Search

The addition of monoclonal antibodies to the antigen receptor complex on the malignant human T-cell line Jurkat generates increases in inositol trisphosphate and in the concentration of cytoplasmic free calcium. Exposure of Jurkat cells to cholera toxin for 3 hr inhibited these receptor-mediated events and led to a selective, partial loss of the antigen receptor complex from the cellular surface. None of the effects of cholera toxin on the antigen receptor complex were mimicked by the B subunit of cholera toxin or by increasing intracellular cAMP levels with either forskolin or 8-bromo cAMP. These results suggest that a cholera toxin substrate can regulate signal transduction by the T-cell antigen receptor.

The association between T3 and the T cell antigen receptor was examined using the T3 bearing T cell leukemic line Jurkat. A monoclonal antibody, C305, was produced, which reacted with idiotypic-like determinants expressed on Jurkat. The molecule with which this antibody reacted was a disulfide-linked heterodimer of 90 kD, composed of polypeptides of 42 and 54 kD. Thus, C305 reacted with a molecule with characteristics of the putative T cell antigen receptor described by others. A series of mutants of Jurkat, induced with ethyl methane sulfonate or radiation, was selected for T3 or antigen receptor negativity. In every instance, there was a concomitant loss of both T3 and the antigen receptor as assessed by quantitative absorption, indirect immunofluorescence, and antibody plus complement-mediated cytotoxicity. The absence of antigen receptor molecules was confirmed on diagonal gels, excluding the possibility that conformational changes of the antigen receptor on such T3-negative mutants were responsible for the failure of such mutants to react with C305. Moreover, in a mutant that expressed a marked decrease in the level of T3 expression, there was a comparable decrease in the expression of antigen receptor determinants. These results suggest that there is an obligate requirement for the coexpression of T3 and the T cell antigen receptor. Furthermore, attempts to activate such mutants with the lectin phytohemagglutinin suggested that the expression of T3 and/or the antigen receptor was required for activation of these cells.

Antibodies against the T3-antigen receptor complex can activate the human T cell line, Jurkat, to produce interleukin 2 (2-5). This activation is initiated by a receptor-mediated increase in the concentration of free cytoplasmic calcium ions [Ca2+]i (3, 4). In this communication, we investigate the mechanism by which the receptor complex increases [Ca2+ )i in Jurkat cells. The initial receptor-mediated change in [Ca2+]i can occur when extracellular Ca2+ is depleted by EGTA. Perturbation of the T cell antigen receptor, therefore, generates a signal which mobilizes Ca2+ from intracellular stores. As inositol trisphosphate appears to function as such a signal for certain hormone receptors, we measured the levels of inositol trisphosphate and of the other inositol phosphate compounds in Jurkat. Antibodies to either the antigen receptor heterodimer or T3 determinants result in marked elevations of all three inositol phosphates. These changes in inositol phosphates are not secondary to the receptor-mediated increases in [Ca2+]i as demonstrated by the inability of the Ca2+ ionophore, ionomycin, to affect the levels of any of these compounds. In concentrations between 0.1 and 1 microM, purified inositol trisphosphate releases Ca2+ from permeabilized Jurkat cells. Taken together, these data indicate that, during activation, perturbation of the T3-antigen receptor complex generates inositol trisphosphate. This compound functions as an intracellular signal to release Ca2+ from intracellular stores, leading to increases in [Ca2+]i.

Rheumatoid arthritis is significantly associated with the HLA determinant HLA-DRw4 and cell-mediated reactivity to collagen. To determine if genes linked to those coding for HLA-DRw4 constituted immune response genes for collagen reactivity, peripheral blood mononuclear cells from 20 individuals with rheumatoid arthritis, 13 individuals with other arthropathies, and 41 normal individuals were compared for their ability to synthesize the lymphokine leukocyte inhibition factor in response to denatured bovine collagen. All individuals were responsive to the control antigen Candida albicans. While 90% of the patients with rheumatoid arthritis responded to collagen, so did 30% of the individuals without rheumatoid arthritis. This included 15 normal individuals without any evidence of arthritis. Collagen responsiveness was dependent on interactions between T cells and macrophages was dependent on interactions between T cells and macrophages and was directed against determinants expressed by primary amino acid sequences in the synthetic polypeptide (Gly-Pro)n. HLA-DRw typing of 59 individuals revealed a highly significant relationship (P less than 0.0001, chi 2 = 33.7) between HLA-DRw4 and collagen responsiveness, irrespective of whether or not rheumatoid arthritis was present. All normal individuals who were HLA-DRw4-positive were collagen responders. These studies demonstrate that the cellular, molecular, and genetic characteristics of collagen reactivity in man parallel those documented for the T cell-dependent response to antigens under immune response gene control in rodents.

Immunization of C3H/HeJ mice with 4 X 10(9) SRBC yields a whole splenic T-cell population which can, upon transfer, specifically suppress recipient direct and indirect plaque-forming cells (PFC) responses to sheep erythrocytes (SRBC). Discontinuous bovine serum albumin density gradient fractionation of these T cells demonstrated a population of low density T cells which augmented and a population of high density T cells which suppressed recipient responses irrespective of the number of T cells transferred. Moreover, infusion of admixtures of low and high density cells resulted in intermediate regulatory functions which could be predicted by knowing the regulatory capacity of each population alone. In addition to heterogeneity existing among regulatory T cells as regards amplification and suppression, it appeared that heterogeneity existed within the suppressor T population. Thus, T cells capable of inhibiting direct PFC could be distinguished from those suppressing indirect PFC by their differential localization in peripheral lymphoid tissue, differences in the dissipation of suppressive influences during incubation at 37 degrees C, and by differences in the possible requirement for adherent cell populations. While the relative frequency of both low density amplifier and high density suppressor cells increased with the dose of SRBC used for their induction, it appeared that suppressor cells might be generated in response to feedback signals from amplifier cells. These studies indicate that further delineation of heterogeneity existing within suppressor populations may be helpful in defining mechanisms required for the induction and manifestation of suppressive regulatory forces.

Normal human peripheral blood contains a population of T cells (autologous reactive cells [ARC]) capable of proliferating in response to signals from autologous B cells and monocytes. Selective suicide of proliferating ARC with 5-bromo-2-deoxyuridine and light demonstrated that this ARC was responsive to signals coded for by genes more closely linked to the HLA-DR, than to the HLA-A, or HLA-B, loci. Density-gradient fractionation of T cells indicated that populations enriched in ARC reactivity were also enriched for helper influences required for Ig synthesis by autologous B cells. In contrast, populations negatively selected for proliferating ARC were deficient in helper activity. These studies indicate that the ARC is responsive, at least in part, to products of genes closely linked to the HLA-DR locus and can function as a helper cell.

T cells responsive to macrophages (M phi) in the autologous mixed lymphocyte reaction (AMLR) contain those cells that can be induced to proliferate by soluble antigens. Negative solution (5-bromo-2-deoxyuridine and light) of T cells activated by autologous M phi also removed those cells required for reactivity to Candida albicans and purified protein derivative. Positive selection of T cells responsive to autologous M phi yields a population that is simultaneously enriched in antigen reactivity. Some patients demonstrating cutaneous anergy and diminished in vitro blast transformation in response to soluble antigen also lack T cells responsive to the AMLR to M phi. When considered in conjunction with previously reported data, these findings indicate the AMLR occurring between T cells and M phi in the absence of soluble antigen represents self recognition occurring between antigen-reactive T cells and antigen-presenting M phi.

Utilizing somatic cell hybridization, we have developed a monoclonal antibody that interacts only with cells of the monocyte/macrophage (M phi) line and not with other myeloid or lymphoid cells. This antibody detects a 120,000-dalton determinant present on 37 +/- 2.8% of the peripheral blood M phi from several (HLA-DR)-disparate individuals and only depicts a subpopulation (approximately 30%) of HLA-DR-bearing M phi from any single subject. Cytolytic removal of this subpopulation of HLA-DR-bearing cells markedly diminished antigen-induced T cell reactivity, a deficiency that can be reconstituted with autologous M phi but not with either their soluble products containing lymphocyte-activating factor or with intact HLA-DR-disparate M phi. Whereas M phi bearing both the 120,000-dalton determinant and HLA-DR serve as effective stimulators for autologous mixed lymphocyte reactions. M phi bearing only HLA-DR determinants do not. However, this latter population of M phi can stimulate proliferation among alloreactive T cells. These studies indicate that the Mac-120 monoclonal antibody detects a subpopulation of HLA-DR-bearing M phi that is required for the genetically restricted presentation of conventional antigen to reactive T cells. Within the M phi population, these Mac-120+ cells constitute the most effective stimulators for autologous mixed lymphocyte reactions.

DNA fragments isolated from a genomic clone of human gamma interferon (IFN-gamma) as well as IFN-gamma cDNA were used to map potential regulatory regions of the IFN-gamma gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-gamma gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-gamma gene. No hypersensitivity was found in the 3' regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-gamma, is 83% homologous to a nearly identical sequence in the 5' flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.

The human T-cell leukemia, Jurkat, and a T3-negative mutant of Jurkat (S.5) were used to study the role of T3 in human T-cell activation. Incubation of Jurkat with phytohemagglutinin (PHA) resulted in the production of interleukin 2, which was markedly increased by the addition of phorbol 12-myristate 13-acetate (PMA). Antibodies reactive with T3 could activate Jurkat only if added together with PMA. However, S.5 cells failed to produce interleukin 2 in response to PHA and produced 1/16th the interleukin 2 activity that Jurkat produced in response to PHA and PMA. Incubation of S.5 cells with the calcium ionophore A23187 and PMA resulted in the production of interleukin 2 activity comparable to that produced by Jurkat. Like antibodies reactive with T3, A23187 demonstrated an obligate requirement for PMA in order to activate Jurkat or S.5. These observations suggested that T3 might participate in T-cell activation through mechanisms that increase intracellular Ca2+. This was examined by using the Ca2+ sensitive fluor, quin-2, to measure levels of cytoplasmic free Ca2+ [( Ca2+]i). Addition of PHA, A23187, or monoclonal antibodies reactive with T3 to Jurkat cells resulted in substantial increases of [Ca2+]i. In contrast, only A23187 could induce an increase in [Ca2+]i in S.5 cells. Three other monoclonal antibodies reactive with other membrane antigens expressed on Jurkat or S.5 did not increase [Ca2+]i. These results suggest that T3 and/or associated molecules participate in T-cell activation through mechanisms that lead to increases in [Ca2+]i and that their expression is a relative requirement for T-cell activation by PHA.