pickens County (SC non-packing house isolates), and 7 California (CA) isolates (at least 3 from packing houses) were evaluated for propiconazole sensitivity. Mycelial growth assays revealed that 6 of 7 CA isolates had the lowest EC50 values and were considered sensitive (S) to propiconazole with an average EC50 value of 0.02 µg/ml and minimum inhibitory concentration (MIC) values >1 to < 3 µg/ml. Isolate 02J018 from CA and all SC non packing house isolates were considered reduced-sensitive (RS) to propiconazole with an average EC50 value of 0.33 µg/ml and MIC values >10 to <30 µg/ml. SC packing house isolates were considered resistant (R) to propiconazole and had an average EC50 value of 3.55 µg/ml and MIC values >300 µg/ml. Two CYP51 genes, GcCYP51A and GcCYP51B, encoding two demethylase inhibitor (DMI) target enzyme 14α-demethylases were identified, sequenced, and characterized. Two GcCYP51A and three GcCYP51B variants were found. While both GcCYP51A variants were linked to S isolates, the GcCYP51B2 variant possessing the mutation Y143F was found in RS, and the GcCYP51B3 variant possessing Y143F, E126K, and G460S mutations was identified in R isolates. The Y143F and G460S mutations had been associated with DMI fungicide resistance in other plant pathogens. No increased constitutive expression of GcCYP51A or GcCYP51B was observed in RS or R isolates. Detached fruit assays revealed that label rates of propiconazole controlled sour rot caused by S and RS but not R isolates. Our results suggest that sour rot outbreaks in a SC packing house were linked to target gene-induced propiconazole resistance in G. candidum.

Since 1971, North Carolina (NC) has been the leading sweetpotato-producing state in the United States (US) and is now producing more than half of the nation's annual output. Due to the high demand for US sweetpotatoes from international markets, NC allocates roughly 40% of its sweetpotatoes for export. However, low fungicide residue limits in primary export markets restricts the ability for NC producers to apply fungicides for disease management during sweetpotato production. Agroathelia rolfsii, the causal agent of southern blight and circular spot, is an important pathogen of sweetpotato. Field experiments were conducted in 2022 and 2023 to quantify the residue amount of various active ingredients and transplant-only vs. bedding and transplant applications when managing A. rolfsii in the field. High-performance liquid chromatography analyses of root and vine samples confirmed that none of the tested active ingredients and application timings resulted in residue numbers exceeding the limits of export markets, except for roots treated with thiabendazole. Results from this study provide information for development of application practices with acceptable residue levels for export markets while effectively managing diseases caused by A. rolfsii.

Jiaotou (Allium chinense G. Don) is a culinary and aromatic herb belonging to the family Amaryllidaceae. It is native to China and cultivated for its culinary uses in many other countries, which also possess high medicinal value in traditional Chinese medicine (Rhetso et al. 2020). In March 2023, a disease resembling anthracnose was detected in the fields of Changde city, Hunan Province, China. The symptoms manifested as yellow to brown necrotic spots located at the tip or middle of the blade. The lesions tended to wrinkle, leading to leaf distortion, thinning, and wilting. This disease has a high incidence rate of approximately 50% in an area of nearly 20 hectares. Ten symptomatic plants were collected for pathogen isolation. The leaf tissues were surface sterilized using 70% ethyl alcohol and 2% sodium hypochlorite, rinsed with sterile distilled water, and then transferred to potato dextrose agar (PDA) and incubated at 26°C in the dark. Ten colonies with similar cultural morphology were selected from the 10 affected plant samples. The fungal strains produced densely aerial mycelium on PDA, displaying off-white to gray-brown coloration. Conidia were hyaline, curved or slightly curved, aseptate, with a rounded apex and truncate base, contained oil globules, and measuring 21.0 to 29.0 × 4.1 to 5.3 μm (n = 50. Appressoria were dark brown, irregular in shape, partially lobed, and measured 6.5 to 15.5 µm long × 5.0 to 10.5 µm wide. Setae were straight, dark brown, with two- to three-septate, 78.5 to 155.4 μm long (n = 50). These morphological characteristics were similar to Colletotrichum spaethianum (Damm et al. 2009). The internal transcribed spacer (ITS) region of rDNA, actin (ACT), chitin synthase (CHS-1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes of three representative strains, JT-1, JT-2 and JT-3, were amplified and sequenced as described in Weir et al. (2012). These sequences were 99 to 100% identical to corresponding sequences of C. spaethianum strains (565/569 bp, MN396364.1 for ITS; 565/569 bp, MN433299.1 for ACT; 262/263 bp, MN433298.1 for GAPDH; 272/272 bp, MH020773 for CHS-1, respectively) (Zhong et al. 2020; Liu et al. 2020; Sun et al. 2020). A concatenated phylogenetic tree showed that all three strains were clustered within the C. spaethianum clade. The sequences of isolate JT-1 were deposited in GenBank (accession nos. PP911453, PP911607, PP911605, and PP911606 for ITS, ACT, GAPDH and CHS-1, respectively). For pathogenicity assays, 1-month-old seedings of A. chinense in plots were inoculated by spraying with a conidial suspension (1 × 105 conidia/ml) until runoff. Control plants were sprayed with sterilized water. All the inoculated plants were kept in a greenhouse at 25°C with a 12-h/12-h light/dark cycle. The experiment was conducted twice with three replications each. After 7 days, symptoms similar to those observed in the field developed on leaves of the inoculated plants, whereas the control plants remained asymptomatic C. spaethianum was specifically reisolated and identified from the symptomatic leaves, thus fulfilling Koch's postulates. Colletotrichum spaethianum has been recorded as a pathogen fungus on many medicinal plants, such as Peucedanum praeruptorum (Guo et al. 2013), Anemarrhena asphodeloides (Okorley et al. 2019), and Paris polyphylla (Zhong et al. 2020). To our knowledge, this is the first report of C. spaethianum causing anthracnose on Jiaotou in China. Effective control measures should be implemented to mitigate potential further damage to Jiaotou cultivation.

Fludioxonil and propiconazole are frequently used fungicides for managing fungal diseases in specialty crops. They are often used in mixture to manage brown rot caused by Monilinia fructicola and sour rot caused by the yeast-like fungus Geotrichum candidum,respectively, on stone fruits. Research indicated, however, that fludioxonil can increase the expression of the ATP-binding cassette transporters CDR1 and CDR2 in the yeast Candida albicans, leading to increased resistance to DMI fungicides. In this study, mycelial growth assays and detached fruit assays were conducted with G. candidum isolates of varying sensitivity to propiconazole to investigate potential antagonism between the two active ingredients. Isolates sensitive, reduced-sensitive, and resistant to propiconazole were able to grow with or without 20 µg/ml fludioxonil on PDA containing up to 0, 3, and 30 μg/ml propiconazole and on water agar containing up to 7.5, 7.5, and 30 μg/ml propiconazole, respectively, and no antagonistic interactions were detected. Propiconazole controlled disease with or without 20 µg/ml fludioxonil equally on detached cherry fruit caused by isolates with different DMI sensitivity phenotypes. Our results indicated no detectable antagonism between fludioxonil and propiconazole that would interfere with the mixture's ability to manage sour rot of cherry.

High levels of sour rot on propiconazole-treated lemon fruit that were stored for extended times in some California packinghouses in 2020 and 2021 initiated surveys on fungicide sensitivity of the causal pathogen. In isolations from diseased fruit in 2020 to 2023, 157 isolates of Geotrichum spp. were obtained. Using species-specific primers, 143 were determined to be G. citri-aurantii and 15 were G. candidum. Isolates of G. citri-aurantii were either sensitive (EC50 0.06 to 0.34 μg/ml), moderately resistant (EC50 1.20 to 2.34 μg/ml), or highly resistant (EC50 >17.68 μg/ml) to propiconazole. There was incomplete cross resistance to cyproconazole, another demethylation inhibitor fungicide pending postharvest registration on citrus in the United States: isolates sensitive to propiconazole were sensitive, isolates moderately resistant to propiconazole were sensitive, and isolates highly resistant were moderately resistant to cyproconazole (EC50 0.11 to 0.63 μg/ml, 0.19 to 0.73 μg/ml, and 2.66 to 6.79 μg/ml, respectively). All except one isolate of G. candidum were highly resistant to both fungicides (EC50 >9.55). Isolates of both species were all considered sensitive to natamycin (EC50 1.18 to 5.01 μg/ml). In lemon fruit inoculations with G. candidum, the incidence of typical sour rot increased from 4.7% to 68.2% when inoculum was amended 2 µg/ml or 100 µg/ml cycloheximide, respectively, a compound known to suppress host defenses. In co-inoculations with 1:1 mixtures of the two Geotrichum spp., G. candidum was only recovered from the centers of decay lesions, whereas G. citri-aurantii was also obtained from the advancing margins. We conclude that G. candidum is a secondary pathogen of lemons, and its presence was favored by extended late-season storage of senescent fruit with reduced defense mechanisms.

Sugarcane (Saccharum officinarum L.) is the most important sugar crop that belongs to the Poaceae family and is mainly cultivated in tropical and subtropical regions worldwide. Brown stripe disease is a common and serious foliar fungal disease of sugarcane and has become a serious threat to sugarcane production in China. Yunnan Province is the second-largest sugar base in China. From 2022 to 2023, brown stripe-like symptoms from different sugarcane variety were observed in Yunnan. Thirty-nine Bipolaris-like isolates were obtained from symptomatic leaves of different sugarcane varieties and characterized by means of morphological identification combined with multilocus phylogeny comprising internal transcribed spacer rDNA (ITS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the translation elongation factor-1α (TEF-1α) gene sequence date. The analysis provided strong support for the delineation and identification of two Bipolaris species associated with sugarcane brown stripe, including Bipolaris secalis and B. setariae. Pathogenicity text in potted sugarcane plants confirmed that these two Bipolaris species can cause brown stripe of sugarcane, thus fulfilling Koch's postulates. This study confirmed that B. secalis and B. setariae were the pathogens of brown stripe in Yunnan Province. To the best of our knowledge, this is the first to report B. secalis as causal agents of brown stripe of sugarcane. Collectively, this finding provides a basis for sugarcane brown stripe disease accurate diagnosis and would be helpful to the development of effective management strategies.

Black oat ( Avena strigosa Schreb.) is used as a cereal crop, forage crop or green manure in temperate regions. In Japan, it is mainly cultivated in Hokkaido island and, because of the vigorous initial growth and ability to suppress the proliferation of plant pathogenic nematodes (Uesugi et al. 2018), its use is recently increasing. In November 2021, a leaf spot and blight disease was observed in the grass cultivated in Kitahiroshima city (N43°0, E141°31). At first, blackish brown spindle-shaped or elliptical lesions, about 3 to 5 × 1 to 2 mm were formed on leaves, and they expanded by forming yellowish-brown halos around them, eventually resulting in leaf blight later on (Fig.1), damaging 5-10 % of leaf area, varied by cultivar. The lesions were excised, surface-sterilized, and incubated on water agar under near-UV light. Three single-spore isolates of Pyrenophora -like fungus were obtained from the lesions and deposited at the NIAS Genebank, Japan (https://www.gene.affrc.go.jp/index&#95;en.php) as MAFF511692, 511693 and 511694. The sequences of ribosomal RNA gene (rDNA) and its internal transcribed spacer (ITS), and the gpd sequences of the isolates were analyzed as described by Marin-Felix et al. 2019. The rDNA-ITS sequences (GenBank accession no. LC769170, LC769171 and LC769172) of the isolates matched with that of the ex-type strain of Pyrenophora avenicola (MK539972) isolated from Avena seed. The sequences of the gpd (accession no. LC795722, LC795723 and LC795724) matched well with that of the ex-type strain (MK540180). Conidiophores of the isolates were septate, straight or flexuous, pale brown to olivaceous brown, 81.4 to 125.7 × 4.2 to 6.5 (ave. 106.4×5.7µm, n=50) µm, with hyaline vegetative hyphae (Fig.2). Conidia were slightly verrucose, cylindrical to obclavate, pale brown to olivaceous brown, 42.2 to 78.5 × 9.0 to 13.3 µm (ave. 56.9 ×10.4µm, n =50) and 2 to 7 distoseptate. This description overlap with the original description of P. avenicolai (Marin-Felix et al. 2019) and the leaf spot pathogen of Avena sativa reported in China (Chen et al. 2022). The fungus was identified as P. avenicola on the basis of morphology and molecular phylogenetic analysis. To produce inoculum, the isolate MAFF511692 was grown on V8 juice agar at 25°C under near-UV light for 7 days. Five plants each of cv. 'Soil saver', 'New oats' of A. strigosa (Kaneko seeds co.) and 'New almighty' of A. sativa (Snow brand seed co.) were grown in a greenhouse for approximately 14 days and then inoculated by atomizing them with the conidial suspension (10 4 conidia/ml) at the five-leaf stage. Five plants of each cultivar sprayed with sterilized distilled water served as the control. Inoculated plants were covered with plastic bags for 24 h at 25°C. After 5 days, blackish brown elliptical lesions developed on the leaves of all inoculated plants of both cultivars of A. strigosa (Fig. 3) and A. sativa , implying broad pathogenicity of the fungus to species and cultivars of Avena plants. Halo was not observed, maybe due to fewer stress in the greenhouse environment. Controls remained asymptomatic. The produced lesions were incubated as described above and the reisolated fungus was identified as P. avenicola based on the morphology, confirming Koch's postulates. To our knowledge, this is the first report of leaf blight caused by P. avenicola on black oat in Japan.

Bakanae disease has become a serious threat for sustainable rice production in Asian countries including Bangladesh. Fusarium species are important seedborne pathogens that cause bakanae disease of rice. Typical bakanae symptomatic samples were collected through a series of sampling conducted in several districts of Bangladesh for 4 consecutive years from 2019 - 2022. The pathogens were confirmed using morphological characteristics, DNA sequences, and phylogenetic analyses of two genes, namely, translation elongation factor 1-alpha ( TEF1-α ), and RNA polymerase subunit II ( RPB2 ). A total of 121 Fusarium isolates were recovered from diseased rice samples at different geographical locations. From the phylogenetics analyses of TEF1-α and RPB2 gene sequences coupled with morphological characterization revealed that the collected isolates belonged to five species viz. F. fujikuroi (75.2% isolation frequency), F. incarnatum (17.35%), F. commune (4.95%), F. verticillioides (1.65%), and F. proliferatum (0.82%). Phylogenetic analysis also showed that 28 representative strains were attributed to five species. Finally, four Fusarium spp. F. fujikuroi , F. commune , F. verticillioides and F. proliferatum were found to be pathogenic under virulence assays of the isolates. The pathogenicity test results demonstrated that F. fujikuroi caused typical symptoms of bakanae, leaf elongation and chlorosis, whereas F. proliferatum and F. verticillioides only caused stunting of seedlings and F. commune caused wilt and root rot. F. incarnatum was found to be associated with bakanae disease of rice, however their pathogenicity could not be established. This study provides insight into the diversity and pathogenicity of Fusarium populations associated with bakanae disease in Bangladesh, which will help in formulating effective strategies and policies for better control of the bakanae disease.

Stevia rebaudiana is a promising medicinal and edible plant, widely cultivated in China. In 2022-2023, a new leaf spot disease occurred in S. rebaudiana in Hongxing country (32°34'55″N, 118°2'12″E), Dingyuan city, Anhui province. Symptoms were observed on 10 to 15% of plants in three S. rebaudiana nursery beds (0.1 ha in total). The typical symptoms included dark brown spots on the leaves and foliar wilting, the development of brown stems with dieback of top buds, and occasional plant death (Fig. 1a). To identify the pathogen, twenty diseased leaves were collected, cut into small pieces, surface sterilized with 75% ethanol for 30 s, in 0.5% sodium hypochlorite for 2 min, washed three times in sterile water, placed on PDA, and incubated at 25℃ for 5 days. Pure cultures were prepared by subculturing hyphal tips. Twenty-five Stagonosporopsis-like isolates with similar morphology were obtained. After 7 days growth on PDA, colonies had a regular margin, were cottony, and formed concentric circles on the surface that were gray-green. The reverse side of the culture was dark brown with a creme-orange and white, margin. The growth rate was 9.5 mm/day on PDA. Pycnidia were mostly solitary, globose or subglobose, pale to dark brown, thin-walled, glabrous, ostiolate, 95.735~250.851×90.93~266.32 μm (n=50). Conidia were oblong, cylindrical to ellipsoidal, smooth-walled, aseptate, with rounded ends and two polar guttules and measured 3.41 to 5.83 × 1.78 to 3.07 μm (n = 50) (Fig.1 b-d). For molecular identification, the internal transcribed spacer (ITS) rDNA, large ribosomal subunit (LSU) gene, β-tubulin (TUB2) gene and RNA polymerase II (RPB2) gene sequences of two representative isolates (TYJ-SP1 and TYJ-SP2) were amplified by PCR (Woudenberg et al. 2009; Dong et al. 2021). The sequences were deposited in GenBank (accession nos.: OR506193 and OR506194 for ITS, OR533526 and OR533527 for LSU, OR545221and OR545222 for TUB; OR545223 and OR545224 for RPB2) and showed 99.60% to 99.2% similarity to ITS (502/504 bp and 507/511 bp; MZ156571), 100% similarity to LSU (857/857 bp and 857/857 bp; MZ191532), 98.67% to 99.3% similarity to TUB2 (296/300 bp and 298/300 bp; MZ203132) and 99.78% (888/890 bp and 868/870 bp; MZ203135) of S. pogostemonis strain ZHKUCC 21-0001. A maximum likelihood phylogenetic analysis based on the concatenated sequences of ITS, LSU, TUB2 and RPB2 using MEGA 11.0 showed the strains TYJ-SP1 and TYJ-SP2 formed a clade with S. pogostemonis (Fig. 2). Thus, the strains were identified as S. pogostemonis (Dong et al. 2021). To test pathogenicity, the strain TYJ-SP1 was inoculated onto 30-day-old S. rebaudiana seedlings which were surface sterilized with 70% alcohol and washed 3 times with water and air dried prior to inoculation. Ten seedlings were sprayed with a conidial suspension (105 conidia/mL) and ten seedlings were sprayed with sterile water to serve as the negative control. All seedlings were maintained in a growth chamber (25°C, 90% relative humidity) with a 16 h photoperiod. Brown spots were first observed on inoculated leaves 48 h after inoculation; typical symptoms appeared by 7 days post inoculation. All inoculated plants developed symptoms similar to naturally infected plants in the nursery beds, and the disease incidence reached 100% while control plants remained symptom free (Fig. 1 e-f). The same Stagonosporopsis isolates were reisolated from the inoculated plants and identified based on morphological and phylogenetic analyses. S. pogostemonis has been reported to cause leaf spot in Pogostemon cablin and Brassica oleracea var. botrytis (Dong et al. 2021; Habib et al. 2024). To our knowledge, this is the first report of S. pogostemonis causing leaf spot on S. rebaudiana in China. As a medicinal and economic plant, S. rebaudiana is widely planted in China and other Asian countries. The occurrence of this leaf spot disease seriously affects its medicinal and economic value. Therefore, it is crucial to establish and implement effective disease management practices to reduce the impact of the disease.

In this two-year field study, the impacts of pre-plant soil management strategies, including soil fumigation, nematicide application, and organic amendments, on the growth and nematode community dynamics on cherry cultivars 'Emperor Francis' and 'Ulster' grafted to 'Mahaleb' rootstock were investigated in a replanted orchard site. In the first year, fumigation with 1,3-dichloropropene - chloropicrin mixture (Telone C-35) led to significantly increased trunk cross-sectional area and canopy height in both cultivars. Pratylenchus penetrans population densities were suppressed only short-term. Plots treated with the fungicide/nematicide fluopyram (Velum® Prime) had P. penetrans reproduction factors below one throughout both years independent of the scion. Additionally, the combined application of Seed Starter 101®, Dairy Doo® compost, and straw mulch reduced the reproduction factor of P. penetrans to below one in the first year. In the same time period, this combinatory treatment had the highest reproduction factor for bacterivore and fungivore nematodes. Based on results of this study, fumigation with Telone® C-35 resulted in improvement of tree establishment and provided effective short-term suppression of P. penetrans. Velum® Prime exhibited longer-term efficacy for the suppression of P. penetrans.

The Hass cultivar is one of the most cultivated and distributed avocado varieties throughout the world, having high productivity, nutritional quality, market acceptance and adaptation to different climatic zones (Dreher and Davenport 2013). Anthracnose affects avocado production in tropical and subtropical regions, causing economic losses, especially post-harvest (Fuentes-Aragón et al. 2020). Correct identification of Colletotrichum species causing anthracnose is essential, as different species vary in important phenotypes such as virulence and sensitivity to fungicides (Chen et al. 2016). Twelve samples from batches of avocados with anthracnose were collected in Minas Gerais State, Brazil, in September 2023. The observed symptoms were brown to black depressed circular spots, ranging from a few millimeters to 3 cm in diameter on the epicarp of the fruits, covered in center by mucilaginous layers of pathogen sporulation. Isolation was performed directly from the spore masses and monoconidial isolates were cultured in PDA at 25°C for 7 days for morphological characterization and preserved in sterile water at 4°C. One of the morphotypes commonly recovered from lesions, represented by isolate UCBV 362 (Culture Collection COAD 3843), formed fast-growing colonies having white aerial mycelium and intense salmon-colored sporulation. The cylindrical conidia were 13 to 17.5 μm long and 4.5 to 7 μm wide (average 14.5 x 5.7 μm, N=100), produced on conidiophores dispersed in the aerial mycelium or aggregated on melanized conidiomata formed on the agar. The partial sequence of the second largest subunit of the RNA polymerase II gene (RPB2) from isolate UCBV 362 (GenBank: PQ034617, 1116 nt) showed 99% of coverage and 99.37% of nucleotide identity with the RPB2 sequence of the ex-epitype strain of Colletotrichum nymphaeae ICMP 17918 (=CBS 515.78) (GenBank: JN985506). In a Maximum Likelihood phylogenetic tree composed with RBP2 sequences from reference strains of the Colletotrichum acutatum species complex, the isolate UCBV 362 formed a highly supported clade with the ex-epitype and other reference strains of Colletotrichum nymphaeae, occupying the Clade 2 of the species complex together with C. scovillae and C. simmondsii (Damm et al. 2012). This result shows the reliability of RPB2 for phylogeny and species delimitation within Colletotrichum. To confirm pathogenicity, 10-mm discs from a 7-day-old colony were inoculated at 3 different points on healthy-looking avocado fruits and incubated at 28°C. Uninoculated fruits served as controls. The first symptoms appeared 5 days after inoculation and were similar to those observed in the original samples, while the fruits in the control group remained asymptomatic. The pathogen was reisolated from the lesions and identified morphologically, fulfilling Koch's postulates. Colletotrichum nymphaeae has been associated with avocado anthracnose in Mexico (Fuentes-Aragón et al. 2020). In Brazil, a study based on molecular phylogeny identified Colletotrichum siamense and C. karsti as etiological agents of this disease (Soares et al. 2021). This report expands the range of species that cause avocado anthracnose in Brazil and provides etiological information for the implementation and monitoring of control methods, especially chemical control.

Watermelon ( Citrullus lanatus ) and melon ( Cucumis melo ) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies ( Bemisia tabaci ) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus ( Opuntia auberi ) from Sonora, Mexico, and from one cactus ( O. cochenillifera ), lamb's ears ( Stachys byzantine ), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Dictyophora rubrovolvata, as an edible fungus with high medicinal value, is widely cultivated in several provinces in China (Hang et al. 2012). However, between December 2023 and March 2024, a rot disease occurred in the main production area in Fengxian District, Shanghai, China (N30°93', E121°49'). The disease incidence was 25% in the affected 1.33-ha growing area. High temperatures (>25℃) and poor ventilation provide favorable conditions for the spread of this disease. The disease mainly occurs at the stage of fruiting bodies formation of D. rubrovolvata. When the epidermis is damaged and broken, it becomes infested with mold, which then produces a layer of moldy rot with pus. The infected D. rubrovolvata tissues at the edge of the lesions were isolated, surface sterilized and cultured on potato dextrose agar (PDA) at 30 ℃ under dark conditions. Pure cultures were obtained by single-spore isolation. After 3 days, isolates were transferred to Czapek Yeast agar (CYA) (Samson et al, 2014). On CYA, the fungal colony consisted of white flocculent hyphae. Scanning electron microscopy analysis showed that the mycelium was white, and the internodes of the stolons formed characteristic pseudoroots, from which upwardly clustered erect, unbranched sporocarp peduncles expanded apically to form rounded sporocarp sacs, within which sporocarp spores were produced. (Hariprasath P, 2019). To confirm the identity of the pathogen, the genomic fragments for the internal transcribed spacer (ITS) and intergenic spacer (IGS) gene of the isolate were amplified by PCR (White et al. 1990; Liu XY. 2008). The resulting sequence was deposited in GenBank with accession PP951880 and PQ001670, respectively. PCR results and morphological observations indicated the isolated strain was a pure culture and the strain was designated as DIC01. Comparative results showed that the sequences with accession numbers MT603964.1 and DQ990323.1 showed high homology of 99.15% and 98.96% to the ITS and IGS sequences of Rhizopus arrhizusi DIC01, respectively. Phylogenetic analysis with ITS and IGS genes of the isolated strain and 7 Rhizopus spp. strains were performed using MEGAX with Neighbor-Joining (NJ) method. Based on the results of growth habits, morphological observations, and phylogenetic analysis, the pathogen was identified as R. arrhizusi. A spore suspension of the R. arrhizusi DIC01 (1 x107 conidia/mL) was inoculated back to healthy D. rubrovolvata. Five healthy fruit bodies of D. rubrovolvata were injected, and another five healthy morels were treated with potato dextrose broth (PDB) as controls. D. rubrovolvata was incubated at 25°C and 90% relative humidity without ventilation for 5 days. The pathogen successfully infected the D. rubrovolvata, which developed white moldy lesions similar to those of natural diseases. The controls remained healthy without any symptoms. The pathogen was reisolated from the affected lesions and identified as R. arrhizusi DIC01 based on its morphological characteristics and phylogenetic marker genes. R. arrhizusi has been reported to cause endothelial cell damage and mycelial invasion into blood vessels, leading to thrombosis and tissue necrosis. (Hariprasath P, 2019). To our knowledge, this is the first report of R. arrhizusi causing rot disease of D. rubrovolvata. This study confirmed that R. arrhizusi is the pathogenic fungus responsible for rotting disease in D. rubrovolvata farms in Fengxian, Shanghai.

Catalpa bungei originates from China. Because of its well-developed root system and strong resistance to wind and soil, it is one of the top ten recommended species of ecological management (Jian et al., 2022). In September 2023, a severe leaf rot of C. bungei was observed at Lanlake farm (500 acres) in Nanyang (33°3'23" N, 112°28'50" E), China. The incidence rate of leaf rot reached 45% (n = 100). The pale-yellow spots initially appeared on the adaxial surface of leaf margins, subsequently enlarging to form irregular black rot lesions, with the yellow halos around the necrotic area of the lesion, ultimately causing the entire leaves to wither. Diseased leaves (20) were collected, cut into pieces, sterilized, and then placed on potato dextrose agar (PDA). A total of 25 purified fungal strains were isolated, and three strains (QS2-1, QS2-2, QS2-3) from distinct areas were selected for further analysis. Each strain produced abundant aerial mycelium, initially white, which later developed purple pigments. The aerial conidiophores were sparsely branched, ending with verticillate phialides. The strains generally produced many more microconidia than macroconidia on PDA media. Microconidia were clavate and measured 3.9 to 6.6 × 1.1 to 2.4 μm (n = 50). To produce macroconidia, we used YPG liquid medium (0.3% yeast extract, 1% peptone, and 2% glucose) with shaking (200 r.p.m.) for 5 days. Macroconidia were slender, straight, and measured 19.5 to 27.1 × 1.9 to 3.5 μm, with 3 to 5 septa (n = 50). The morphological characteristics matched the species description of Fusarium verticillioides (Sacc.) Nirenberg 1976 (Leslie and Summerell, 2006). The rDNA internal transcribed spacer (ITS), β -tubulin gene ( tub2 ), translation elongation factor 1-alpha gene ( tef1 ), calmodulin ( cmdA ), RNA polymerase II largest subunit ( rpb1 ), and RNA polymerase II second largest subunit ( rpb2 ) were amplified for molecular identification (O'Donnell et al., 2022). The sequences were submitted to GenBank with accession numbers OR741762, OR741763, OR741765 (ITS), OR762222, OR762223, OR939807 ( tub2 ), OR939799, OR939800, PQ035927 ( tef1 ), OR778611, OR939808, OR939809 ( cmdA ), PQ035921, PQ035922, PQ035923 ( rpb1 ), and PQ035924, PQ035925, PQ035926 ( rpb2 ). BLASTn analysis of QS2-1 sequences exhibited 99% similarity with F. verticillioides sequences (strains CBS 576.78) MT010888 of cmdA (711/713, 99%), MT010956 of rpb1 (1790/1791, 99%), and MT010972 of rpb2 (868/870, 99%). A phylogenetic tree was constructed using concatenated sequences along with the sequences of the type strains employing the neighbor-joining method, showing the three strains formed a clade with the type strain CBS 576.78. Pathogenicity was tested on 10 healthy potted seedlings by spraying them with a conidial suspension (10 6 conidia ml -1 ), while 5 seedlings were sprayed with sterilized water as a control. The plants were placed in climate incubators. Ten days after inoculation, typical lesions were observed on the treated plants, but not on the control group. The reisolated strains were identified as F. verticillioides through morphological characterization, thus fulfilling Koch's postulates. F. verticillioides is known to cause Fusarium ear rot on maize, and other plants including Brassica rapa (Akram et al., 2020) and Schizonepeta tenuifolia (Li et al., 2024). This is the first documented instance of F. verticillioides causing leaf rot on C. bungei globally. Identifying the pathogen is critical to implementing effective disease management strategies, especially in choosing proper pesticide agents and screening disease-resistant varieties.

In both April 2018 and September 2019, cowpeas / black-eyed peas (Vigna unguiculata) in one field in Tulare County, California were observed with tap root rot, both underground (foot) and aboveground stem rot, and in some cases canopy decline, compromising bean formation. In both fields, < 5% of plants appeared affected. Foot and stem segments (~1 cm) of 5-10 plants / field were disinfested sequentially with 0.1% Tween 20 (dip), 70% ethanol for 30 s, and 1% sodium hypochlorite for 2 min and placed on 1:10 potato dextrose agar with 0.03% tetracycline and Fusarium selective medium (Leslie and Summerell 2006). Fusarium-like isolates (dominant in isolation plates) were transferred to 0.6% KCl agar, where fusiform, curved macroconidia and varied microconidia in false heads on elongated monophialides were observed, characteristic of the Fusarium solani species complex (FSSC) (Leslie and Summerell 2006). Isolates CS221, CS222, and CS520 (representing different plants and locations) were saved as single hyphal tip cultures. An Illumina-derived genome sequence was assembled (Burkhardt et al. 2019) and partial tef1ɑ and rpb2 sequences (O'Donnell et al. 2022) were extracted from genome sequences in silico. Sequences were 99.9-100% identical to one another and to deposited F. falciforme isolates based on Fusarium ID and Fusarium MLST for tef1ɑ and rpb2, respectively (tef1a accessions: NRRL 28562 and NRRL 32331; rpb2 accession: NRRL 22857), and were deposited in GenBank (accessions in supplementary table). Pathogenicity was evaluated in three-week-old cowpea plants (cv. CB46rk2) in the greenhouse (13.5-33.6℃; 12:12 h L:D). The tap root / stem was wounded (1 mm wide, 2 mm deep) ~ 2 cm below the soil line and drenched with 50 ml of 106 spores / ml 0.1% water agar or with 0.1% water agar (negative control). The trial was arranged in a Randomized Complete Block Design with three blocks and 2-3 plants / isolate / block, and conducted twice. 52 d post-inoculation, below ground tap root / stem rot developed in 83% of F. falciforme-inoculated plants, with lesion lengths ranging from 25.2 ± 4.2 to 29.2 ± 8.0 mm (P = 0.893 for isolate, ANOVA). Canopy decline developed in 33-50% of plants across treatments in trial 1 (P = 0.859 for isolate) but not in trial 2, likely due to cooler conditions in trial 2 (January-March) vs. trial 1 (May-July), which were less stressful. F. falciforme isolates did not affect bean biomass (dry weight) vs. negative controls (12.5-14.8g / plant; P = 0.949 for pathogen treatment). FSSC isolates were recovered from 100% of symptomatic plants in the inoculated treatments but not in negative controls (both trials) and representative isolates from all treatments were confirmed as F. falciforme (tef1a analysis; trial 2 only). This study establishes F. falciforme as a root and stem rot pathogen of cowpea in California-a disease previously attributed to the morphologically and phylogenetically distinct F. phaseoli (syn. F. solani f. sp. phaseoli), but which lacked modern etiological studies (Frate et al. 2018; Geiser et al. 2021). This work is consistent with previous reports of F. falciforme as a root / stem rot pathogen in cowpea (Ajamu et al. 2023) and other beans (Sousa et al. 2017; Duarte et al. 2019). Clarification of disease etiology will improve accurate diagnosis and effective crop rotation-based management, since F. falciforme is also a pathogen of other California crops including melon, tomato and pistachio.

Brown rot, caused by Monilinia fructicola, is one of the most economically important diseases of peach. Demethylation inhibitor (DMI) fungicides play an important part in managing brown rot in the southeastern U.S., but over the last 20 years, reduced efficacy to DMIs has been reported in field isolates overexpressing the DMI target enzyme encoding MfCYP51 gene. Metabolites of the biocontrol agent (BCA) Pseudomonas chlororaphis strain AFS009 suppressed the MfCYP51 gene in sensitive and resistant M. fructicola isolates previousely, but it is not known what molecule was responsible. The goals of this study were to determine the presence and role of pyrrolnitrin (PRN), a common metabolite of P. chlororaphis and chemical analogue to fludioxonil with antifungal activity, in the suppression of the MfCYP51 gene and to investigate if MfCYP51 expression can also be suppressed by Bacillus subtilis. High-performance liquid chromatography (HPLC) detected pyrrolnitrin at 1.75 µg/mg in P. chlororaphis metabolites formulated as Howler EVO (Howler). PRN at 0.1 µg/ml, fludioxonil at 0.1 µg/ml, and Howler applied at a dose that contained 0.1 µg/ml PRN significantly reduced the MfCYP51 gene expression at similar levels in DMI-resistant isolates. Furthermore, MfCYP51 expression in DMI-sensitive and three DMI-resistant isolates treated with Howler (88.1 µg/ml), Theia (209.5 µg/ml), propiconazole (0.3 µg/ml), or the mixture of either Howler or Theia + propiconazole revealed that Howler significantly reduced the MfCYP51 target gene expression in two of three sensitive and all three resistant M. fructicola isolates. On the other hand, Theia showed no suppressive effect and even increased the MfCYP51 gene expression level in two of three resistant isolates. In detached fruit assays on apple with a DMI resistant isolate, only the mixture of Howler + 50 µg/ml propiconazole resulted in synergism. The results indicate that suppression of MfCYP51 target gene is BCA-dependent and can be induced by pyrrolnitrin.

Fusarium head blight (FHB), a devastating wheat disease caused by several species of Fusarium, threatens global wheat yield and quality (Erenstein et al. 2022). In August 2023, wheat spikes exhibiting clear FHB symptoms were observed in fields in Yunnan, China (24°16'46″ N, 102°29'46″ E), with an incidence rate of approximately 10%. Diseased wheat spikes exhibited a bleached, wilted appearance, with abundant orange sporodochia on the glumes, similar to previous reports (Osborne et al. 2007). Twenty-four symptomatic spikes were collected from a single field, and sporodochia were washed with sterile water to prepare a spore suspension of 1 × 10³ spores/ml, which was inoculated onto potato dextrose agar (PDA) to obtain monosporic cultures. Four reference strains (KUNCC 3418 to KUNCC 3420, and KUNCC 3431) were deposited at the Kunming Institute of Botany Culture Collection, Chinese Academy of Sciences (KUNCC). For species identification, four strains were cultured on PDA and carnation leaf agar (CLA) at 25°C, with incubation under a 12-hour near-UV light/dark cycle on CLA and in complete darkness for 24 hours on PDA. Colonies on PDA grew rapidly, appearing white and loosely flocculent. Abundant pale orange, translucent sporodochia formed on CLA. Sporodochial conidiogenous cells were monophialidic or polyphialidic, subulate to subcylindrical, 9.5-12 μm × 3-3.5 μm. Sporodochial macroconidia were naviculate to fusiform, with an elongate, tapering apical cell and a foot-shaped basal cell, 3-6-septate, 33-67.5 μm × 3.5-5.5 μm. The ITS, tef1-α, rpb1, rpb2, and cam regions were amplified and sequenced using primers ITS1/ITS4, EF-1/EF-2, rpb1-F7/G2R, rpb2-5F2/11aR, and CL1/CL2A, respectively (White et al. 1990; O'Donnell et al. 2000; O'Donnell et al. 2010; Reeb et al. 2004; O'Donnell et al. 1998). These sequences were deposited in GenBank for cam (PP951603 to PP951606), ITS (PP946846 to PP946849), tef-1α (PP719217, PP731572 to PP731574), rpb1 (PP719219, PP737839 to PP737841), and rpb2 (PP719218, PP951607 to PP951609). BLASTn analyses of these sequences showed an identity range of 99.7% to 100% with the epitype strain NRRL 36323 of F. compactum (GenBank: cam = GQ505560, ITS = MH855177, tef-1α = GQ505648, and rpb2 = GQ505826), with base pair matches of 663/665 bp for cam, 488/488 bp for ITS, 641/641 bp for tef-1α, and 892/892 bp for rpb2. Both morphological and BLASTn analyses confirmed these isolates as F. compactum (Leslie & Summerell 2006; Han et al. 2023). Pathogenicity tests were performed by spraying 1 ml of spore suspension (1 × 108 spores/ml) of F. compactum strains onto spikes of the wheat cultivar Yunmai 126 at the flowering stage (n = 9). Controls (n = 9) were treated only with sterile water. Following treatment, the wheat spikes were covered with plastic bags and incubated at 25°C for 10 days. After 14 days, the inoculated spikes turned bleached and dry, showing FHB symptoms, while the wheat spikes in the control treatment remained asymptomatic. The pathogenic fungus re-isolated from all diseased samples was confirmed as F. compactum. It has been frequently reported in association with crown and root rot of wheat, particularly in regions such as Turkey and Iran (Tunali et al. 2008; Besharati et al. 2017). To our knowledge, this is the first report of F. compactum on diseased wheat spikes in China. This finding provides valuable insights into the spread of F. compactum.

Monitoring of scientific activity is a process of systematic tracking, analysis and evaluation of the activity and results of scientific research, to identify new directions and trends in research, as well as to assess the growth, level of activity and significance of scientific activity in a particular field of knowledge. This paper summarizes and analyzes statistical data for 2023 on publication and patent activity, personnel, directions and topics of research work of participants in the Scientific Program of the Moscow Healthcare Department for 2023-2025, the functions of which are coordinated by the Research Institute for Healthcare Organization and Medical Management of Moscow Healthcare Department.

Parrotia subaequalis is of great ornamental value due to its unique bark, featuring interesting textures and colors, and its large, striking galls. These characteristics make it a popular choice for bonsai cultivation. (Yan et al. 2022) . In July 2023, an outbreak of leaf blight was observed on 40, six-month-old P. subaequalis seedlings in Anqing, Anhui, China, with an incidence rate of 80%. In the early stages of infection, small brown spots appear on the leaf surface, which gradually become round or irregular and darken to a deep brown color. As the disease progresses, the affected areas expand from the leaf margins towards the center, causing the leaf surface to become concave, wilt, and necrotize. This resulted in restricted plant growth, and in severe cases, partial or complete plant death. For isolation, 30 tissue slices (5 × 5 mm) were taken from the leaves of 10 symptomatic seedlings and surface sterilized with 75% ethanol for 5 seconds, followed by five rinses with sterilized distilled water. After two days of dark incubation at 28°C, hyphal tips of fungi were transferred onto new potato dextrose agar (PDA) plates and incubated until conidia production. Six unidentified isolates with similar morphological characteristics were obtained. The colonies, initially white, darken to black after 7 to 10 days of incubation. They produced colorless, aseptate conidia that were oblong or fusiform, measuring 18-26 μm in length and 5-8 μm in width (n=50). The morphological characteristics of the isolates resembled those of Botryosphaeria (Udayanga et al. 2015) . Isolate IS2116-1 was further confirmed through molecular methods. The rDNA internal transcribed spacer (ITS) region, translation elongation factor 1-α (TEF1-α), and beta-tubulin (TUB2) genes were amplified and sequenced using the primers ITS1/ITS4 (White et al., 1990), EF1-728F/EF1-986R, and Bt2a/Bt2b (Ferreira et al., 2021; Carbone et al., 1999), respectively. BLAST analysis revealed that the ITS (OR958722) sequence was 100% similar to the B. dothidea isolate HZ5(MH329650.1), TEF1-a (PP214058) sequence was 100% similar to the B. dothidea strain JZB310220(ON890458.1), and strain TUB2 (PP214057) sequence was 99.78% similar to the B. dothidea strain L14 (KR260833.1). Maximum likelihood analyses were performed for the combined ITS、TUB2、TEF datasets using PhyloSuite v1.2.2, the resulting phylogenetic tree indicated that isolate IS2116-1 clustered together with Botryosphaeria dothidea in a clade with 97% bootstrap support(Zheng et al. 2020) . Pathogenicity tests were conducted on 3-6 month-old P. subaequalis seedlings (n = 5) grown in a greenhouse. A conidial suspension (106 spores/ml) collected from the isolates was sprayed onto P. subaequalis seedlings, while the control was treated with distilled water. All plants were maintained in a growth chamber at 28°C with a 12-h photoperiod. The experiment was conducted twice independently . After 20 days of inoculation, brownish lesions similar to those observed in the field appeared on the treated plants, while the noninoculated control plants remained symptomless. The pathogen was reisolated from the leaves of the obviously diseased seedlings and confirmed as B. dothidea through morphological and sequence analysis. No isolates were obtained from uninoculated control plants, thus fulfilling Koch's hypothesis. This report marks the first record of B. dothidea causing leaf blight in P. subaequalis. In light of the rarity of natural P. subaequalis populations, it is imperative to assess both the extent of disease spread and its economic impact. These insights are crucial for devising strategies to protect this endangered species from disease threats and to preserve its ecological significance.

Forestry constitutes an important agronomical activity in Uruguay, involving the cultivation of exotic trees mainly for cellulose pulp production with Eucalyptus species. Over the last decade, E. smithii emerged as a species of interest for cellulose pulping. However, its rapid expansion has coincided with high mortality rates among young trees ranging from 5 to 85%, especially during the first and second summer after plantation. Disease surveys conducted on nine E. smithii commercial fields and three nurseries in southern and eastern Uruguay, yielded a collection of 25 isolates from E. smithii root rot belonging to the Nectriaceae family. In this study, we aimed to identify and characterize these isolates employing phenotypical and molecular studies and to assess their pathogenicity on E. smithii seedlings. Based on morphological features, the Nectriaceae isolates were subdivided into two groups, one resembling Calonectria (n=15) and another Cylindrocarpon-like (n=10). DNA sequences of the partial histone H3 (his3), actine, calmodulin, RNA polymerase II second largest subunit, translation elongation factor 1-alpha (tef1) and β-tubulin (tub2) genes were amplified for Calonectria, as well as partial his3, tef1, tub2 and internal-transcribed spacer and intervening 5.8S (ITS) for the Cylindrocarpon-like group. Based on phylogenetic analysis and phenotypical features three species were identified and characterized; Calonectria pauciramosa (n=15), Dactylonectria novozelandica (n=2), and a novel taxon which we describe here as Ilyonectria charruensis sp. nov. (n=8). The pathogenicity trials revealed that isolates from the three species significantly reduced both shoot and root dry weights of inoculated E. smithii seedlings compared to control plants.

Halo blight of hop, caused by Diaporthe humulicola, has increased in eastern North America since 2018. When left untreated, the disease can cause yield loss ranging from 17-56%. Currently, there are no fungicides registered for use on halo blight of hop. From 2020 to 2022 field trials were conducted using 10 fungicides registered for use on powdery and downy mildew of hop to determine their efficacy against halo blight. To validate field results, the EC50 value was determined for each active ingredient including flutriafol, tebuconazole + fluopyram, cyflufenamid, and trifloxystrobin + salicylhydroxamic acid (SHAM). Each fungicide tested had an EC50 value less than 50 ppm. A discriminatory dose was used to test the sensitivity of 206 D. humulicola isolates collected from the eastern U.S. and Canada in a poison agar assay. Results showed that tebuconazole + fluopyram decreased the incidence and severity of halo blight in the field. Also, this fungicide combination had EC50 values of 2.26 x 10-1 ppm and significantly reduced the growth of most of the isolates tested. Trifloxystrobin + SHAM decreased the presence of halo blight in the field tiral, but some isolates were less sensitive in discriminatory dose testing. Our results show that fungicides in FRAC groups 3, 7, and 11 were the most effective to control halo blight. Analyses of field trials showed a positive correlation between the severity of early season downy mildew infections and late season halo blight infections.

Macrophomina phaseolina is a fungus that causes charcoal rot in strawberry and a wide variety of crop species. Little is known about its potential to asymptomatically colonize crop plants or grow saprophytically on their tissues, both of which would create a potential for alternate, asymptomatic hosts to lead to increases in inoculum. To test the impact of cover cropping on M. phaseolina abundance, we conducted randomized-block field experiments in soils infested by M. phaseolina . None of the fifteen cover crop varieties showed symptoms of charcoal rot. All Fabaceae and Brassicaceae varieties were asymptomatically colonized at varying rates, but among Poaceae, M. phaseolina was recovered from only one individual oat plant. Soil samples collected at the time of planting, tillage, and 8 weeks post-tillage showed that cover cropping attenuated the growth of M. phaseolina relative to fallow plots harboring the weedy legume Medicago polymorpha . This weed species was abundantly colonized by this pathogen in both living root samples and plant residue collected 8 weeks after tillage. Cover cropping also influenced the diversity and composition of bulk soil bacterial and fungal communities, but these effects were not associated with M. phaseolina population density. Although M. phaseolina was not detected in living wheat tissues, it was recovered from wheat residue, suggesting that it may be facultatively saprophytic. These results suggest that cover cropping does not pose a risk for increasing disease caused by M. phaseolina and could be beneficial as conducive weed species, such as M. polymorpha , are suppressed.

Broccoli (Brassica oleracea L. var. italica) is one of the important cruciferous vegetables in China, known for its considerable economic and nutritional value (Li et al. 2021). In September 2023, leaf spot disease was observed on broccoli seedlings in the commercial fields in Weifang City, Shandong Province, China (119°15'E, 36°70'N). Further investigation revealed that the disease incidence was approximately 60% in 4.5 square hectometers (hm2) broccoli field, resulting in substantial economic losses. This disease primarily affects the leaves, manifesting distinct symptoms such as circular, dark necrotic spots that gradually lighten and are encircled by a chlorotic halo. Some lesions further develop a black or purplish border, exhibit concentric zonation, and eventually fall off, leaving behind holes, as shown in Figure S1B and C. In severe cases, decay originates from the central perforation and spreads outwards, as shown in Figure S1A. To identify the causal agent of this disease, infected leaf tissues were collected and surface disinfected by immersing in 75% ethanol for 30 seconds, followed by three rinses with sterile water. The samples were grinded in sterile deionized water, and the extract was plated on NA. After incubation at 28°C for 48 h, individual colonies were transferred to fresh NA plates. A total of 12 strains with the similar morphological characteristics were isolated from diseased samples collected from the three plots. After 48 hours of growth on NA medium at 28℃, each colony attained a diameter ranging from 3 to 5 mm. These colonies appeared yellow, slightly elevated, nearly circular in shape, with a smooth and moist edge. Three representative strains were selected for further investigation. All strains were Gram-negative, aerobic, and rod-shaped. The analysis of BIOLOG GENIII microplate system revealed the capability of three isolates using cellobiose, trehalose, glucose, mannose, galactose, and sucrose. Furthermore, the isolates were unable to hydrolyze arginine and utilize rhamnose and inositol. The 16S rRNA gene was amplified and sequenced to confirm that three isolated bacteria belong to the genus Xanthomonas (OR772321-OR772323), followed by PCR amplification for 4 housekeeping genes atpD, dnaK, gyrB, and rpoD (Young et al. 2008; Saux et al. 2015). The obtained sequences were submitted to the GenBank under accessions OR789628-OR789630, OR785471-OR785473, OR789631-OR789633, and OR785468-OR785470. Gene sequences were aligned, concatenated, and used to generate a phylogenetic tree using the neighbor-joining method in MEGA11 (Tamura et al. 2021). The phylogenetic analysis revealed that all the three isolates were clustered with Xanthomonas campestris pv. raphani strains 5055 and 576, respectively (Figure S2). (Dubrow et al. 2022). These results were consistent with those of the reported X. campestris pv. raphanin (Cruz et al. 2015). To verify the pathogenicity of these strains, we used a spray inoculation method. In detail, bacterial suspensions (30 mL per treatment) containing approximately 108 CFU/ml were sprayed onto healthy, four-week-old broccoli plants and incubated in a phytotron at 28°C and above 90% RH. Negative controls were performed using sterile distilled water. Each isolate underwent three trials and each treatment included 12 broccoli seedlings. Leaf spot symptoms were observed on 5 days post inoculation, as shown in Figure S1E, F and G. Negative control plants showed no symptoms (Figure S1D). We further re-isolated the bacterium from the symptomatic plants and verifying the bacteria as X. campestris pv. raphanin with the aforementioned sequence analysis, thereby fulfilling Koch's postulates. To our knowledge, this is the first report of X. campestris pv. raphani causing leaf spot disease on broccoli in China. This study enhances our understanding of the pathogenic bacterium on broccoli and lays the groundwork for developing targeted management strategies.

Ginger (Zingiber officinale) is a vital commercial crop in China, valued for its medicinal and nutritional properties. From June to September 2023, soft rot symptoms were observed on ginger rhizomes in fields in Shucheng County, Lu'an City, Anhui Province, China (31°24'N, 116°53'E). Brown, water-soaked lesions emerged at the stem base, accompanied by leaf yellowing and wilting. Approximately 20% of the ginger fields in this region (about 530 hectares) displayed soft rot symptoms. Rhizomes from ten randomly diseased ginger plants from three different locations were surface disinfected (Liu et al. 2020). The disinfected rhizomes were ground in sterile water, and serial dilutions of the supernatant were then placed on Luria-Bertani (LB) agar, resulting in the isolation and purification of 432 colonies. Using the primer set 27F/1492R (Weisburg et al. 1991), the 16S rRNA gene was amplified and sequenced. BLASTn analysis indicated that Pectobacterium species were isolated from all three locations, accounting for one-fifth of the total isolates. Three isolates, PA03, PA05, and PA08, were randomly chosen for further analysis. These colonies appeared milky white, round, with a smooth surface and smooth margins. All three isolates were Gram-negative, tested negative for methyl red and catalase, but positive for urease. The 16S rRNA sequences obtained (GenBank accession No. PP935462, PP935465 and PP935466) were 100% identical to Pectobacterium aroidearum strains KNUB-05-21 (LC777355, 1,375/1,375 bp), 3898C (KY446053, 1,418/1,418 bp), and MY11 (MT834965, 1,373/1,373 bp). The icdA, mdh, and proA genes of the isolates were amplified by PCR using specific primer pairs icdA-F/icdA-R, mdh-F/mdh-R, and proA-F/proA-R, respectively (Ma et al. 2007). BLASTn searches showed that the icdA (PP922142), mdh (PP922148), and proA (PP922145) sequences of PA03 had similarities of 99.25%, 98.26%, and 98.01%, respectively, with those of P. aroidearum strain UNEB3 (MH500095, 563/536 bp; MH507329, 522/394 bp; MH507331, 655/702 bp). Similarly, the icdA (PP922143), mdh (PP922149), and proA (PP922146) sequences of PA05 were 99.05%, 99.09%, and 97.18% identical to those of P. aroidearum strain MTL1911110204 (MT013063, 529/552 bp; MT013079, 498/399 bp; MT013095, 717/714 bp). The icdA (PP922144), mdh (PP922150), and proA (PP922147) sequences of PA08 shared 99.25%, 98.27%, and 97.94% similarity with those of P. aroidearum strain CCRM35 (MH500096, 537/537 bp; MH507330, 513/396 bp; MH507332, 630/705 bp). Phylogenetic trees were generated using MEGA11.0 software based on 16S rRNA and concatenated sequences of icdA-mdh-proA (Tamura et al. 2021). The results of phylogentic analysis revealed that the isolates, PA03, PA05, and PA08, clustered with P. aroidearum strains. To test pathogenicity, 10 µl of bacterial suspensions (1×108 CFU/ml) of isolates PA03, PA05, and PA08 were inoculated into the stem base of ginger plants using a sterile syringe, with sterile water used as a control. Each isolate was inoculated into five pots, with three plants per pot. The plants were maintained in a greenhouse at 28°C with 75% relative humidity. Rhizomes inoculated with bacterial suspensions displayed soft rot symptoms resembling those observed in the field seven days after inoculation, while the control group remained free of symptoms. Bacteria were re-isolated from diseased tissues and identified by PCR with specific primer pairs icdA-F/icdA-R, mdh-F/mdh-R, and proA-F/proA-R. The re-isolated strains had the identical sequences as PA03, PA05, and PA08, confirming their pathogenicity and fulfilling Koch's postulates. P. aroidearum is known to cause soft rot in various crops (Barroso et al. 2019; Morase et al. 2020; Tang et al. 2021). To our knowledge, this is the first report of P. aroidearum causing soft rot disease of ginger rhizomes in China. In 2023, soft rot disease led to a 15 to 20% reduction in ginger yield, posing a substantial risk to ginger cultivation in Lu'an city. Identifying this pathogen is crucial for preventing disease outbreaks and developing effective disease management strategies.

Maize yield is threatened by increasing incidences of head smut disease caused by Sporisorium reilianum . To help breeders identify S. reilianum -resistant maize lines, the availability of efficient screening systems would be an advantage. Here we assessed maize lines with distinct levels of field resistance against head smut disease in greenhouse experiments using two different inoculation techniques. Addition of mixtures of mating-compatible sporidia to the soil at seedling stage of the plant did not lead to plant disease, and we could detect only marginal amounts of fungal DNA in apical meristems at eighteen days after sowing. Inoculation of the maize lines by leaf-whorl inoculation led to both high disease incidence and prominent levels of fungal DNA in apical meristems in all tested maize lines regardless of their field resistance levels. Thus, S. reilianum entering the plant via the leaf whorl can escape existing resistance mechanisms of currently known field-resistant maize lines. Since field-resistant lines are also resistant to inoculation via teliospore-contaminated soil, we propose teliospore addition to seeds at the time of sowing (rather than leaf-whorl inoculation of seedlings) combined with quantitative detection of fungal DNA in apical meristems, as an efficient screening procedure to discover field-resistant lines. However, screening maize plants for resistance against the leaf-whorl inoculation method might be promising for the discovery of novel resistance mechanisms needed to develop durably resistant maize lines.