Author: "Stewart C." - Searchworks@Jio Institute Digital Library Search Results

Your search keyword '"Stewart C."' showing total 12,824 results

Start Over Author "Stewart C."

12,824 results on '"Stewart C."'

1. Relative muscle indices and healthy reference values for sarcopenia assessment using T10 through L5 computed tomography skeletal muscle area

Author: Brian A. Derstine, Sven A. Holcombe, Nicholas C. Wang, Brian E. Ross, June A. Sullivan, Stewart C. Wang, and Grace L. Su
Subjects: Sarcopenia, Skeletal muscle, Morphomics, Medicine, Science
Abstract: Abstract Sarcopenia is the age-related loss of skeletal muscle mass and function. Computed tomography (CT) assessments of sarcopenia utilize measurements of skeletal muscle cross-sectional area (SMA), radiation attenuation (SMRA), and intramuscular adipose tissue (IMAT). Unadjusted SMA is strongly correlated with both height and body mass index (BMI); therefore, SMA must be adjusted for body size to assess sarcopenic low muscle mass fairly in individuals of different heights and BMI. SMA/height (rather than $$SMA/height^2$$ S M A / h e i g h t 2 ) provides optimal height adjustment, and vertebra-specific relative muscle index (RMI) equations optimally adjust for both height and BMI. Since L3 measurement is not available in all CT scans, sarcopenic low muscle mass may be assessed using other levels. Both a mid-vertebral slice and an inferior slice have been used to define ‘L3 SMA’, but the effect of vertebral slice location on SMA measurements is unexplored. Healthy reference values for skeletal muscle measures at mid- and inferior vertebra slices between T10 and L5, have not yet been reported. We extracted T10 through L5 SMA, SMRA, and IMAT at a mid-vertebral and inferior slice using non-contrast-enhanced CT scans from healthy, adult kidney donor candidates between age 18 and 73. We compared paired differences in SMA between the mid-vertebral slice versus the inferior slice. We calculated the skeletal muscle gauge as $$SMG_{HT}=SMRA*SMI_{HT}$$ S M G HT = S M R A ∗ S M I HT . We used allometric analysis to find the optimal height scaling power for SMA. To enable comparisons with other published reference cohorts, we computed two height-adjusted measures; $$SMI_{HT}=SMA/height$$ S M I HT = S M A / h e i g h t (optimal) and $$SMI_{HT2}=SMA/height^2$$ S M I H T 2 = S M A / h e i g h t 2 (traditional). Using the young, healthy reference cohort, we utilized multiple linear regression to calculate relative muscle index z-scores ( $$RMI_{HT}$$ R M I HT , $$RMI_{HT2}$$ R M I H T 2 ), which adjust for both height and BMI, at each vertebra level. We assessed Pearson correlations of each muscle area measure versus age, height, weight, and BMI separately by sex and vertebra number. We assessed the differences in means between age 18–40 versus 20–40 as the healthy, young adult reference group. We reported means, standard deviations, and sarcopenia cutpoints (mean-2SD and 5th percentile) by sex and age group for all measures. Sex-specific allometric analysis showed that height to the power of one was the optimal adjustment for SMA in both men and women at all vertebra levels. Differences between mid-vertebra and inferior slice SMA were statistically significant at each vertebra level, except for T10 in men. $$SMI_{HT}$$ S M I HT was uncorrelated with height, whereas $$SMI_{HT2}$$ S M I H T 2 was negatively correlated with height at all vertebra levels. Both $$SMI_{HT}$$ S M I HT and $$SMI_{HT2}$$ S M I H T 2 were positively correlated with BMI at all vertebra levels. $$RMI_{HT}$$ R M I HT was uncorrelated with BMI, weight, and height (minimal positive correlation in women at $$\hbox {L3}_{inf}$$ L3 inf , $$\hbox {L4}_{mid}$$ L4 mid , and $$\hbox {L5}_{inf}$$ L5 inf ) whereas $$RMI_{HT2}$$ R M I H T 2 was uncorrelated with BMI, but negatively correlated with height and weight at all levels. There were no significant differences in SMA between 18–40 versus 20–40 age groups. Healthy reference values and sarcopenic cutpoints are reported stratified by sex, vertebra level, and age group for each measure. Height to the power of one (SMA/height) is the optimal height adjustment factor for SMA at all levels between $$\hbox {T10}_{mid}$$ T10 mid through $$\hbox {L5}_{inf}$$ L5 inf . The use of $$SMA/height^2$$ S M A / h e i g h t 2 should be discontinued as it retains a significant negative correlation with height and is therefore biased towards identifying sarcopenia in taller individuals. Measurement of SMA at a mid-vertebral slice is significantly different from measurement of SMA at an inferior aspect slice. Reference values should be used for the appropriate slice. We report sarcopenic healthy reference values for skeletal muscle measures at the mid-vertebral and inferior aspect slice for T10 through L5 vertebra levels. Relative muscle index (RMI) equations developed here minimize correlation with both height and BMI, producing unbiased assessments of relative muscle mass across the full range of body sizes. We recommend the use of these RMI equations in other cohorts.
Published: 2024
Full Text: View/download PDF

2. Navigating the integration of knowledge and research evidence in clinical practice for children's foot health: A multi‐professional survey

Author: Lisa Hodgson, Carina Price, Julie Reay, Chris Nester, and Stewart C. Morrison
Subjects: allied health professional, evidence based practice, paediatric, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Background Access to clinical services for children with foot and ankle problems are important, but unravelling the complexity of practice and service delivery can be challenging. The pursuit and implementation of research evidence is critical for driving positive change in practice, but little is understood about the approaches to knowledge and research acquisition in children foot health. Aim The aim of the study was to: (1) explore multi‐professional habits of knowledge and research evidence acquisition in children's foot health; and (2) understand how clinicians integrate information for children and their families into their practice. Methods This was a descriptive, cross‐sectional online survey. Participants were included if they worked in the UK and had experience of working within paediatric services. Results There were complete responses from 247 health professionals, representing physiotherapists (n = 160), podiatrists (n = 50), orthotists (n = 25), nurses and specialists in community public health nurses (health visitors) (n = 12). Three main themes were generated from the data: (1) Factors that influence knowledge and inform clinical practice. (2) The role of Professional Bodies in informing professional knowledge. (3) Health Professionals' views on managing health information for parents and caregivers. Conclusions This work advances understanding of the value health professionals' place in the development of materials for informing professional knowledge, as well as highlighting some of the challenges with translation of knowledge into clinical practice. The findings offer a national perspective of health professionals working on children's foot health and have highlighted that some of the most valued influences on clinical practice come from peer‐to‐peer networking.
Published: 2024
Full Text: View/download PDF

3. Reliability of kinematic waveforms during gait analysis with total hip arthroplasty patients

Author: Ben Langley, Henrike Greaves, Chris Whelton, Richard Page, Mary Cramp, Stewart C. Morrison, Paola Dey, and Tim Board
Subjects: Total hip arthroplasty, Standard error of measurement, Reliability, Gait analysis, Lower limb, Surgery, RD1-811
Abstract: Purpose: The aim of the study was to determine the test-retest reliability of lower limb kinematic waveforms derived from 3D gait analysis (3DGA) in patients following total hip arthroplasty (THA). Methods: Eight (7 M:1F; age: 70 ± 7 years; height: 1.68 ± 0.11 m; mass: 85 ± 20 kg) adults with a unilateral THA attended test and retest sessions. 3DGA was undertaken with participants walking at a self-selected pace along a 7 m walkway within each session. The standard error or the measurement (SEM) was calculated for hip, knee and ankle joint angles in all three planes, over the walking gait cycle. Results: The SEM ranged from 2.9 to 4.1°, 2.7–3.7° and 1.9–3.9°, in the sagittal, frontal and traverse planes at the hip. At the knee the SEM ranged from 1.6 to 4.2°, 1.0–1.9° and 1.3–2.9° in the sagittal, frontal and transverse planes, respectively. While the SEM ranged from 0.7 to 2.0°, 1.2–2.3° and 2.9–4.0° in the sagittal, frontal and transverse planes at the ankle. Conclusions: The findings demonstrate that 3DGA provides a reliable means of quantifying lower limb kinematics over the walking gait cycle in patients following THA, with all SEM values below the 5° threshold previously suggested to identify clinically meaningful differences. The SEM values reported may aid in the interpretation of changes in lower limb kinematics in patients following THA.
Published: 2024
Full Text: View/download PDF

4. Telehealth experience during COVID-19 at an American burn Association (ABA) verified adult and pediatric burn center

Author: Hannan A. Maqsood, Jacob M. Dougherty, Parker Martin, Zhaohui Fan, Cindy Wegryn, Stewart C. Wang, Gary A. Vercruysse, Mark R. Hemmila, and Naveen F. Sangji
Subjects: Telehealth, Out-patient care, Burn care, Travel distance, COVID-19 pandemic, Dermatology, RL1-803, Medical emergencies. Critical care. Intensive care. First aid, RC86-88.9
Abstract: Introduction: The COVID-19 pandemic resulted in unprecedented changes to healthcare services. Non-emergent, out-patient care was either discontinued, greatly reduced, or switched to telehealth during the first wave of the pandemic. Here, we describe an American Burn Association (ABA) verified Burn Center’s experience with telehealth services during and after the COVID-19 emergency. Material and methods: In this retrospective study, all patients who underwent out-patient care at a large academic hospital’s ABA Burn Center between March 2018 and March 2023 were identified from the electronic medical record system. Descriptive analysis was carried out to delineate trends in outpatient in-person and telehealth services during the COVID-19 pandemic. The travel distance saved from the introduction of telehealth was determined. Results: During the study period, 3471 patients underwent a total of 7444 out-patient visits for burn care. There were no telehealth visits prior to the onset of the COVID-19 pandemic. In the first year of the COVID-19 pandemic, 14.9% of all out-patient visits were conducted with telehealth. This decreased to 8.3% and 6.8% of all out-patient care in the second and third years of the pandemic, respectively. The average round trip travel distance saved was 123 miles (2.8–––2312 miles). No complications were reported specific to receiving telehealth care. Conclusions: Telehealth is a feasible option for out-patient burn care in selected patients and reduces travel for patients. Further studies are needed to assess patient and clinician satisfaction, clinical outcomes, and the economic impact of telehealth utilization to help guide appropriateness of use.
Published: 2024
Full Text: View/download PDF

5. Reference distributions of aortic calcification and association with Framingham risk score

Author: Steven R. Horbal, Brian A. Derstine, Edward Brown, Grace L. Su, Stewart C. Wang, and Sven A. Holcombe
Subjects: Medicine, Science
Abstract: Abstract Evidence supporting aortic calcification as a leverageable cardiovascular risk factor is rapidly growing. Given aortic calcification’s potential as a clinical correlate, we assessed granular vertebral-indexed calcification measurements of the abdominal aorta in a well curated reference population. We evaluated the relationship of aortic calcification measurements with Framingham risk scores. After exclusion, 4073 participants from the Reference Analytic Morphomic Population with varying vertebral levels were included. The percent of the aortic wall calcified was used to assess calcification burden at the L1–L4 levels. Descriptive statistics of participants, sex-specific vertebral indexed calcification measurements, relational plots, and relevant associations are reported. Mean aortic attenuation was higher in female than male participants. Overall, mean aortic calcium was higher with reference to inferior abdominal aortic measurements and demonstrated significant differences across all abdominal levels [L3 Area (mm $$^2$$ 2 ): Females 6.34 (sd 16.60), Males 6.23 (sd 17.21); L3 Volume (mm $$^3$$ 3 ): Females 178.90 (sd 474.19), Males 195.80 (sd 547.36); Wall Calcification (%): Females (L4) 6.97 (sd 16.03), Males (L3) 5.46 (13.80)]. Participants with elevated calcification had significantly higher Framingham risk scores compared to participants with normal calcification scores. Opportunistically measuring aortic calcification may inform further cardiovascular risk assessment and enhance cardiovascular event surveillance efforts.
Published: 2023
Full Text: View/download PDF

6. Foot plantar pressure and centre of pressure trajectory differ between straight and turning steps in infants

Author: Carina Price, Eleonora Montagnani, Christopher Nester, and Stewart C. Morrison
Subjects: Medicine, Science
Abstract: Abstract Plantar pressure has been used to understand loading on infant feet as gait develops. Previous literature focused on straight walking, despite turning accounting for 25% of infant self-directed steps. We aimed to compare centre of pressure and plantar pressure in walking steps in different directions in infants. Twenty-five infants who were walking confidently participated in the study (aged 449 ± 71 days, 96 ± 25 days after first steps). Plantar pressure and video were recorded whilst five steps per infant were combined for three step types: straight, turning inwards and outwards. Centre of pressure trajectory components were compared for path length and velocity. Pedobarographic Statistical Parametric Mapping explored differences in peak plantar pressure for the three step types. Significant differences were identified primarily in the forefoot with higher peak pressures in straight steps. Centre of pressure path was longer in the medial–lateral direction during turning (outward 4.6 ± 2.3, inward 6.8 ± 6.1, straight 3.5 ± 1.2 cm, p
Published: 2023
Full Text: View/download PDF

7. Sarcopenia provides extra value outside the PULP score for predicting mortality in older patients with perforated peptic ulcers

Author: Yu-Hao Wang, Yu-San Tee, Yu-Tung Wu, Chi-Tung Cheng, Chih-Yuan Fu, Chien-Hung Liao, Chi-Hsun Hsieh, and Stewart C. Wang
Subjects: Perforated peptic ulcer, Geriatric, Sarcopenia, PULP score, Geriatrics, RC952-954.6
Abstract: Abstract Background Perforated peptic ulcer (PPU) remains challenging surgically due to its high mortality, especially in older individuals. Computed tomography (CT)-measured skeletal muscle mass is a effective predictor of the surgical outcomes in older patients with abdominal emergencies. The purpose of this study is to assess whether a low CT-measured skeletal muscle mass can provide extra value in predicting PPU mortality. Methods This retrospective study enrolled older (aged ≥ 65 years) patients who underwent PPU surgery. Cross-sectional skeletal muscle areas and densities were measured by CT at L3 and patient-height adjusted to obtain the L3 skeletal muscle gauge (SMG). Thirty-day mortality was determined with univariate, multivariate and Kaplan–Meier analysis. Results From 2011 to 2016, 141 older patients were included; 54.8% had sarcopenia. They were further categorized into the PULP score ≤ 7 (n=64) or PULP score > 7 group (n=82). In the former, there was no significant difference in 30-day mortality between sarcopenic (2.9%) and nonsarcopenic patients (0%; p=1.000). However, in the PULP score > 7 group, sarcopenic patients had a significantly higher 30-day mortality (25.5% vs. 3.2%, p=0.009) and serious complication rate (37.3% vs. 12.9%, p=0.017) than nonsarcopenic patients. Multivariate analysis showed that sarcopenia was an independent risk factor for 30-day mortality in patients in the PULP score > 7 group (OR: 11.05, CI: 1.03-118.7). Conclusion CT scans can diagnose PPU and provide physiological measurements. Sarcopenia, defined as a low CT-measured SMG, provides extra value in predicting mortality in older PPU patients.
Published: 2023
Full Text: View/download PDF

8. Using a modified nominal group technique to develop complex interventions for a randomised controlled trial in children with symptomatic pes planus

Author: Michael R. Backhouse, Daniel J. Parker, Stewart C. Morison, Jenny Anderson, Sarah Cockayne, and Joy A. Adamson
Subjects: Consensus, Consensus development, Nominal group technique, Complex interventions, Foot health advice, Insoles, Medicine (General), R5-920
Abstract: Abstract Background Children with symptomatic flat feet (pes planus) frequently present for care but there remains uncertainty about how best to manage their condition. There is considerable variation in practice between and within professions. We intend to conduct a three-arm trial to evaluate three frequently used interventions for pes planus (exercise and advice, exercise and advice plus prefabricated orthoses, and exercise and advice plus custom made orthoses). Each of these interventions are complex and required developing prior to starting the trial. This paper focusses on the development process undertaken to develop the interventions. Methods We used a modified Nominal Group Technique combining an electronic survey with two face-to-face meetings to achieve consensus on the final logic model and menu of options for each intervention. Using the Nominal Group Technique across consecutive meetings in combination with a questionnaire is novel, and enabled us to develop complex interventions that reflect contemporary clinical practice. Results In total 16 healthcare professionals took part in the consensus. These consisted of 11 podiatrists, two orthotists, two physiotherapists, and one orthopaedic surgeon. Both meetings endorsed the logic model with amendments to reflect the wider psychosocial impact of pes planus and its treatment, as well as the increasing use of shared decision making in practice. Short lists of options were agreed for prefabricated and custom made orthoses, structures to target in stretching and strengthening exercises, and elements of health education and advice. Conclusions Our novel modification of the nominal group technique produced a coherent logic model and shortlist of options for each of the interventions that explicitly enable adaptability. We formed a consensus on the range of what is permissible within each intervention so that their integrity is kept intact and they can be adapted and pragmatically applied. The process of combining survey data with face-to-face meetings has ensured the interventions mirror contemporary practice and may provide a template for other trials.
Published: 2022
Full Text: View/download PDF

9. A step in the right direction: Delphi consensus on a UK and Australian paediatric podiatry curriculum

Author: Julie Reay, Cylie Williams, Chris Nester, and Stewart C. Morrison
Subjects: Podiatry, Pre-registration, Paediatric, Curriculum, Special aspects of education, LC8-6691, Medicine
Abstract: Abstract Background Previous research shows considerable variation in pre-registration paediatric podiatry curricula, and thus the clinical skills realised prior to graduation. Whilst pre-registration training is guided by regulatory bodies, these high level principles only refer briefly to standards in paediatric practice. An estimated 9% of podiatry caseloads in the United Kingdom (UK) and Australia are dedicated to paediatric service provision. Therefore, it is imperative that curricula support the consistent development of paediatric practice enabling newly registered podiatrists to work safely and effectively with children. Given that the global healthcare work force provides unique opportunities to explicitly align international curricula, the aim of this study was to determine the priorities for a UK and Australian binational pre-registration paediatric podiatry curriculum. Methods A four round modified Delphi design was employed to ascertain consensus and agreement of a panel of experts with a special interest in paediatrics working in the UK and Australia. Round 1 contained open questions designed to promote diverse responses on the broad topics of lecturer experience and curriculum organisation and delivery. The answers from Round 1 were developed, through content analysis, into a series of statements presented to the panel for agreement in Rounds 2, 3 and 4. Results Of the 297 statements generated following Round 1, 183 were accepted and 114 rejected by the end of Round 4. 109 of the accepted statements related to curriculum content. Participants also agreed on areas relating to lecturer experience, clinical education, and assessment of paediatric skills. Conclusions This study is the first of its kind to describe elements of a curriculum for pre-registration podiatry training. The recommendations highlight opportunities that education providers can work towards during curriculum design. They also emphasise the collaboration that is needed between professional bodies, clinicians and higher education institutions when defining guidelines and expectations for paediatric specific skills.
Published: 2022
Full Text: View/download PDF

10. Automated Measurements of Body Composition in Abdominal CT Scans Using Artificial Intelligence Can Predict Mortality in Patients With Cirrhosis

Author: Winnie Y. Zou, Binu E. Enchakalody, Peng Zhang, Nidhi Shah, Sameer D. Saini, Nicholas C. Wang, Stewart C. Wang, and Grace L. Su
Subjects: Diseases of the digestive system. Gastroenterology, RC799-869
Abstract: Body composition measures derived from already available electronic medical records (computed tomography [CT] scans) can have significant value, but automation of measurements is needed for clinical implementation. We sought to use artificial intelligence to develop an automated method to measure body composition and test the algorithm on a clinical cohort to predict mortality. We constructed a deep learning algorithm using Google’s DeepLabv3+ on a cohort of de‐identified CT scans (n = 12,067). To test for the accuracy and clinical usefulness of the algorithm, we used a unique cohort of prospectively followed patients with cirrhosis (n = 238) who had CT scans performed. To assess model performance, we used the confusion matrix and calculated the mean accuracy of 0.977 ± 0.02 (0.975 ± 0.018 for the training and test sets, respectively). To assess for spatial overlap, we measured the mean intersection over union and mean boundary contour scores and found excellent overlap between the manual and automated methods with mean scores of 0.954 ± 0.030, 0.987 ± 0.009, and 0.948 ± 0.039 (0.983 ± 0.013 for the training and test set, respectively). Using these automated measurements, we found that body composition features were predictive of mortality in patients with cirrhosis. On multivariate analysis, the addition of body composition measures significantly improved prediction of mortality for patients with cirrhosis over Model for End‐Stage Liver Disease alone (P
Published: 2021
Full Text: View/download PDF

11. Head to head randomized trial of two decision aids for prostate cancer

Author: Angela Fagerlin, Margaret Holmes-Rovner, Timothy P. Hofer, David Rovner, Stewart C. Alexander, Sara J. Knight, Bruce S. Ling, James A.Tulsky, John T. Wei, Khaled Hafez, Valerie C. Kahn, Daniel Connochie, Jeffery Gingrich, and Peter A. Ubel
Subjects: Decision aids, Prostate cancer, Patient education, Literacy, Plain language, Shared decision making, Computer applications to medicine. Medical informatics, R858-859.7
Abstract: Abstract Background While many studies have tested the impact of a decision aid (DA) compared to not receiving any DA, far fewer have tested how different types of DAs affect key outcomes such as treatment choice, patient–provider communication, or decision process/satisfaction. This study tested the impact of a complex medical oriented DA compared to a more simplistic decision aid designed to encourage shared decision making in men with clinically localized prostate cancer. Methods 1028 men at 4 VA hospitals were recruited after a scheduled prostate biopsy. Participants completed baseline measures and were randomized to receive either a simple or complex DA. Participants were men with clinically localized cancer (N = 285) by biopsy and who completed a baseline survey. Survey measures: baseline (biopsy); immediately prior to seeing the physician for biopsy results (pre- encounter); one week following the physician visit (post-encounter). Outcome measures included treatment preference and treatment received, knowledge, preference for shared decision making, decision making process, and patients’ use and satisfaction with the DA. Results Participants who received the simple DA had greater interest in shared decision making after reading the DA (p = 0.03), found the DA more helpful (p’s
Published: 2021
Full Text: View/download PDF

12. Dissolved Algal Toxins along the Southern Coast of British Columbia Canada

Author: Ryan B. Shartau, Lenora D. M. Turcotte, Julia C. Bradshaw, Andrew R. S. Ross, Blair D. Surridge, Nina Nemcek, and Stewart C. Johnson
Subjects: microcystin, okadaic acid, domoic acid, SPATT, harmful algae, aquaculture, Medicine
Abstract: Harmful algal blooms (HABs) in coastal British Columbia (BC), Canada, negatively impact the salmon aquaculture industry. One disease of interest to salmon aquaculture is Net Pen Liver Disease (NPLD), which induces severe liver damage and is believed to be caused by the exposure to microcystins (MCs). To address the lack of information about algal toxins in BC marine environments and the risk they pose, this study investigated the presence of MCs and other toxins at aquaculture sites. Sampling was carried out using discrete water samples and Solid Phase Adsorption Toxin Tracking (SPATT) samplers from 2017–2019. All 283 SPATT samples and all 81 water samples tested positive for MCs. Testing for okadaic acid (OA) and domoic acid (DA) occurred in 66 and 43 samples, respectively, and all samples were positive for the toxin tested. Testing for dinophysistoxin-1 (DTX-1) (20 samples), pectenotoxin-2 (PTX-2) (20 samples), and yessotoxin (YTX) (17 samples) revealed that all samples were positive for the tested toxins. This study revealed the presence of multiple co-occurring toxins in BC’s coastal waters and the levels detected in this study were below the regulatory limits for health and recreational use. This study expands our limited knowledge of algal toxins in coastal BC and shows that further studies are needed to understand the risks they pose to marine fisheries and ecosystems.
Published: 2023
Full Text: View/download PDF

13. Piscine orthoreovirus Genotype-1 (PRV-1) in Wild Pacific Salmon of British Columbia, Canada: 2011–2020

Author: Lenora D. M. Turcotte, Julia C. Bradshaw, Mark P. Polinski, and Stewart C. Johnson
Subjects: Piscine orthoreovirus (PRV), salmon, North Pacific, British Columbia, Biology (General), QH301-705.5, Genetics, QH426-470
Abstract: Piscine orthoreovirus genotype 1 (PRV-1) is an endemic virus to the Northeastern Pacific that infects both wild and farmed salmon. To better understand PRV-1 prevalence and transmission pathways in the region, we targeted out-migrating juvenile Pacific Salmon in the Strait of Georgia and Johnstone Strait in British Columbia, Canada, for PRV-1 molecular screening with an emphasis on Chinook (Oncorhynchus tshawytscha) and Coho (Oncorhynchus kisutch) salmon. A total of 4031 individuals were screened for PRV-1 and we identified an overall virus prevalence of 3.5% from 2011 to 2020. PRV-1 was absent in enhancement facilities and freshwater catchments and predominately found in the marine environment. The detection of PRV-1 varied greatly between species, year and stock of origin, but cumulatively identified that life history and migratory behaviors likely influenced viral prevalence. Specifically, Chinook salmon, which demonstrate long residence time in the Strait of Georgia relative to other species, had the highest PRV-1 prevalence in this study (7.4%). Varying stock composition and regional detection between year classes within the Strait of Georgia further indicated that the sources for Chinook infection were highly variable between years. These findings enhance our understanding for PRV-1 transmission in the region and more generally between/within salmon species.
Published: 2023
Full Text: View/download PDF

14. Optimal body size adjustment of L3 CT skeletal muscle area for sarcopenia assessment

Author: Brian A. Derstine, Sven A. Holcombe, Brian E. Ross, Nicholas C. Wang, Grace L. Su, and Stewart C. Wang
Subjects: Medicine, Science
Abstract: Abstract Measurements of skeletal muscle cross-sectional area (SMA) at the level of the third lumbar (L3) vertebra derived from clinical computed tomography (CT) scans are commonly used in assessments of sarcopenia, the loss of skeletal muscle mass and function associated with aging. As SMA is correlated with height and Body Mass Index (BMI), body size adjustment is necessary to fairly assess sarcopenic low muscle mass in individuals of different height and BMI. The skeletal muscle index, a widely used measure, adjusts for height as $$(SMA/height^2)$$ ( S M A / h e i g h t 2 ) but uses no BMI adjustment. There is no agreed upon standard for body size adjustment. We extracted L3 SMA using non-contrast-enhanced CT scans from healthy adults, split into ‘Under-40’ and ‘Over-40’ cohorts. Sex-specific allometric analysis showed that height to the power of one was the optimal integer coefficient for height adjusted SMA in both males and females. We computed two height-adjusted measures $$SMA_{HT}=SMA/height$$ S M A HT = S M A / h e i g h t and $$SMA_{HT2}=SMA/height^2$$ S M A H T 2 = S M A / h e i g h t 2 , comparing their Pearson correlations versus age, height, weight, and BMI separately by sex and cohort. Finally, in the ‘Under-40’ cohort, we used linear regression to convert each height-adjusted measure into a z-score ( $$z(SMA_{HT})$$ z ( S M A HT ) , $$z(SMA_{HT2})$$ z ( S M A H T 2 ) ) adjusted for BMI. $$SMA_{HT}$$ S M A HT was less correlated with height in both males and females ( $$r=0.005$$ r = 0.005 , $$p=0.91$$ p = 0.91 and $$r=0.1$$ r = 0.1 , $$p=0.01$$ p = 0.01 ) than $$SMA_{HT2}$$ S M A H T 2 ( $$r=-\,0.30$$ r = - 0.30 and $$r=-\,0.21$$ r = - 0.21 , $$p
Published: 2021
Full Text: View/download PDF

15. Professional appraisal of online information about children’s footwear measurement and fit: readability, usability and quality

Author: Carina Price, Michael Haley, Anita Williams, Chris Nester, and Stewart C. Morrison
Subjects: Shoes, Measurement, Paediatric, Internet, Advice, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Background Parents increasingly use the internet to seek health information, share information and for purchasing textiles and footwear. This shift in footwear purchasing habits raises concern about how (and if) parents are getting their children’s feet measured, and what support strategies are in place to support the fit of footwear. In response to this, some companies and healthcare organisations have developed resources to support home measurement of foot size, and link these measures to footwear selection, measurement and fitting. The aim of this research was to undertake an appraisal of web-based resources about measurement and fit of children’s footwear, focussing specifically on readability, usability and quality. Methods Search terms relating to children’s foot measurement were compiled and online searching was undertaken. Search results were saved and screened for relevance. Existing resources were categorised based on their source e.g. a footwear company or a health website. The 15 most commonly identified resources were reviewed by a professional panel for readability, content, usability and validity. One researcher also assessed the accessibility and reading ease of the resources. Results Online resources were predominantly from commercial footwear companies (54%). Health information sources from professional bodies made up 4.2% of the resources identified. The top 15 resources had appropriate reading ease scores for parents (SMOG Index 4.3–8.2). Accessibility scores (the product of the number of times it appeared in search results and its ranking in the results) were highest for commercial footwear companies. The panel scores for readability ranged from 2.7 to 9 out of 10, with a similar range for content, usability and validity. Conclusions Information for parents seeking to purchase footwear for their children is readily available online but this was largely dominated by commercial footwear companies. The quality and usability of this information is of a moderate standard; notable improvements could be made to the validity of the task the child is asked to undertake and the measures being taken. Improvements in these resources would improve the data input to the selection of footwear and therefore have a beneficial impact on footwear fit in children.
Published: 2020
Full Text: View/download PDF

16. Symptomatic pes planus in children: a synthesis of allied health professional practices

Author: Stewart C. Morrison, Madeleine Tait, Elaine Bong, Kyra J. Kane, and Chris Nester
Subjects: Paediatric, Orthoses, Orthotist, Physiotherapist, Podiatrist, Feet, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Background This study sought to explore professional perspectives on the assessment and management of symptomatic pes planus in children. Methods Data was collected from three professional groups (podiatrists, physiotherapists, and orthotists) with experience of managing foot problems in children. The survey was undertaken in the United Kingdom via a self-administered, online survey. Data was captured over a four-month period in 2018. Results Fifty-five health professionals completed the survey and the results highlighted that assessment techniques varied between professions, with standing tip-toe and joint range of motion being the most common. Treatment options for children were diverse and professionals were adopting different strategies as their first line intervention. All professions used orthoses. Conclusions There were inconsistencies in how the health professionals assessed children presenting with foot symptoms, variation in how the condition was managed and differences in outcome measurement. These findings might be explained by the lack of robust evidence and suggests that more effort is needed to harmonise assessment and treatment approaches between professions. Addressing discrepancies in practice could help prioritise professional roles in this area, and better support the management of children with foot pain.
Published: 2020
Full Text: View/download PDF

17. Three-dimensional foot shape analysis in children: a pilot analysis using three-dimensional shape descriptors

Author: Matyas Varga, Carina Price, and Stewart C. Morrison
Subjects: Paediatric foot, Foot morphology, 3D scanning, Shape-index, Curvedness, Foot development, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Background Existing clinical measures to describe foot morphology are limited in that they are commonly two-dimensional, low in resolution and accuracy, and do not accurately represent the multi-planar and complex changes during development across childhood. Using three-dimensional (3D) scanner technology provides the opportunity to understand more about morphological changes throughout childhood with higher resolution and potentially more relevant 3D shape measures. This is important to advance the prevailing arguments about the typical development of children’s feet and inform the development of appropriate clinical measures. 3D shape descriptors derived from 3D scanning can be used to quantify changes in shape at each point of the 3D surface. The aim of this study was to determine whether 3D shape descriptors derived from 3D scanning data can identify differences in foot morphology between children of different ages. Methods Fifteen children were recruited from three age groups (2, 5, and 7 years of age). Both feet were scanned in bipedal stance, using the Artec Eva (Artec Group, Luxembourg, Luxembourg) hand-held scanner. Three dimensional shape descriptors were extracted from the 3D scans of the right foot, to create histograms for each age group and heat maps of representative participants for comparison. Results There were changes to the dorsal, medial and lateral surfaces of the feet with age. The surfaces became less round along with an increase in indented areas. This is supported by the heat maps which demonstrated that the surfaces of the anatomical landmarks (e.g. the malleoli and navicular tuberosity) became more rounded and protruding, with indented surfaces appearing around these landmarks. On the plantar surface, the concavity of the midfoot was evident and this concavity extended into the midfoot from the medial aspect as age increased. Conclusions The findings of this study indicated that with increasing age the foot becomes thinner in 3D, with bony architecture emerging, and the medial longitudinal arch (MLA) increases in area and concavity. Three-dimensional shape descriptors have shown good potential for locating and quantifying changes in foot structure across childhood. Three-dimensional shape descriptor data will be beneficial for understanding more about foot development and quantifying changes over time.
Published: 2020
Full Text: View/download PDF

18. Parents, health professionals and footwear stakeholders' beliefs on the importance of different features of young children's footwear: a qualitative study

Author: Cylie M. Williams, Helen A. Banwell, Kade L. Paterson, Katherine Gobbi, Sam Burton, Matthew Hill, Emma Harber, and Stewart C. Morrison
Subjects: Shoes, Children, Gait, Qualitative, Foot, Footwear, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Background A small but building pool of evidence of the impact of footwear on children's function means understanding the different beliefs of stakeholders about footwear key features and flexibility is critical for translation into recommendations and to support parents and caregivers in purchasing footwear for their children. Therefore, this research aimed to describe how different stakeholders (health professionals, parents, and footwear industry representatives) described the importance of flexibility and other footwear features for young children. Methods This qualitative study was nested within an international modified Delphi online survey. Participants responded to open‐ended questions about footwear component flexibility and asked if and why flexibility in these areas were important. Participants also described any other important footwear features. Inductive thematic analysis was used to generate themes. Results There were 121 responses from three stakeholder groups including health professionals (n = 90), parents of young children (n = 26) and footwear industry representatives (n = 5). Overarching themes described by participants included developmental impacts of footwear, therapeutic impact and how footwear may play a role in function. Conclusion There were key differences in how stakeholders viewed footwear and any perceived benefits of footwear components, much of which was not backed with empirical evidence. It was also identified that health professionals are using footwear within treatment recommendations. This work highlights the importance of understanding circumstances in which footwear may have a therapeutic impact or be the first line of treatment for children with complex foot needs. This is the first step in developing contemporary footwear recommendations for parents and caregivers.
Published: 2022
Full Text: View/download PDF

19. International approaches to paediatric podiatry curricula: It’s the same, but different

Author: Cylie M. Williams, Chris Nester, and Stewart C. Morrison
Subjects: Registration, Education, Student, Undergraduate, Children, Curriculum, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Introduction Pre-registration / entry-level programmes of study provide the core knowledge, skills and abilities required for clinical practice. These programmes are where students are introduced to specialist domains of practice and begin to shape their professional interests. The aim of this research was to describe paediatric curricula within pre-registration and entry level podiatry programmes across comparable universities and offer a contemporary synthesis of international practices. Methods An exploratory, cross-sectional, online survey was undertaken across a three-month period. Representatives from podiatry programmes delivering pre-registration or entry level podiatry degrees in which graduates are eligible for Professional and Statutory Body registration within their country (deemed at a Bachelor degree or higher), were invited to participate. The survey was administered online using Online Surveys. Descriptive statistics were used to describe the data due to the exploratory nature of the research question and design. Results There were responses from seven (54% of 13) universities in the United Kingdom (UK), nine (100% of nine) universities in Australia and four (50% of eight) of the invited universities external to the UK and Australia (New Zealand, Malta, Ireland, South Africa). There was some variation in curriculum content, but all universities reported to cover ontogeny and developmental milestones and general paediatric orthopaedic conditions. There was further discrepancy with the number of hours dedicated to paediatric podiatry within the curricula (ranging from 26 h). Conclusion The findings from this study highlight some disparity in the delivery of training for students relating to paediatrics. The data suggests that there is a need for international coordination in establishing priorities for the paediatric curricula. This will ensure consistency in baseline knowledge, modes of training, amount and nature of curriculum delivery during undergraduate or entry level podiatry training.
Published: 2019
Full Text: View/download PDF

20. Role of tumor-specific and whole-body imaging biomarkers for prediction of recurrence in patients with stage III colorectal cancer

Author: Borhani, Amir A., Zhang, Peng, Diergaarde, Brenda, Darwiche, Sophie, Chuperlovska, Kalina, Wang, Stewart C., Schoen, Robert E., and Su, Grace L.
Published: 2024
Full Text: View/download PDF

21. Correction: Using a modified nominal group technique to develop complex interventions for a randomised controlled trial in children with symptomatic pes planus

Author: Michael R. Backhouse, Daniel J. Parker, Stewart C. Morrison, Jenny Anderson, Sarah Cockayne, and Joy A. Adamson
Subjects: Medicine (General), R5-920
Published: 2022
Full Text: View/download PDF

22. Skeletal muscle cutoff values for sarcopenia diagnosis using T10 to L5 measurements in a healthy US population

Author: Brian A. Derstine, Sven A. Holcombe, Brian E. Ross, Nicholas C. Wang, Grace L. Su, and Stewart C. Wang
Subjects: Medicine, Science
Abstract: Abstract Measurements of skeletal muscle cross-sectional area, index, and radiation attenuation utilizing clinical computed tomography (CT) scans are used in assessments of sarcopenia, the loss of skeletal muscle mass and function associated with aging. To classify individuals as sarcopenic, sex-specific cutoffs for ‘low’ values are used. Conventionally, cutoffs for skeletal muscle measurements at the level of the third lumbar (L3) vertebra are used, however L3 is not included in several clinical CT protocols. Non-contrast-enhanced CT scans from healthy kidney donor candidates (age 18–40) at Michigan Medicine were utilized. Skeletal muscle area (SMA), index (SMI), and mean attenuation (SMRA) were measured at each vertebral level between the tenth thoracic (T10) and the fifth lumbar (L5) vertebra. Sex-specific means, standard deviations (s.d.), and sarcopenia cutoffs (mean-2 s.d.) at each vertebral level were computed. Associations between vertebral levels were assessed using Pearson correlations and Tukey’s difference test. Classification agreement between different vertebral level cutoffs was assessed using overall accuracy, specificity, and sensitivity. SMA, SMI, and SMRA L3 cutoffs for sarcopenia were 92.2 cm2, 34.4 cm2/m2, and 34.3 HU in females, and 144.3 cm2, 45.4 cm2/m2, and 38.5 HU in males, consistent with previously reported cutoffs. Correlations between all level pairs were statistically significant and high, ranging from 0.65 to 0.95 (SMA), 0.64 to 0.95 (SMI), and 0.63 to 0.95 (SMRA). SMA peaks at L3, supporting its use as the primary site for CT sarcopenia measurements. However, when L3 is not available alternative levels (in order of preference) are L2, L4, L5, L1, T12, T11, and T10. Healthy reference values reported here enable sarcopenia assessment and sex-specific standardization of SMA, SMI, and SMRA in clinical populations, including those whose CT protocols do not include L3.
Published: 2018
Full Text: View/download PDF

23. Big issues for small feet: developmental, biomechanical and clinical narratives on children’s footwear

Author: Stewart C. Morrison, Carina Price, Juliet McClymont, and Chris Nester
Subjects: Children, Shoes, Foot development, Maturation, Footwear, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract The effects of footwear on the development of children’s feet has been debated for many years and recent work from the developmental and biomechanical literature has challenged long-held views about footwear and the impact on foot development. This narrative review draws upon existing studies from developmental, biomechanical and clinical literature to explore the effects of footwear on the development of the foot. The emerging findings from this support the need for progress in [children’s] footwear science and advance understanding of the interaction between the foot and shoe. Ensuring clear and credible messages inform practice requires a progressive evidence base but this remains big issue in children’s footwear research.
Published: 2018
Full Text: View/download PDF

24. Development of the infant foot as a load bearing structure: study protocol for a longitudinal evaluation (the Small Steps study)

Author: Carina Price, Juliet McClymont, Farina Hashmi, Stewart C. Morrison, and Christopher Nester
Subjects: Infant biomechanics, Foot development, Milestone, Infant skin, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Background An improved understanding of the structural and functional development of the paediatric foot is fundamental to a strong theoretical framework for health professionals and scientists. An infant’s transition from sitting, through crawling and cruising, to walking is when the structures and function of the foot must adapt to bearing load. The adaptation of skin and other hard and soft tissue, and foot and gait biomechanics, during this time is poorly understood. This is because data characterising the foot tissue and loading pre-walking onset does not exist. Of the existing kinematic and plantar pressure data, few studies have collected data which reflects the real-life activities of infants with modern equipment. Methods This is a longitudinal study and part of the Great Foundations Initiative, a collaborative project between the University of Brighton and the University of Salford, which is seeking to improve foot health in children. Two cohorts of 50 infants will be recruited at the two sites (University of Brighton, Eastbourne, UK and University of Salford, Salford, UK). Infants will be recruited when they first reach for their feet and attend four laboratory visits at milestones related to foot loading, with experienced independent walking being the final milestone. Data collection will include tissue characteristics (skin thickness, texture, elasticity, pH and tendon thickness and cross-sectional area), plantar pressures and kinematics captured during real world locomotion tasks. Discussion This study will provide a database characterising the development of the infant foot as it becomes a weight bearing structure. The data will allow effective comparison and quantification of changes in structure and function due to maturation and loading by measuring pre and post established walking. Additional variables which impact on the development of the foot (gender, ethnicity and body weight) will also be factored into our analysis. This will help us to advance understanding of the determinants of foot development in early childhood.
Published: 2018
Full Text: View/download PDF

25. Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Author: Yang, Yongil, Chaffin, Timothy, Shao, Yuanhua, Balasubramanian, Vimal, Markillie, Meng, Mitchell, Hugh, Rubio-Wilhelmi, Maria, Ahkami, Amir, Blumwald, Eduardo, and Neal Stewart, C
Subjects: Populus, green tissue specific promoter, synthetic biology, synthetic promoter, water‐deficit stress, Populus, Promoter Regions, Genetic, Plants, Genetically Modified, Gene Expression Regulation, Plant, Dehydration, Stress, Physiological, Organ Specificity, Plant Leaves
Abstract: Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Published: 2024

26. Comparisons of Manual Tape Measurement and Morphomics Measurement of Patients with Upper Extremity Lymphedema

Author: Steven R. Horbal, PhD, Sung-Yu Chu, MD, Nicholas C. Wang, BS, Wen-Hui Chan, MD, Yen-Ling Huang, MD, Edward Brown, BS, Sven A. Holcombe, PhD, Paul S. Cederna, MD, Stewart C. Wang, MD, PhD, FACS, and Ming-Huei Cheng, MD, MBA
Subjects: Surgery, RD1-811
Abstract: Background:. Lymphedema is a debilitating condition characterized by swelling from lymph fluid exceeding transport capacity. A gold standard for arm measurement is not established, and measurement methods vary. This study evaluates the comparability of the tape measure and Analytic Morphomics in deriving limb circumference measurements in patients with upper extremity lymphedema. Methods:. Fifteen participants with diagnosed upper limb lymphedema were included between July 2013 and June 2017 at Chang Gung Memorial Hospital in Taipei, Taiwan. Affected and unaffected arm circumferences were measured using a flexible tape or morphomic measurement at 10 cm above and below the elbow. Computed tomography scans were standardized, processed, smoothed with a piecewise polynomial algorithm for Analytic Morphomics of arm circumference. Comparative plots, mean percent difference, and adjusted coefficient of determination (R2) were utilized to compare the consistency of both measurement procedures. Results:. The tape measure and Analytic Morphomics demonstrated consistent measures of arm circumference. On the affected arm, the mean (95% CI) difference in arm circumference between methods was 1.60 cm (0.99–2.20) above, and 0.57 cm (0.23–0.91) below the elbow. Mean percent differences in circumference was 6.65% (SD 3.52%) above and 1.38% (SD 2.11%) below the elbow. The adjusted R2 for both methods was 94% above and 96% below the elbow. Conclusions:. Analytic Morphomics showed strong consistency with the manual tape measure of arm circumference measurement in those with upper extremity lymphedema. Analytic Morphomics present an opportunity for a precise, granular measurement of limb composition for assessment of disease state and patient planning.
Published: 2019
Full Text: View/download PDF

27. Foot and ankle problems in children and young people: a population-based cohort study

Author: Rezel-Potts, Emma, Bowen, Catherine, Dunn, Kate M., Jones, Christopher I., Gulliford, Martin C., and Morrison, Stewart C.
Published: 2024
Full Text: View/download PDF

28. Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

Author: Balasubramanian, Vimal Kumar, Veličković, Dušan, Del Mar Rubio Wilhelmi, Maria, Anderton, Christopher R, Stewart, C Neal, DiFazio, Stephen, Blumwald, Eduardo, and Ahkami, Amir H
Subjects: Plant Biology, Biological Sciences, palisade mesophyll, vascular, MALDI-MSI imaging, spatial metabolomics, secondary metabolites, drought, Crop and pasture production, Plant biology
Abstract: The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue 'omics'-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar (Populus tremula× P. alba) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.
Published: 2024

29. Relative muscle indices and healthy reference values for sarcopenia assessment using T10 through L5 computed tomography skeletal muscle area

Author: Derstine, Brian A., Holcombe, Sven A., Wang, Nicholas C., Ross, Brian E., Sullivan, June A., Wang, Stewart C., and Su, Grace L.
Published: 2024
Full Text: View/download PDF

30. Letter to the editor of Acta Neurochirurgica: Combined surgical repair and venous sinus stenting for patients with skull base encephaloceles secondary to dural venous sinus stenosis

Author: Gallia, Gary L., Moghekar, Abhay, Owler, Brian K., Labeyrie, Marc-Antoine, Stewart, C. Matthew, Ishii, Masaru, and Gailloud, Philippe
Published: 2024
Full Text: View/download PDF

31. On sequences of integers with small prime factors

Author: Stewart, C. L.
Subjects: Mathematics - Number Theory, 11N25
Abstract: We show that the difference between consecutive terms in sequences of integers whose greatest prime factor grows slowly tends to infinity.
Published: 2023

32. Independent Associations of Aortic Calcification with Cirrhosis and Liver Related Mortality in Veterans with Chronic Liver Disease

Author: Horbal, Steven R., Belancourt, Patrick X., Zhang, Peng, Holcombe, Sven A., Saini, Sameer, Wang, Stewart C., Sales, Anne E., and Su, Grace L.
Published: 2024
Full Text: View/download PDF

33. Energy Homeostasis in Monotremes

Author: Stewart C. Nicol
Subjects: echidna, platypus, hibernation, leptin, thyroid, brown adipose tissue, Neurosciences. Biological psychiatry. Neuropsychiatry, RC321-571
Abstract: In 1803, the French anatomist Étienne Geoffroy Saint-Hilaire decided that the newly described echidna and platypus should be placed in a separate order, the monotremes, intermediate between reptiles and mammals. The first physiological observations showed monotremes had low body temperatures and metabolic rates, and the consensus was that they were at a stage of physiological development intermediate between “higher mammals” and “lower vertebrates.” Subsequent studies demonstrated that platypuses and echidnas are capable of close thermoregulation in the cold although less so under hot conditions. Because the short-beaked echidna Tachyglossus aculeatus, may show very large daily variations in body temperature, as well as seasonal hibernation, it has been suggested that it may provide a useful model of protoendotherm physiology. Such analysis is complicated by the very significant differences in thermal relations between echidnas from different climates. In all areas female echidnas regulate Tb within 1°C during egg incubation. The lactation period is considered to be the most energetically expensive time for most female mammals but lactating echidnas showed no measurable difference in field metabolic rate from non-lactating females, while the lactation period is more than 200 days for Kangaroo Island echidnas but only 150 days in Tasmania. In areas with mild winters echidnas show reduced activity and shallow torpor in autumn and early winter, but in areas with cold winters echidnas enter true hibernation with Tb falling as low as 4.5°C. Monotremes do not possess brown adipose tissue and maximum rates of rewarming from hibernation in echidnas were only half those of marmots of the same mass. Although echidnas show very large seasonal variations in fat stores associated with hibernation there is no relationship between plasma leptin and adiposity. Leptin levels are lowest during post-reproductive fattening, supporting suggestions that in evolutionary terms the anorectic effects of leptin preceded the adiposity signal. BMR of platypuses is twice that of echidnas although maximum metabolism is similar. High levels of thyroid hormones in platypuses may be driving metabolism limited by low body temperature. Monotremes show a mosaic of plesiomorphic and derived features but can still inform our understanding of the evolution of endothermy.
Published: 2017
Full Text: View/download PDF

34. 2263 Creating a reference analytics morphomics population from surgical patient cross-sectional imaging

Author: Katherine He, Brian Derstine, Sven Holcombe, Nicholas C. Wang, and Stewart C. Wang
Subjects: Medicine
Abstract: OBJECTIVES/SPECIFIC AIMS: Patient factors such as body mass index and functional status are commonly used in surgical decision-making and prediction of outcomes. Morphomic analysis uses semi-automated 3D cross-sectional imaging analysis to quantify tissue, organ, and bone geometry and density. These data can be used to assess patient health status. There is an emerging trend of using morphomic variables such as muscle mass and bone mineral density to predict surgical and medical outcomes. In certain cases, it has been shown to predict cancer survival more accurately than conventional staging methods. With the growing popularity of morphomic analysis, it is vital to establish baseline variability against which patient populations can be validated. Of populations receiving radiographic imaging, trauma patients are approximately representative of the general population. We created a reference population of morphomic variables from over 6000 University of Michigan patients presenting with trauma. METHODS/STUDY POPULATION: Computed tomography (CT) scans were obtained for all patients who underwent scans for trauma indications at the University of Michigan starting from April 1998. High throughput image processing algorithms written in MATLAB 2015a were used to semi-automatically process chest, abdomen, and pelvis CT scans. Scans were referenced to a common coordinate system based on vertebral levels and body anatomy. Measurements of adiposity, muscle group, and bone density measurements were performed at each level. Percentile curves of morphomic measures of body composition by age and sex were created. The reference population dataset is periodically updated and is publicly accessible. RESULTS/ANTICIPATED RESULTS: As of July 2017, over 6000 patients aged 1–81 years have been included in the Reference Analytics Morphomics Population. Patient CT scans were analyzed at the T10, T11, T12, L1, L2, L3, and L4 vertebral levels. Morphomic measures analyzed include body depth, body cross-sectional area, vertebral trabecular bone density, visceral fat area, fascia area, subcutaneous fat area, central back fat, and psoas muscle area. DISCUSSION/SIGNIFICANCE OF IMPACT: We created reference curves for several morphomic variables from a Reference Analytic Morphomics Population of over 6000 University of Michigan patients presenting with trauma.
Published: 2018
Full Text: View/download PDF

35. The Changing Carbon Cycle in the Southern Ocean

Author: Richard A. Iannuzzi, John G. Goddard, Stewart C. Sutherland, Timothy Newberger, Burke Hales, David W. Chipman, Taro Takahashi, and Colm Sweeney
Subjects: ocean carbon cycle, Southern Ocean, Oceanography, GC1-1581
Abstract: Various human activities, including fossil fuel combustion and forest clearing, emit about eight petagrams (or billion tons) of carbon in the form of CO2 into the atmosphere annually. The global ocean absorbs about two petagrams of CO2, and about a half of that amount is absorbed by the Southern Ocean south of 30°S, thus slowing the rapid accumulation of CO2 in the atmosphere. Partial pressure of CO2 (pCO2) is a measure of the chemical driving force for the CO2 exchange between the ocean and the atmosphere. This paper discusses its space and time distribution over the Southern Ocean. The major sink zone for atmospheric CO2 is located in a latitude belt between 30°S and 50°S, where the biological utilization of CO2 and cooling of warm subtropical waters flowing southward produce low seawater pCO2. Strong winds in this zone also enhance the ocean's uptake. Although the source-sink conditions vary over a wide range through the seasons in the areas south of 50°S, this zone is a small sink on an annual average. Winter observations show that surface water pCO2 values in the source region for Antarctic Intermediate Water have increased at a rate faster than the atmospheric increase rate, suggesting that the ocean CO2 sink intensity has been weakening for several decades and has changed from a net sink to a net source since 2005. The results of ocean general circulation-biogeochemistry model studies are found to be consistent with the observations.
Published: 2012

36. Time to revise our dialogue: how flat is the paediatric flatfoot?

Author: Stewart C. Morrison, Juliet McClymont, Carina Price, and Chris Nester
Subjects: Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract A recent systematic review of measures of foot development used the medial longitudinal arch profile as its primary indicator of development. A comparative analysis of existing studies was undertaken. This work confirmed changes with arch profile were age-dependent, although the age at which foot development ceased remains unknown. This work also highlighted the abundance of clinical measures used in existing research and outlined the challenges with drawing consensus from available data. There is a clear need to move this debate forward and, to do so, it is essential that scientific and clinical communities unite. It is time to abandon ill-defined measures of foot position, look beyond the medial longitudinal arch as a sole parameter of foot development and re-focus our perspective(s) on the paediatric foot in order to make advances with clinical practice and research.
Published: 2017
Full Text: View/download PDF

37. Combined Use of Unidirectional Site-Specific Recombination System and CRISPR-Cas Systems for Plant Genome Editing

Author: Yau, Yuan-Yeu, Easterling, Mona, Neal Stewart, C., Jr, Kumar, Ashwani, editor, Arora, Sudipti, editor, Ogita, Shinjiro, editor, Yau, Yuan-Yeu, editor, and Mukherjee, Krishnendu, editor
Published: 2024
Full Text: View/download PDF

38. Different cellular traffic of LDL-cholesterol and acetylated LDL-cholesterol leads to distinct reverse cholesterol transport pathwayss⃞

Author: Ming-Dong Wang, Robert S. Kiss, Vivian Franklin, Heidi M. McBride, Stewart C. Whitman, and Yves L. Marcel
Subjects: cholesterol efflux, ATP binding cassette transporter A1, ATP binding cassette transporter G1, scavenger receptor class B type I, low density lipoprotein, Biochemistry, QD415-436
Abstract: Endocytosis of LDL and modified LDL represents regulated and unregulated cholesterol delivery to macrophages. To elucidate the mechanisms of cellular cholesterol transport and egress under both conditions, various primary macrophages were labeled and loaded with cholesterol or cholesteryl ester from LDL or acetylated low density lipoprotein (AcLDL), and the cellular cholesterol traffic pathways were examined. Confocal microscopy using fluorescently labeled 3,3′-dioctyldecyloxacarbocyanine perchlorate-labeled LDL and 1,1′-dioctyldecyl-3,3,3′,3′-tetramethylindodicarbocyanine perchlorate-labeled AcLDL demonstrated their discrete traffic pathways and accumulation in distinct endosomes. ABCA1-mediated cholesterol efflux to apolipoprotein A-I (apoA-I) was much greater for AcLDL-loaded macrophages compared with LDL. Treatment with the liver X receptor ligand 22-OH increased efflux to apoA-I in AcLDL-loaded but not LDL-loaded cells. In contrast, at a level equivalent to AcLDL, LDL-derived cholesterol was preferentially effluxed to HDL, in keeping with increased ABCG1. In vivo studies of reverse cholesterol transport (RCT) from cholesterol-labeled macrophages injected intraperitoneally demonstrated that LDL-derived cholesterol was more efficiently transported to the liver and secreted into bile than AcLDL-derived cholesterol. This indicates a greater efficiency of HDL than lipid-poor apoA-I in interstitial fluid in controlling in vivo RCT. These assays, taken together, emphasize the importance of mediators of diffusional cholesterol efflux in RCT.
Published: 2007
Full Text: View/download PDF

39. Selected static foot assessments do not predict medial longitudinal arch motion during running

Author: Ben Langley, Mary Cramp, and Stewart C. Morrison
Subjects: Foot, Running, Kinematics, Medial longitudinal arch, Static foot assessment, Diseases of the musculoskeletal system, RC925-935
Abstract: Abstract Background Static assessments of the foot are commonly advocated within the running community to classify the foot with a view to recommending the appropriate type of running shoe. The aim of this work was to determine whether selected static foot assessment could predict medial longitudinal arch (MLA) motion during running. Methods Fifteen physically active males (27 ± 5 years, 1.77 ± 0.04 m, 80 ± 10 kg) participated in the study. Foot Posture Index (FPI‐6), MLA angle and rearfoot angle were measured in a relaxed standing position. MLA motion was calculated using the position of retro‐reflective markers tracked by a VICON motion analysis system, while participants ran barefoot on a treadmill at a self‐selected pace (2.8 ± 0.5 m.s−1). Bivariate linear regression was used to determine whether the static measures predicted MLA deformation and MLA angles at initial contact, midsupport and toe off. Results All three foot classification measures were significant predictors of MLA angle at initial contact, midsupport and toe off (p
Published: 2015
Full Text: View/download PDF

40. Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation

Author: Yang, Yongil, Shao, Yuanhua, Chaffin, Timothy A, Ahkami, Amir H, Blumwald, Eduardo, and Stewart, C Neal
Subjects: Biochemistry and Cell Biology, Biological Sciences, Generic health relevance, Poplar, Mesophyll protoplasts, Synthetic promoter, Fluorescence, Image analysis, Biological sciences, Biomedical and clinical sciences
Abstract: Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.
Published: 2023

41. Macrophage-specific expression of class A scavenger receptors in LDL receptor−/− mice decreases atherosclerosis and changes spleen morphology

Author: Stewart C. Whitman, Debra L. Rateri, Stephen J. Szilvassy, Joseph A. Cornicelli, and Alan Daugherty
Subjects: bone marrow transplantation, low density lipoprotein, immune function, Biochemistry, QD415-436
Abstract: Class A scavenger receptors (SR-A) have been implicated in the atherogenic process, although there have been conflicting reports as to their specific effect on the development of lesions. In part, this discord may arise because of the variable contribution of SR-A in the several cell types known to express this protein. To determine the effects of macrophage-specific SR-A expression in the atherogenic process, transgenic mice were created using the chicken lysozyme (lyso) promoter to drive expression of bovine SR-A (bSR-A). To express this gene in an atherosclerosis-susceptible strain, bone marrow cells from transgenic and non-transgenic littermates were used to repopulate lethally-irradiated female LDL receptor (LDLr)−/− mice. Following hematopoietic engraftment, mice were placed on a diet enriched in saturated fat and cholesterol. After 8 weeks, there was a modest, but statistically significant reduction in serum total cholesterol in LDLr−/− mice repopulated with lyso-bSR-A transgenic cells, due to decreased LDL-cholesterol. The extent of atherosclerosis was reduced in both cross-sectional analysis of the aortic root and en face analysis of the intimal surface of the aortic arch. In addition to changes in atherosclerosis, lyso-bSR-A repopulated LDLr−/− mice had a marked increase (3.6×) in spleen weights and a disruption of spleen white pulp formation.Therefore, macrophage-specific overexpression of SR-A resulted in reduced atherosclerosis in two vascular beds, reduced serum cholesterol concentrations, and changed the morphology of the spleen.
Published: 2002
Full Text: View/download PDF

42. Fibre digestibility, abundance of faecal bacteria and plasma acetate concentrations in overweight adult mares

Author: Megan L. Shepherd, Monica A. Ponder, Amy O. Burk, Stewart C. Milton, and William S. Swecker
Subjects: Body condition score, Digestible energy, Faecal bacteria, Horses, Nutrition. Foods and food supply, TX341-641, Medicine
Abstract: The purpose of the present study was to compare digestibility of grass hay, faecal and plasma volatile fatty acid (VFA) concentrations, and faecal bacterial abundance in overweight and moderate-condition mares. Five overweight adult mixed-breed mares and five adult mixed-breed mares in moderate condition were housed individually and limit-fed orchard grass (Dactylis glomerata) hay at 20 g/kg body weight (as fed) daily for 14 d. Forage DM and fibre digestibility were determined using AOAC methods; digestible energy was measured using bomb calorimetry; plasma and faecal VFA concentrations were determined by use of GC and MS; faecal Firmicutes, Bacteroidetes, Fibrobacter succinogenes, Ruminococcus flavefaciens and total bacteria abundance was determined by quantitative real-time PCR using previously designed phylum-specific 16S ribosomal RNA gene primers. No differences in hay digestibility, faecal VFA concentrations or faecal bacterial abundance were detected between overweight and moderate-condition mares. Mean plasma acetate concentrations were higher (P = 0·03) in overweight (1·55 (range 1·43–1·65) mmol/l) v. moderate-condition (1·39 (range 1·22–1·47) mmol/l) mares. We conclude that the higher plasma acetate in overweight mares should be further investigated as a potential link between gut microbes and obesity in horses.
Published: 2014
Full Text: View/download PDF

43. Macrophage-specific expression of class A scavenger receptors enhances granuloma formation in the absence of increased lipid deposition

Author: Alan Daugherty, Ninetta Kosswig, Joseph A. Cornicelli, Stewart C. Whitman, Sabine Wolle, and Debra L. Rateri
Subjects: cell-specific promoter, cholesterol, lysozyme, inflammation, Biochemistry, QD415-436
Abstract: Class A scavenger receptors (SR-A) have several proposed functions that could impact atherosclerosis and inflammatory processes. To define the function of SR-A in vivo, we created C57BL/6 transgenic mice that expressed bovine SR-A under the control of the restricted macrophage promoter, lysozyme (lyso-bSR-A). bSR-A mRNA was present in cultured peritoneal macrophages of transgenic mice and tissues that contain significant macrophages including spleen, lung, and ileum. Functional overexpression of SR-A was demonstrated in peritoneal macrophages both by augmented cholesterol ester deposition in response to AcLDL and enhanced adhesion in transgenic mice compared with nontransgenic littermates. To determine whether macrophage-specific expression of bSR-A regulated inflammatory responses, granulomas were generated by subcutaneous injection of carrageenan. Granuloma size was significantly increased in lyso-bSR-A transgenic mice compared with wild-type littermates [421 ± 51 mg (n = 11) vs. 127 ± 22 mg (n = 10), P < 0.001]. However, the larger granulomas in lyso-bSR-A transgenic mice were only associated with an increase in unesterified cholesterol, and not cholesterol esters. Furthermore, granulomas from transgenic mice had an increase in the number of macrophages within the tissue.Therefore, macrophage expression of bSR-A increased presence of this cell type in granulomas without enhancing the deposition of cholesterol esters, consistent with a role of the adhesive property of the protein.—Daugherty, A., N. Kosswig, J. A. Cornicelli, S. C. Whitman, S. Wolle, and D. L. Rateri. Macrophage-specific expression of class A scavenger receptors enhances granuloma formation in the absence of increased lipid deposition. J. Lipid Res. 2001. 42: 1049–1055.
Published: 2001
Full Text: View/download PDF

44. Immunomodulatory therapy in children with paediatric inflammatory multisystem syndrome temporally associated with SARS-CoV-2 (PIMS-TS, MIS-C; RECOVERY): a randomised, controlled, open-label, platform trial

Author: Faust, Saul N, Haynes, Richard, Jones, Christine E, Staplin, Natalie, Whittaker, Elizabeth, Jaki, Thomas, Juszczak, Ed, Spata, Enti, Wan, Mandy, Bamford, Alasdair, Dimitri, Paul, Finn, Adam, Furness, John, Ramanan, Athimalaipet V, Gale, Christopher, Cathie, Katrina, Drysdale, Simon, Bernatoniene, Jolanta, Murray, Clare, Roehr, Charles C, Fleming, Paul, Riordan, Andrew, Bandi, Srini, Jyothish, Deepthi, Evans, Jennifer, Emonts, Marieke, Kelly, Dominic, Pathan, Nazima, Davies, Patrick, Hague, Rosie, Pollock, Louisa, Semple, Malcolm G, Peto, Leon, Baillie, J Kenneth, Buch, Maya, Jeffery, Katie, Knight, Marian, Lim, Wei Shen, Montgomery, Alan, Mukherjee, Aparna, Mumford, Andrew, Rowan, Kathryn, Thwaites, Guy, Mafham, Marion, Emberson, Jonathan, Landray, Martin J, Horby, Peter W, Chappell, Lucy, Day, Jeremy, Dung, DV, Quang, NN, Binh, Prof, Burhan, E, Alisjahbana, B, Koirala, J, Basnet, S, Kestelyn, E, Basnyat, B, Gyanwali, P, Hamers, RL, Sandercock, P, Darbyshire, J, DeMets, D, Fowler, R, Lalloo, D, Munavvar, M, Roberts, I, Warris, A, Wittes, J, Craddock-Bamford, A, Barton, J, Basoglu, A, Brown, R, Brudlo, W, Denis, E, Fletcher, L, Howard, S, Musini, S, Taylor, K, Cui, G, Goodenough, B, King, A, Lay, M, Murray, D, Stevens, W, Wallendszus, K, Welsh, R, Crichton, C, Davies, J, Goldacre, R, Harper, C, Knight, F, Nunn, M, Salih, H, Welch, J, Campbell, M, Pessoa-Amorim, G, Zayed, M, Wiles, J, Bagley, G, Cameron, S, Chamberlain, S, Farrell, B, Freeman, H, Kennedy, A, Whitehouse, A, Wilkinson, S, Wood, C, Reith, C, Davies, K, Halls, H, Holland, L, Truell, R, Wilson, K, Lingwood, Emma, Howie, L, Lunn, M, Rodgers, Penelope, Amuasi, J, Baird, K, Bao, T, Bittaye, M, Bonney, J, D'Alessandro, U, Dhimal, M, Huyen, T, Jagne, A, Karkey, A, Maiga, O, Matey, E, Nadjm, B, Nel, J, Pant, S, Puspatriani, K, Rahardjani, M, Raijal, S, Rees, H, Rimainar, A, Roberts, C, Rocca, A, Shrestha, S, Usuf, E, Vidaillic, C, Wulandari, F, Alexander, A, Amezaga, M, Armah, C, Asghar, A, Aubrey, P, Barker-Williams, K, Barnard, A, Bartholomew, J, Beaumont-Jewell, D, Beddows, S, Beety, J, Birch, C, Boyle, P, Brend, M, Brookes, M, Callens, C, Campbell, D, Campbell, H, Cate, H, Chambers, E, Chapman, K, Coe, A, Collins, J, Crawshaw, S, Das, S, De Soyza, A, Denton, E, Dicks, P, Dolman, M, Donaldson, K, Dowden, L, Dowling, S, Drake, C, Duckles-Leech, H, Duffy, H, Gerdes, L, Gibbons, K, Gill, L, Gilmour, K, Goodwin, J, Graham, J, Green, C, Hall, C, Hall, A, Hampshire, K, Hanson, J, Harman, T, Harper, H, Harrison, S, Hicks, J, Hodgson, H, Hough, M, Jackson, S, Johnson, G, Kirk, J, Lemoine, N, Levett, C, Lock, S, Lockett, T, Logan, M, Lomme, K, Luo, J, McMillan, N, Membrey, H, Mguni, N, Minton, J, Monaghan, H, Murphy, S, Muzengi, N, Naz, M, Nickson, I, Odam, M, Ohia, U, Okell, E, Oliver, A, Pearson, K, Pine, K, Pleass, R, Porter, D, Porter, L, Potter, A, Poustie, V, Pratt, S, Price, A, Priest, A, Rodgers, A, Rook, C, Ryan, P, Sam, S, Sharratt, P, Sheffield, J, Shenton, J, Shirley, K, Skinner, T, Slade, H, Sutu, M, Taylor, J, Thomas, E, Tinkler, H, Unsworth, A, Usher, R, van't Hoff, W, Walker, S, Walters, J, Walton, E, Warmington, J, Wayman, E, Williams, P, Williamson, J, Williamson, D, Yelnoorkar, F, Knight, M, Hodson, K, Pavord, S, Williamson, C, Bowman, L, Chen, F, Clarke, R, Goonasekara, M, Herrington, W, Judge, P, Ng, S, Preiss, D, Sammons, E, Zhu, D, Arkley, C, Bowker, P, Bruce, J, Byrne-Watts, V, Chapman, G, Coleman, G, Denwood, T, Gray, J, Harrison, D, Mather, N, Pinches, H, Rees, A, Rees, S, Turner, G, Abani, O, Abbas, A, Abbas, F, Abbas, J, Abbas, K, Abbas, M, Abbasi, S, Abbass, H, Abbott, A, Abdallah, N, Abdelaziz, A, Abdelfattah, M, Abdelqader, B, Abdul, A, Abdul, B, Abdul, S, Abdul Rasheed, A, Abdulakeem, A, Abdul-Kadir, R, Abdullah, A, Abdulmumeen, A, Abdul-Raheem, R, Abdulshukkoor, N, Abdusamad, K, Abed El Khaleq, Y, Abedalla, M, Abeer Ul Amna, A, Abel, L, Abernethy, K, Abeywickrema, M, Abhinaya, C, Aboaba, A, Aboagye-Odei, A, Aboelela, H, Abo-Leyah, H, Abouelela, K, Abou-Haggar, A, Abouibrahim, M, Abousamra, A, Abouzaid, M, Abraham, M, Abraham, T, Abraheem, A, Abrams, J, Abrams, R, Abu, H, Abu-Arafeh, A, Abubacker, S, Abung, A, Abusamra, Y, Aceampong, Y, Achara, A, Acharya, D, Acheampong, S, Acheampong, P, Acheson, J, Achieng, S, Acosta, A, Acquah, R, Acton, C, Adabie-Ankrah, J, Adair, P, Adam, F, Adam, M, Adamali, H, Adamczyk, M, Adams, C, Adams, D, Adams, K, Adams, L, Adams, N, Adams, R, Adams, T, Adamu-Ikeme, L, Adati, K, Adcock, K, Addo, A, Adeagbo, O, Adebiyi, A, Adedeji, O, Adegeye, Y, Adegoke, K, Adell, V, Adenwalla, S, Adeoye, F, Adesemoye, O, Adewunmi, E, Adeyanju, A, Adeyemi, J, Adeyemo, T, Adhikary, R, Aditya, A, Adkins, G, Adnan, A, Aeron-Thomas, J, Affleck, D, Afnan, C, Afridi, M, Aftab, Z, Agarwal, M, Agbeko, R, Agbo, C, Aggarwal, S, Aghababaie, A, Aguilar Jimenez, L, Ahamed Sadiq, S, Ahammed Nazeer, M, Ahmed, A, Ahmed, B, Ahmed, F, Ahmed, H, Ahmed, I, Ahmed, K, Ahmed, L, Ahmad, M, Ahmed, N, Ahmed, O, Ahmed, R, Ahmad, S, Ahmed, S H, Ahmed Ali, R, Ahmed Mohamud, B, Ahmer, S, Ahonia, A, Aiken, C, Ail, D, Ainsworth, M, Aissa, M, Aitken, L, Ajay, B, Ajibode, A, Ajmi, A, Akhtar, N, Akili, S, Akinbiyi, B, Akindolie, O, Akinfenwa, Y, Akinkugbe, O, Akinpelu, I, Akram, M, Aktinade, O, Akudi, U, Al Aaraj, A, Al Balushi, A, Al Dakhola, M, Al Swaifi, A, Al-Abadi, E, Alabi, A, Aladangady, N, Alafifi, M, Alam, A, Alam, S, Al-Asadi, A, Alatzoglou, K, Albert, P, Albon, L, Alcala, A, Alcorn, G, Alcorn, S, Aldana, A, Alderdice, D, Aldesouki, A, Aldouri, R, Aldridge, J, Aldridge, N, Alegria, A, Alexander, C, Alexander, J, Alexander, P, Al-Fori, J, Alghazawi, L, Alhabsha, O, Al-Hakim, B, Alhameed, R, Al-Hayali, M, Al-Hity, S, Ali, A, Ali, F, Ali, J, Ali, M, Ali, N, Ali, O, Ali, R, Ali, S, Aliberti, E, Alin, J, Alina, A, Alipustain, A, Aliyuda, F, Alizaedeh, K, Al-Jibury, M, Al-Juboori, S, Al-Khalil, M, Alkhudhayri, A, Alkhusheh, M, Allan, F, Allan, N, Allanson, A, Allcock, R, Allen, E, Allen, J, Allen, K, Allen, L, Allen, P, Allen, R, Allen, S, Allen, T, Alli, A, Allison, K, Allman, B, Allsup, D, Allsop, H, Allsop, L, Almahroos, A, Al-Moasseb, H, Al-Obaidi, M, Alomari, L, Al-Rabahi, A, Al-Ramadhani, B, Al-Saadi, Z, Al-Sammarraie, R, Alshaer, I, Al-Shahi Salman, R, Al-Shamkhani, W, Alsheikh, F, Al-Sheklly, B, Altaf, S, Alty, A, Alvarez, M, Alvarez Corral, M, Alveyn, E, Alzetani, M, Amamou, S, Amar, N, Ambalavanan, S, Ambrogetti, R, Ambrose, C, Ameen, A, Ames, K, Amin, A, Amin, K, Amin, S, Amin, T, Amit, B, Amjad, A, Amjad, N, Amosun, V, Amsal, M, Amsha, K, Amutio Martin, N, Amy, P, Anada, A, Anand, A, Anandappa, S, Anantapatnaikuni, S, Anderson, E, Anderson, J, Anderson, L, Anderson, M, Anderson, N, Anderson, R, Anderson, S, Anderson, W, Andreou, P, Andrews, A, Andrews, J, Aneke, K, Ang, A, Ang, W, Angel, T, Angela, A, Angelini, P, Anguvaa, L, Anichtchik, O, Anim-Somuah, M, Aniruddhan, K, Annett, J, Anning, L, Anstey, P, Anstey, R, Anthony, A, Anthony-Pillai, A, Antill, P, Antonnia, Z, Anu, V, Anwar, M, Apetri, E, Apostolopoulos, A, Appleby, S, Appleyard, D, Aquino, M, Araba, B, Aransiola, S, Araujo, M, Archer, A, Archer, D, Archer, S, Arcoria, D, Ardley, C, Arias, A, Aribike, O, Arimoto, R, Armata, I, Armistead, J, Armitage, A, Armstrong, C, Armstrong, M, Armstrong, S, Armstrong, W, Armtrong, P, Arndt, H, Arnison-Newgass, C, Arnold, D, Arnold, R, Arnott, A, Arora, D, Arora, R, Arora, K, Arora, P, Arter, A, Arumaithurai, A, Arya, A, Arya, R, Asandei, D, Asghar, M, Ashab, M, Ashbrook-Raby, C, Ashby, H, Ashcroft, J, Ashcroft, S, Asher, G, Ashfak, Z, Ashfaq, A, Ashish, A, Ashley, D, Ashman-Flavell, S, Ashok, S, Ashour, A, Ashraf, S, Ashraf, M, Ashraq, M, Ashton, D, Ashton, S, Ashworth, A, Ashworth, F, Ashworth, R, Aslam, A, Aslam, I, Aslam, S, Aslett, L, Asogan, H, Asrar, A, Assaf, O, Astin-Chamberlain, R, Athorne, D, Atkins, B, Atkins, C, Atkins, S, Atkinson, J, Atkinson, V, Atomode, A, Atraskiewicz, B, Attia, A, Attubato, E, Attwood, M, Auer, Z, Aujayeb, A, Aung, A, Aung, H, Aung, K, Aung, N, Aung, Y, Aung, Z, Austin, E, Austin, K, Auwal, A, Avari, M, Avery, M, Aveyard, N, Avis, J, Aviss, G, Avram, C, Avram, P, Awadelkareem, A, Awadzi, G, Awaly, M, Awan, A, Awoseyila, A, Aya, A, Ayaz, E, Ayers, A, Azam, J, Azeem, A, Azharuddin, M, Aziz, A, Aziz, G, Aziz, I, Aziz, N, Azkoul, A, Azman Shah, A, Azzopardi, G, Azzoug, H, Babatunde, F, Babi, M, Babiker, B, Babington, G, Babirecki, M, Babores, M, Babs-Osibodu, A, Bacciarelli, S, Bachar, R, Bachour, M, Bacon, G, Bacon, J, Badal, B, Bader, M, Badhan, G, Badhrinarayanan, S, Bae, J, Baggaley, A, Baggott, A, Bagmane, D, Bagshaw, L, Bahadori, K, Bailey, A, Bailey, J, Bailey, K, Bailey, L, Bailey, M, Bailey, P, Bailey, S, Baillie, H, Baillie, J, Bain, J, Bains, V, Baird, D, Baird, E, Baird, S, Baird, T, Baird, Y, Bajandouh, A, Baker, D, Baker, E, Baker, J, Baker, K, Baker, M, Baker, R, Baker, T, Baker, V, Bakere, H, Bakerly, N, Baker-Moffatt, M, Bakhai, A, Bakhtiar, N, Bakoulas, P, Bakthavatsalam, D, Balachandran, N, Balan, A, Balasingam, P, Balaskas, T, Balasubramania, M, Balatoni, N, Balcombe, A, Baldwin, A, Baldwin, C, Baldwin, D, Baldwin, F, Baldwin-Jones, R, Bale, N, Balfour, J, Ball, R, Ball, M, Ballard, K, Balluz, I, Balmforth, C, Balogh, E, Baltmr, A, Baluwala, A, Bambridge, G, Bamford, P, Bamford, A, Bamgboye, A, Bancroft, H, Bancroft, E, Banda, J, Bandaru, K, Bandla, N, Bandyopadhyam, S, Banerjee, A, Banerjee, R, Bani-Saad, O, Banks, H, Banks, L, Banks, P, Bann, C, Bannister, H, Bannister, O, Banton, L, Baptist, M, Baqai, T, Baral, A, Baramova, D, Barbe, R, Barbon, E, Barbosa, M, Barbour, J, Barclay, A, Barclay, C, Bardsley, G, Bareford, S, Bari, S, Barker, A, Barker, D, Barker, E, Barker, H, Barker, J, Barker, L, Barker, O, Barkha, S, Barla, J, Barlow, G, Barlow, R, Barlow, V, Barnacle, J, Barnes, D, Barnes, N, Barnes, R, Barnes, T, Barnetson, C, Barnett, A, Barnett-Vanes, A, Barnsley, W, Barr, A, Barr, C, Barr, D, Barr, J, Barratt, N, Barratt, S, Barrera, M, Barrett, A, Barrett, F, Barrett, J, Barrett, S, Barrow, E, Bartlett, C, Bartlett, G, Bartlett, J, Bartlett, L, Bartley, S, Bartolmeu-Pires, S, Barton, A, Barton, G, Barton, L, Barton, R, Baruah, R, Baryschpolec, S, Bashir, H, Bashyal, A, Basker, B, Basran, A, Bassett, G, Bassett, J, Bassford, C, Bassoy, B, Bastion, V, Basumatary, A, Basvi, P, Bataduwaarachchi, V, Bate, T, Bateman, H, Bateman, K, Bateman, V, Bates, E, Bates, H, Bates, M, Bates, S, Batham, S, Batista, A, Batla, A, Batra, D, Batty, A, Batty, H, Batty, T, Baum, M, Baumbe, R, Bautista, C, Bawa, T, Bawa, F, Bawani, F, Bax, S, Baxter, M, Baxter, N, Baxter, Z, Bayes, H, Bayo, L-A, Bazari, F, Bazaz, R, Bazli, A, Beacham, L, Beadles, W, Beadon, K, Beak, P, Beale, A, Beard, K, Beardsal, K, Bearpark, J, Beasley, A, Beattie, S, Beaumont, K, Beaver, T, Beavis, S, Beazley, C, Beck, S, Beckett, V, Beckitt, R, Beckley, S, Beddall, H, Beeby, D, Beeby, S, Beech, G, Beecroft, M, Beer, S, Beer, N, Bega, G, Begg, A, Begg, S, Beghini, S, Begum, A, Begum, S, Behan, T, Behrouzi, R, Beishon, J, Beith, C, Belcher, J, Belfield, H, Belfield, K, Belgaumkar, A, Bell, D, Bell, G, Bell, J, Bell, L, Bell, N, Bell, P, Bell, S, Bellamu, J, Bellamy, M, Bellamy, T, Bellini, A, Bellis, A, Bellis, F, Bendall, L, Benesh, N, Benetti, N, Benham, L, Benison-Horner, G, Benkenstein, S, Benn, T, Bennett, A, Bennett, C, Bennett, D, Bennett, G, Bennett, K, Bennett, L, Bennett, M, Bennett, S, Bennion, K, Benoy, G, Benson, V, Bentley, A, Bentley, J, Benton, I, Beranova, E, Beresford, M, Bergin, C, Bergstrom, M, Berriman, T, Berry, Z, Best, K, Best, F, Bester, A, Beuvink, Y, Bevan, E, Bevins, S, Bewick, T, Bexley, A, Beyatli, S, Beynon, F, Bhadi, A, Bhagani, S, Bhakta, S, Bhalla, R, Bhandal, K, Bhandari, A, Bhandari, S, Bhanich Supapol, J, Bhanot, A, Bhanot, R, Bhasin, S, Bhat, A, Bhat, P, Bhatnagar, R, Bhatt, K, Bhayani, J, Bhojwani, D, Bhuie, P, Bhuiyan, S, Bibby, A, Bibi, F, Bibi, N, Bibi, S, Bicanic, T, Bidgood, S, Bigg, J, Biggs, S, Biju, A, Bikov, A, Billingham, S, Billings, J, Binns, A, BinRofaie, M, Bintcliffe, O, Birch, J, Birchall, K, Bird, S, Birt, M, Bishop, C, Bishop, K, Bishop, L, Bisnauthsing, K, Biswas, N, Biuk, S, Blachford, K, Black, E, Black, H, Black, K, Black, M, Black, P, Black, S, Blackgrove, H, Blackledge, B, Blackler, J, Blackley, S, Blackman, H, Blackstock, C, Blair, C, Blakemore, F, Blamey, H, Bland, A, Blane, S, Blankley, S, Blaxill, P, Blaylock, K, Blazeby, J, Blencowe, N, Bloom, B, Bloomfield, J, Bloss, A, Blowers, A, Blows, S, Bloxham, H, Blundell, L, Blunsum, A, Blunt, M, Blunt, T, Blyth, I, Blyth, K, Blythe, A, Blythe, K, Boampoaa, M, Board, S, Bobie, B, Bobruk, K, Bodalia, P, Bodasing, N, Boden, M, Bodenham, T, Boehmer, G, Boffito, M, Bohanan, K, Bohmov, K, Bohnacker, N, Bokhandi, S, Bokhar, M, Bokhari, S, Bokobza, I, Boles, A, Bolger, C, Bond, C, Bond, H, Bond, S, Bond, T, Bone, A, Boniface, G, Bonney, L, Booker, L, Boot, S, Boothroyd, M, Borbone, J, Borman, N, Bosence, S, Bostock, K, Botting, N, Bottrill, F, Bouattia, H, Bough, L, Boughton, H, Boult, Z, Boumrah, T, Bourke, M, Bourke, S, Bourne, M, Bousfield, R, Boustred, L, Bowes, A, Bowker, T, Bowler, H, Bowman, S, Bowmer, R, Bowring, A, Bowyer, H, Boyd, A, Boyd, J, Boyd, L, Boyer, N, Boyle, N, Boyle, R, Boyles, L, Brace, L, Bracken, A, Bradder, J, Bradley, C, Bradley, P, Bradley-Potts, J, Bradshaw, L, Bradshaw, Z, Brady, C, Brady, R, Brady, S, Braga Sardo, P, Braganza, D, Braithwaite, M, Brammer, S, Branch, M, Brankin-Frisby, T, Brannigan, J, Brattan, S, Bray, F, Bray, N, Brazil, M, Brear, L, Brear, T, Brearey, S, Bremner, L, Bresges, X, Bressington, C, Bretland, G, Brewer, C, Bridgett, M, Bridgwood, G, Brigham, S, Bright, J, Brightling, C, Brigstock, T, Brimfield, L, Brinksman, P, Brinkworth, E, Brittain-Long, R, Britten, V, Britton, H, Broad, L, Broadhead, S, Broadhurst, R, Broadley, A, Broadway, M, Brockelsby, C, Brocken, M, Brockley, T, Brodsky, M, Brogan, F, Brohan, L, Brokke, F, Brolly, J, Bromley, D, Brooke-Ball, H, Brooker, V, Brooking, D, Brooks, A, Brooks, D, Brooks, J, Brooks, K, Brooks, N, Brooks, P, Brooks, R, Brooks, S, Broom, M, Broomhead, N, Broughton, N, Broughton, C, Brouns, M, Brown, A, Brown, C, Brown, E, Brown, H, Brown, J, Brown, L, Brown, N, Brown, P, Brown, S, Brown, T, Browne, B, Browne, C, Browne, D, Browne, M, Browne, N, Brownlee, S, Brraka, A, Bruce, M, Brunchi, A, Brunskill, N, Brunton, A, Brunton, M, Bryant, M, Bryden, E, Brzezicki, H, Buazon, A, Buchan, R, Buchanan, R, Buche, D, Buck, L, Buck, A, Buckland, M, Buckley, C, Buckley, L, Buckley, P, Buckley, S, Buckman, C, Budds, A, Bugg, G, Bujazia, R, Bukhari, M, Bukhari, S, Bulbulia, R, Bull, A, Bull, D, Bull, K, Bull, R, Bull, T, Bullock, E, Bullock, S, Bulteel, N, Bumunarachchi, K, Bungue-Tuble, R, Burbidge, O, Burchett, C, Burda, D, Burden, C, Burden, T, Burgess, M, Burgess, R, Burgess, S, Burhan, H, Burke, H, Burke, K, Burman, A, Burnard, S, Burnett, C, Burnett, S, Burns, A, Burns, C, Burns, J, Burns, K, Burrage, D, Burrows, K, Burston, C, Burton, A, Burton, B, Burton, F, Burton, H, Burton, M, Butcher, D, Butler, A, Butler, E, Butler, J, Butler, P, Butler, S, Butt, A, Butt, M, Butterworth, C, Butterworth-Cowin, N, Buttery, R, Buttle, T, Button, H, Buttress, D, Bye, H, Byrne, J, Byrne, W, C Ooi, H, Cabandugama, A, Cabrero, L, Caddy, S, Cade, R, Cadwgan, A, Cahilog, Z, Cairney, D, Calderwood, J, Caldow, D, Cale, E, Calisti, G, Callaghan, D, Callaghan, J, Callum, D, Calver, C, Cambell-Kelly, M, Camburn, T, Cameron, D, Cameron, E, Cameron, F, Camm, C, Cammack, R, Campbell, A, Campbell, B, Campbell, J, Campbell, K, Campbell, R, Campbell, W, Campbell Hewson, Q, Camsooksai, J, Canclini, L, Candido, S, Candlish, J, Caneja, C, Cann, A, Cann, J, Cannan, R, Cannon, A, Cannon, E, Cannon, M, Cannon, P, Cannons, V, Canonizado, E, Cantliff, J, Caplin, B, Capocci, S, Caponi, N, Capp, A, Capstick, R, Capstick, T, Caraenache, C, Card, A, Cardwell, M, Carey, C, Carey, R, Carley, S, Carlin, F, Carlin, T, Carmichael, S, Carmody, M, Carnahan, M, Caroline, C, Carpenter, J, Carr, S, Carrasco, A, Carrington, Z, Carroll, A, Carroll, P, Carson, R, Cart, C, Carter, E, Carter, J, Carter, M, Carter, N, Carter, P, Cartwright, D, Cartwright, J, Carty, C, Carty, L, Carungcong, J, Carver, C, Carver, E, Carver, R, Casey, S, Cassells, A, Castiello, T, Castle, G, Castles, B, Caswell, M, Catana, A, Catelan Zborowski, A, Cathcart, S, Catibog, D, Catley, C, Catlow, L, Caudwell, M, Cavazza, A, Cave, A, Cave, L, Cavinato, S, Cawa, F, Cawley, K, Caws, C, Cawthorne, K, Cendl, H, Century, H, Cernova, J, Cesay, M, Cetti, E, Chabane, S, Chablani, M, Chabo, C, Chacko, C, Chadwick, R, Chadwick, J, Chadwick, D, Chakkaraphani, E, Chakraborty, A, Chakraborty, M, Chakravorty, M, Chalakova, P, Chalmers, R, Chalmers, J, Chamberlain, G, Chambers, J, Chambers, L, Chambers, N, Chan, A, Chan, C, Chan, E, Chan, J, Chan, K, Chan, P, Chan, R, Chan, X, Chandler, C, Chandler, H, Chandler, K, Chandler, Z, Chandra, S, Chandran, N, Chandrasekaran, B, Chang, Y, Chanlder, S, Chaplin, G, Chaplin, J, Chapman, J, Chapman, L, Chapman, M, Chapman, P, Chapman, T, Chappel, L, Charalambou, A, Charles, B, Charlton, D, Charlton, S, Chatar, K, Chatha, C, Chatterton, D, Chaube, R, Chaudhary, M, Chaudhry, I, Chaudhry, Z, Chaudhuri, N, Chaudhury, M, Chauhan, A, Chauhan, R, Chavasse, A, Chavasse, N, Chawla, V, Cheater, L, Cheaveau, J, Cheeld, C, Cheeseman, M, Chen, H, Chen, T, Cheng, F, Cheng, L, Cheng, Z, Chenoweth, H, Cheong, C, Cherian, S, Cherrie, M, Cheshire, H, Cheung, C, Cheung, E, Cheung, K, Cheung, M, Cheyne, C, Chhabra, S, Chia, W, Chiang, E, Chiapparino, A, Chicano, R, Chikungwa, M, Chikwanha, Z, Chilcott, G, Chilcott, S, Chilvers, A, Chimbo, P, Chin, K, Chin, W, Chineka, R, Chingale, A, Chinonso, E, Chin-Saad, C, Chirgwin, M, Chisem, H, Chisenga, C, Chisholm, C, Chisnall, B, Chiswick, C, Chita, S, Chitalia, N, Chiu, M, Chiverton, L, Chivima, B, Chmiel, C, Choi, S, Choon Kon Yune, W, Chopra, M, Choudhary, V, Choudhury, O, Choudhury, S, Chow, B, Chowdhury, M, Chowdhury, S, Chrisopoulou, A, Christenssen, V, Christian, P, Christides, A, Christie, F, Christmas, D, Christoforou, G, Christopherson, T, Christou, A, Christy, M, Chrysostomou, P, Chua, Y, Chudgar, D, Chudleigh, R, Chukkambotla, S, Chukwu, M, Chukwulobelu, I, Chung, C, Church, E, Church, S, Churchill, D, Cianci, N, Cicconi, P, Cinardo, P, Cipinova, Z, Cipriano, B, Clamp, S, Clancy, B, Clapham, M, Clare, E, Clare, S, Clark, A, Clark, C, Clark, D, Clark, E, Clark, F, Clark, G, Clark, J, Clark, K, Clark, L, Clark, M, Clark, N, Clark, P, Clark, R, Clark, T, Clark, Z, Clarke, A, Clarke, J, Clarke, P, Clarke, S, Claxton, A, Claxton, L, Clay, K, Clayton, E, Clayton, C, Clayton, O, Clayton-Smith, J, Clearyb, B, Cleaver, C, Cleeton, R, Clement, I, Clemente de la Torre, C, Clements, J, Clements, S, Clenton, S, Cliff, S, Clifford, R, Clifford, S, Clive, A, Clouston, J, Clubb, V, Clueit, S, Clutterbuck, L, Clyne, A, Coakley, M, Coakley, P, Cobain, K, Cochrane, A, Cochrane, P, Cockayne, L, Cockerell, M, Cockerill, H, Cocks, S, Codling, R, Coetzee, S, Coey, D, Cohen, D, Cohen, J, Cohen, O, Cohn, M, Coke, L, Coker, O, Colbeck, N, Colbert, R, Cole, E, Cole, J, Coleman, M, Coleman, N, Coles, H, Colin, M, Colino-Acevedo, A, Colley, J, Collie, K, Collier, A, Collier, D, Collier, H, Collingwood, T, Collini, P, Collins, E, Collins, K, Collins, M, Collins, N, Collins, S, Collins, V, Collinson, A, Collinson, B, Collinson, J, Collis, M, Colmar, M, Colton, H, Colton, J, Colville, K, Colvin, C, Combes, E, Comer, D, Comerford, A, Concannon, D, Condliffe, A, Condliffe, R, Connell, E, Connell, L, Connell, N, Connelly, K, Connolly, G, Connor, E, Conroy, A, Conroy, K, Conteh, V, Convery, R, Conway, F, Conway, G, Conway, R, Conyngham, J, Cook, A, Cook, C, Cook, E, Cook, G, Cook, H, Cook, J, Cook, M, Cook, S, Cooke, D, Cooke, G, Cooke, H, Cooke, J, Cooke, K, Cooke, T, Cooke, V, Cooper, A, Cooper, C, Cooper, D, Cooper, H, Cooper, J, Cooper, L, Cooper, N, Cooper, R, Cooray, S, Cope, T, Corbet, C, Corbet, S, Corbishley, A, Corcoran, J, Cordell, C, Cordle, J, Corfield, A, Corless, J, Corlett, A, Cornwell, J, Cornwell, M, Corogeanu, D, Corr, A, Corredera, M, Corrigan, R, Corry, P, Corser, R, Cort, J, Cosgrove, D, Cosier, T, Costa, P, Costa, T, Coston, C, Cotgrove, S, Coton, Z, Cottam, L, Cotter, R, Cotterill, D, Cotton, C, Couch, G, Coulding, M, Coull, A, Counsell, D, Counter, D, Coupland, C, Courtney, E, Courtney, J, Cousins, R, Coutts, A, Cowan, A, Cowan, E, Cowan, R, Cowell, R, Cowen, L, Cowman, S, Cowton, A, Cox, E, Cox, G, Cox, H, Cox, K, Cox, M, Coy, K, Craig, H, Craig, J, Craig, V, Craighead, F, Cramp, M, Cranston, H, Crasta, S, Crause, J, Crawford, A, Crawford, E, Crawford, I, Creagh-Brown, B, Creamer, A, Creaser-Myers, A, Cremona, J, Cremona, S, Crepet, A, Cresswell, J, Cribb, M, Crilly, D, Crisp, L, Crisp, N, Crocombe, D, Croft, M, Crooks, J, Crosby, H, Cross, E, Cross, T, Crothers, A, Crotty, S, Crouch, S, Crow, M, Crowder, A, Crowley, K, Crowley, T, Croysdill, R, Cruickshank, C, Cruickshank, I, Cruise, J, Cruz, C, Cruz Cervera, T, Cryans, D, Cui, H, Cullen, L, Cummings-Fosong, G, Cunliffe, V, Cunningham, N, Cupitt, J, Curgenven, H, Curnow, G, Curran, D, Curran, S, Currie, C, Currie, J, Currie, S, Curtis, J, Curtis, K, Curtis, M, Curtis, O, Curtis, T, Cuthbertson, R, Cuthill, J, Cutler, S, Cutts, S, Czekaj, M, Czylok, P, d Sausmarez, E, D'Souza, S, da Rocha, J, Dafalla, M, Dagens, A, Daggett, H, Daglish, J, Dahiya, S, Dale, A, Dale, K, Dale, M, Dale, S, Dales, J, Dalgleish, H, Dallow, H, D'aloia, C, Dalton, D, Dalton, M, Daly, Z, Damani, M, Damm, E, Danga, A, Dangerfield, J, Daniel, A, Daniel, P, Daniels, A, Dann, A, Danso-Bamfo, S, Darby, S, Darbyshire, A, Dargan, P, Dark, P, Darlington, K, Darnell, S, Darton, T, Darylile, G, Das, A, Das, M, Daschel, M, Dasgin, J, Datta, D, Daunt, A, Dave, V, Davenport, E, Davey, M, David, M, Davidson, A, Davidson, L, Davidson, N, Davidson, R, Davies, A, Davies, B, Davies, C, Davies, D, Davies, E, Davies, F, Davies, G, Davies, H, Davies, L, Davies, M, Davies, N, Davies, O, Davies, R, Davies, S, Davis, A, Davis, J, Davis, K, Davis, P, Davis-Cook, A, Davison, A, Dawe, H, Dawe, C, Dawkins, M, Dawson, A, Dawson, D, Dawson, E, Dawson, I, Dawson, J, Dawson, L, Dawson, M, Dawson, S, Dawson, T, Daxter, A, Day, A, Day, J, D'Costa, J, De, P, de Fonseka, D, de Freitas, T, De Pretto, R, De Santana Miranda, F, de Silva, S, de Silva, T, De Sousa, J, De Sousa, P, de Souza, J, De Souza, P, de Vere, N, de Vos, J, Deacon, B, Dealing, S, Dean, A, Dean, J, Dean, K, Dean, S, Dean, T, Deane, J, Dear, J, Dearden, E, Deas, C, Debbie, S, Debreceni, G, Deelchand, V, Deeley, M, Deery, J, Defever, E, Del Forno, M, De-La-Cedra, G, Dell, A, DelRosa, A, Demetriou, C, Democratis, J, Denham, J, Denley, L, Denmade, C, Dent, A, Dent, K, Dent, M, Deole, N, Depala, D, Depante, M, Dermody, S, Desai, A, Desai, P, Deshpande, S, Deshpande, V, Devkota, S, Devonport, D, Devonport, M, Dey, P, Dey, V, Deylami, R, Dhaliwal, K, Dhani, S, Dhanoa, A, Dhar, M, Dhariwal, A, Dharmasena, D, Dhasman, D, Dhillon, E, Dhillon, R, Dhillon, S, Dhiru, D, Dhorajiwala, T, Dias, P, Diaz, S, Diaz-Pratt, K, Dibas, M, Dickerson, D, Dickson, M, Dickson, S, Digby, J, Digpal, R, Dillane, S, Diment, S, Dimitriadis, G, Din, S, Dipper, A, Dipro, S, Dirmantaite, L, Dismore, L, Ditchfield, L, Diver, S, Diwakar, L, Diwan, P, Dixon, C, Dixon, G, Dixon, K, Djeugam, B, Dlouhy, P, D'Mello, A, Dobbie, L, Dobranszky Oroian, M, Dobson, C, Dobson, L, Docherty, M, Dockrell, D, Dodd, J, Dodds, J, Dodds, R, Dodds, S, Dogra, R, Doherty, C, Doherty, E, Doherty, W, Doi, Y, Doig, I, Doke, E, Dolan, D, Dolman, R, Donald, K, Donald, L, Donaldson, C, Donaldson, D, Donaldson, G, Donlon, S, Donnachie, J, Donnelly, E, Donnelly, R, Donnison, P, Donohoe, A, Donohoe, G, Donohue, B, Dooks, E, Doonan, R, Doran, G, Dore, R, Dorey, K, Dorgan, S, Dos Santos, K, Dosani, M, Dosanjh, D, Dospinescu, P, Doss, I, Doudouliaki, T, Dougherty, A, Doughty, J, Douglas, K, Douse, J, Dow, A, Dower, M, Downer, N, Downes, C, Downes, R, Downes, T, Downey, D, Downey, R, Downing, C, Downs, L, Dowson, S, Dragan, C, Dragos, C, Drain, M, Drew, V, Drewett, O, Drexel, A, Driscoll, C, Drogan, H, Drosos, O, Drummond, G, Drury, K, Druryk, K, Druyeh, R, Dryburgh-Jones, J, Du Thinh, A, Dube, H, Dube, J, Duberley, S, Duckenfield, P, Duff, N, Duffield, E, Duffy, K, Dufour, L, Duggan, A, Dugh, P, Duhoky, R, Duignan, J, Dulay, J, Dummer, S, Duncan, A, Duncan, C, Duncan, F, Duncan, G, Duncan, H, Duncan, R, Dundas, S, Dunleavy, A, Dunleavy, J, Dunn, A, Dunn, C, Dunn, D, Dunn, L, Dunn, P, Dunne, C, Dunne, K, Dunning, F, Dunphy, A, Duraiswamy, V, Duran, B, DuRand, I, Durdle, L, Duric, N, Durie, A, Durie, E, Durogbola, S, Durojaiye, C, Durrans, L, Durrant, K, Durrington, H, Duru, I, Duvnjak, H, Dwarakanath, A, Dwarakanath, L, Dwyer, E, Dyar, Z, Dyball, C, Dyer, K, Dymond, H, Dymond, T, Eades, C, Eadie, L, Eadie, R, Eagles, L, Eapen, B, Earl, N, Early, J, Earwaker, M, Easom, N, East, C, Easthope, A, Easton, F, Easton, J, Easton, P, Eatough, R, Ebigbola, O, Ebon, M, Eccles, A, Eccles, S, Eddings, C, Eddleston, M, Edgar, M, Edgerley, K, Edmond, N, Edmondson, M, Edmunds, T, Edwards, A, Edwards, C, Edwards, J, Edwards, K, Edwards, M, Edwards, S, Eedle, J, Eggink, A, Egginton, D, Eggleston, S, Ehiorobo, L, Eisen, S, E-J Stoner, E-J, Ekeowa, U, Ekoi, M, Ekunola, A, El Behery, S, Elashhar, N, Elawamy, L, Elbeshy, M, El-Bouzidi, K, Elder, J, El-Din, M, Eldridge, E, Eleanor, D, Elenwa, U, Eletu, I, Elfar, E, Elgamal, M, Elgohary, A, Elhadi, M, Elia, S, Elias, J, Elias, T, Elkaram, N, Elkins, A, Ellam, J, Ellard, N, Ellerton, L, Elliot, L, Elliott, A, Elliott, F, Elliott, K, Elliott, S, Ellis, A, Ellis, C, Ellis, K, Ellis, L, Ellis, R, Ellis, Y, Ellwood, A, Elmahdi, R, Elmahi, E, Elmasry, H, El-Naggar, M, Elndari, N, Elneima, O, Eloki, M, Elradi, A, Elsaadany, M, Elsayed, M, El-Sayeh, S, El-Sbahi, H, Elsebaei, M, Elsefi, T, El-Shakankery, K, Elsheikh, A, El-Taweel, H, Elyoussfi, S, Emberey, J, Emberton, J, Emery, A, Emmanuel, J, Emmerson, I, Emms, M, Emond, F, Enachi, N, Enenche, D, Engden, A, English, K, Entwistle, E, Enyi, H, Erotocritou, M, Eskander, P, Esmail, H, Essa, F, Evans, B, Evans, C, Evans, D, Evans, E, Evans, G, Evans, I, Evans, J, Evans, L, Evans, M, Evans, R, Evans, S, Evans, T, Everden, C, Everden, S, Every, L, Evison, L, Evison, H, Ezenduka, C, Faccenda, J, Fahel, L, Fahmay, Y, Fairbairn, I, Fairbairn, S, Fairbairn, T, Fairclough, A, Fairlie, L, Fairweather, M, Fajardo, A, Falcone, N, Falconer, E, Fallon, J, Fallow, A, Faluyi, D, Fancois, V, Farah, A, Farah, M, Farah, Q, Fard, N, Fares, L, Farg, A, Farmer, A, Farmer, K, Farmery, T, Farnworth, S, Farook, F, Farooq, H, Farooq, S, Farquhar, F, Farr, H, Farrell, A, Farrukh, F, Farthing, J, Farzana, S, Fasina, R, Faterni, A, Faterni, M, Fathima, S, Fatimah, N, Faulkner, M, Favager, C, Fawke, J, Fawohunre, S, Fazal, A, Fazleen, A, Fearby, S, Fearnley, C, Feben, A, Fedel, F, Fedorova, D, Fegan, C, Felongo, M, Felton, L, Felton, T, Fenlon, K, Fenn, A, Fennelly, R, Fenner, I, Fenton, C, Fenton, M, Ferenando, G, Ferguson, C, Ferguson, J, Ferguson, K, Ferguson, S, Ferguson, V, Fernado, C, Fernandez, C, Fernandes, D, Fernandez, E, Fernandez, M, Fernandez Lopez, S, Fernandez Roman, J, Fernando, J, Feroz, A, Ferranti, P, Ferrari, T, Ferrelly, E, Ferrera, A, Ferriman, E, Ferron, S, Fethers, N, Field, B, Field, J, Field, R, Fielder, K, Fieldhouse, L, Fielding, A, Fielding, J, Fielding, S, Fikree, A, Filipa, S, Filson, S, Finan, S, Finbow, S, Finch, D, Finch, J, Finch, L, Finch, S, Fineman, N, Finlayson, L, Finlayson, J, Finn, J, Finnerty, D, Finney, C, Finucane, D, Fiouni, S, Fiquet, J, Firi, P, Fisher, J, Fisher, N, Fishman, D, Fishwick, K, Fitton, C, Fitzgerald, F, Fitzjohn, K, Flaherty, J, Flanagan, M, Flanders, C, Flaris, N, Fleming, G, Fleming, J, Fleming, L, Flesher, W, Fletcher, A, Fletcher, J, Fletcher, S, Flett, F, Flewitt, K, Flockhart, S, Flood, C, Floodgate, I, Flor, J, Florence, V, Flowerdew, M, Floyd, S, Flynn, R, Flynn, M, Foden, C, Fofana, A, Fogarty, G, Foley, P, Folkes, L, Fong, T, Font, D, Foo, A, Foo, J, Foot, A, Foot, H, Foot, J, Forbes, J, Ford, A, Ford, J, Fordham, I, Foreman, J, Forester, M, Forkan, M, Fornolles, C, Forrest, A, Forsey, E, Forsey, M, Forshall, T, Forster, E, Forsyth, A, Forton, J, Foster, C, Foster, E, Foster, J, Foster, R, Foster, T, Foulds, A, Foulds, I, Fowe, F, Fowkes, N, Fowler, E, Fowler, S, Fox, A, Fox, C, Fox, H, Fox, J, Fox, L, Fox, N, Fox, O, Fox, S, Foxton, S, Fraile, E, Frake, R, Francioni, S, Francis, O, Francis, R, Francis, S, Francis-Bacon, T, Frankland, H, Franklin, J, Franklin, S, Fraser, C, Fratila, A, Frayling, S, Fredlund, M, Freeman, A, Freeman, C, Freeman, E, Freeman, N, Freer, C, French, E, French, T, Freshwater, K, Frise, M, Fromson, R, Frosh, A, Frost, J, Frost, V, Froud, O, Frowd, R, Fryatt, A, Frygier, A, Fuller, B, Fuller, L, Fuller, T, Fullerton, F, Fung, C, Fung, G, Funnell, S, Fyfe, A, G, N, Gabbitas, E, Gabriel, C, Gabriel, Z, Gachi, H, Gaffarena, S, Gage, S, Gahir, J, Gajebasia, S, Gajewska-Knapik, K, Galani, Z, Gale, H, Gale, L, Gale, R, Gali, S, Gallagher, B, Gallagher, J, Gallagher, R, Gallagher, W, Gallam, F, Galliford, J, Galloway, C, Galloway, E, Galloway, J, Galvin, A, Galvis, V, Gamble, L, Gamble, G, Gammon, B, Gan, C, Ganaie, M, Ganapathi, J, Ganapathy, R, Gandhi, K, Gandhi, S, Ganesh, U, Ganeshanathan, T, Ganguly, S, Gani, A, Ganley, P, Gar, R, Garcia, U, Garden, E, Gardener, A, Gardiner, E, Gardiner, M, Gardiner, P, Gardiner, S, Gardiner-Hill, C, Gardner, L, Gardner, J, Garfield, M, Garg, A, Garg, I, Garlick, N, Garner, D, Garner, J, Garner, L, Garner, Z, Garrero, K, Garty, F, Gascoyne, R, Gashau, H, Gatenby, A, Gaughan, E, Gaurav, A, Gavrila, M, Gaylard, J, Gayle, S, Geddie, C, Gedge, I, Gee, S, Geele, F, Geerthan, K, Gellamucho, M, Gelly, K, Gelmon, L, Gelves-Zapata, S, Genato, G, Gent, D, Gent, N, Geoghegan, N, George, A, George, B, George, S, George, T, George, V, Georges, S, Georgiou, D, Gerard, P, Germain, L, Gerrish, H, Getachew, A, Gethin, L, Gettings, S, Ghanayem, H, Ghavami Kia, B, Ghazal, S, Gherman, A, Ghosh, A, Ghosh, D, Ghosh, J, Ghosh, S, Giannopoulou, S, Gibani, M, Gibb, C, Gibbison, B, Gibson, A, Gibson, B, Gibson, J, Gibson, K, Gibson, S, Gigi, M, Gilbert, C, Gilbert, J, Gilbert, K, Giles, B, Gilham, J, Gill, M, Gillen, P, Gillesen, A, Gillespie, K, Gillham, E, Gillian, A, Gilliland, D, Gillott, R, Gilmour, D, Gilmour, L, Ginn, L, Giokanini-Royal, T, Gipson, A, Giri, B, Girling, J, Gisby, R, Gkioni, A, Gkoritsa, A, Gkrania-Klotsas, E, Gladwell, A, Glanville, J, Glasgow, S, Glasgow, J, Glass, J, Glass, L, Glaysher, S, Gledhill, L, Glenday, E, Glennon, A, Glossop, J, Glover, J, Glover, K, Glover, M, Glover Bengtsson, J, Glowski, D, Glynn, S, Gnanalingam, C, Goddard, J, Goddard, W, Godden, E, Godden, J, Godlee, S, Godson, E, Godwin, G, Gogoi, S, Goh, A, Gohel, M, Goiriz, R, Gokaraju P Harman, S, Goldsmith, A, Goldsmith, P, Gomersall, D, Gomez, L, Gomez-Marcos, R, Gondal, A, Gonzalez, C, Goodall, J, Goodall, V, Goodfellow, A, Goodfellow, L, Goodlife, J, Goodwin, E, Goodwin, C, Goodyear, P, Gooentilleke, R, Gooseman, S, Gopal, S, Gordon, C, Gordon, S, Gore, R, Gorick, H, Gorman, C, Gormely, S, Gorniok, M, Gorog, D, Gorst, M, Gorsuch, T, Gosai, J, Gosling, R, Gosling, S, Gosney, G, Goss, V, Gotham, D, Gott, N, Goudie, E, Gould, N, Gould, S, Goumalatsou, C, Gourbault, L, Govind, A, Govindan, R, Gowans, S, Gowda, G, Gowda, R, Gower, H, Goyal, P, Goyal, S, Graham, C, Graham, L, Graham, R, Graham, S, Graham-Brown, M, Grahamslaw, J, Grana, G, Grandison, T, Grandjean, L, Grant, A, Grant, D, Grant, K, Grant, M, Grant, P, Gravell, R, Graves, J, Gray, A, Gray, C, Gray, G, Gray, K, Gray, N, Gray, R, Gray, S, Grayson, A, Greaves, F, Greaves, P, Green, A, Green, D, Green, F, Green, J, Green, M, Green, N, Green, S, Greene, D, Greenfield, P, Greenhalgh, A, Greenwood, D, Greer, S, Gregory, J, Gregory, K, Gregory, T, Greig, J, Grenfell, R, Grenier, T, Gresty, J, Grevatt, S, Grey, G, Gribben, S, Gribbin, A, Gribble, A, Grieg, N, Grieve, D, Griffin, B, Griffin, D, Griffin, M, Griffith, S, Griffiths, A, Griffiths, D, Griffiths, I, Griffiths, M, Griffiths, N, Griffiths, O, Griffiths, S, Griffiths, Y, Grigoriadou, S, Grigsby, S, Grist, P, Grobovaite, E, Grogono, D, Grondin, C, Groome, R, Grose, P, Grosu, L, Grounds, J, Grout, M, Grover, H, Groves, J, Grubb, N, Grundy, J, Guarino, F, Gudur, S, Guerin, J, Guettari, S, Gulati, S, Gulia, V, Gunasekara, H, Gunasekera, P, Gunawardena, M, Gunganah, K, Gunn, J, Gunter, E, Gupt, A, Gupt, V, Gupta, A, Gupta, R, Gupta, T, Gupta-Wright, A, Guratsky, V, Gureviciute, A, Gurram, S, Gurung, B, Gurung, L, Gurung, S, Gurung Rai, S, Guth, H, Guthrine, N, H Dinh, T, Habibi, R, Hack, B, Hackett, J, Hackney, P, Hacon, C, Haddad, A, Hadfield, D, Hadfield, N, Hadfield, S, Hadjiandreou, M, Hadjisavvas, N, Haestier, A, Hafiz, N, Hafiz-Ur-Rehman, R, Hafsa, J, Hagan, S, Hague, J, Haider, N, Haigh, K, Haile, V, Hailstone, J, Haines, C, Hainey, S, Hair, M, Hairsine, B, Hajnik, J, Hake, D, Hakeem, L, Haldeos, A, Halder, W, Hale, E, Hale, J, Halevy, C, Halford, P, Halford, W, Halim, A, Hall, E, Hall, F, Hall, H, Hall, J, Hall, K, Hall, L, Hallas, J, Hallas, K, Hallett, C, Halliday, J, Hallman, A, Hamdollah-Zadeh, M, Hamed-Adekale, I, Hameed, B, Hameed, M, Hamid, I, Hamie, M, Hamill, R, Hamilton, B, Hamilton, F, Hamilton, G, Hamilton, L, Hamilton, M, Hamilton, N, Hamilton, S, Hamlin, R, Hamlyn, E, Hammans, B, Hammersley, S, Hammerton, K, Hammond, B, Hammond, E, Hammond, L, Hammond, S, Hammonds, F, Hamoodi, I, Hampson, J, Hampson, L, Hamzah, L, Han, J, Hanci, O, Hand, S, Handford, J, Handrean, S, Handzewniak, N, Haney, S, Hanif, S, Hanison, E, Hannah, J, Hannington, A, Hannun, M, Hanrath, A, Hanratty, H, Hansen, D, Hanson, A, Hanson, H, Hanson, K, Hanson, S, Haqiqi, A, Haque, M, Harcourt, H, Harden, L, Harding, Z, Hardman, S, Hardwick, M, Hardy, G, Hardy, J, Haresh, K, Harford, R, Hargadon, B, Hargraves, J, Hargreaves, C, Harin, A, Haris, M, Harlock, E, Harmer, M, Haroon, M, Harper, J, Harper, P, Harper, R, Harrhy, S, Harrington, K, Harrington, S, Harrington-Davies, Y, Harris, J, Harris, L, Harris, M, Harris, N, Harris, S, Harrison, L, Harrison, M, Harrison, O, Harrison, R, Harrison, T, Harrison, W, Harrod, E, Hart, C, Hart, D, Hartidge, P, Hartley, L, Hartley, J, Hartley, R, Hartley, T, Hartrey, W, Hartshorn, S, Harvey, A, Harvey, M, Harwood, H, Harzeli, Z, Haselden, B, Hashimm, M, Hashimoto, T, Hashmi, I, Haslam, J, Haslam, Z, Hasnip, G, Hassan, A, Hassan, Z, Hassasing, S, Hassell, P, Hassell, J, Hastings, A, Hastings, B, Hastings, J, Hathaway-Lees, S, Hatton, J, Hau, J, Havinden-Williams, M, Havlik, S, Hawcutt, D, Hawes, K, Hawes, L, Hawes, N, Hawker, L, Hawkins, A, Hawkins, J, Hawkins, N, Hawkins, W, Hawley, D, Hawley-Jones, E, Haworth, E, Hay, C, Hayat, A, Hayat, J, Hayathu, M, Hayes, A, Hayes, C, Hayes, F, Hayes, J, Hayes, K, Hayes, M, Hayle, P, Haylett, C, Hayman, A, Hayman, M, Haynes, M, Hayre, R, Haysom, S, Hayward, J, Haywood, P, Hazelton, T, Hazenberg, P, He, Z, Headon, E, Heal, C, Healy, B, Healy, J, Hearn, A, Heasman, D, Heath, A, Heath, D, Heath, R, Heaton, D, Heavens, A, Hebbron, K, Hector, G, Heddon, S, Hedges, A, Hedges, K, Heeley, C, Heeney, E, Heinink, R, Heire, R, Helgesen, I, Hemingway, J, Hemmings, B, Hemphill, S, Hemsley, D, Henderson, A, Henderson, E, Henderson, J, Henderson, S, Henry, J, Henry, K, Henry, L, Henry, M, Henry, N, Henshall, D, Herdman, G, Herdman-Grant, R, Herkes, M, Hernandez, F, Heron, E, Heron, L, Heselden, E, Heslop, P, Heslop, T, Hester, S, Hetherington, E, Hetherington, J, Hettiarachchi, C, Hettiarachchi, P, Hewer, H, Hewertson, J, Hewetson, A, Hewins, S, Hewitson, N, Hewitt, C, Hewitt, D, Hewitt, R, Hey, S, Heyderman, R, Heydtmann, M, Heys, J, Heywood, J, Hibbert, M, Hickey, J, Hickey, P, Hickey, N, Hicks, A, Hicks, S, Higbee, D, Higgins, L, Higham, A, Highcock, M, Highgate, J, Hikmat, M, Hill, A, Hill, H, Hill, J, Hill, L, Hill, P, Hill, U, Hilldrith, A, Hillman-Cooper, C, Hilton, J, Hilton, Z, Hinch, S, Hindle, A, Hindley, E, Hindmarsh, A, Hine, P, Hinshaw, K, Hird, C, Hirst, C, Hirst, L, Hives, J, Hlaing, H, Ho, B, Ho, R, Hoare, M, Hobden, G, Hobrok, M, Hobson, S, Hodge, C, Hodge, S, Hodgen, L, Hodgetts, G, Hodgkinson, H, Hodgkinson, S, Hodgson, D, Hodgson, L, Hodgson, S, Hodkinson, G, Hodson, M, Hogan, A, Hogben, M, Hogg, L, Hoggett, L, Holborow, A, Holbrook, C, Holbrook, R, Holden, C, Holden, J, Holden, M, Holden, S, Holder, T, Holdhof, N, Holdsworth, H, Holland, M, Holland, N, Holland, P, Holland, S, Hollands, M, Holliday, E, Holliday, K, Holliday, M, Holling, N, Hollos, L, Hollos, N, Holloway, L, Holloway, S, Hollowday, M, Hollyer, M, Holman, A, Holmes, A, Holmes, M, Holmes, R, Holroyd, K, Holroyd-Hind, B, Holt, L, Holt, S, Holyome, A, Home, M, Homewood, R, Hong, K, Hoole, L, Hooper, C, Hope, S, Hopkins, B, Horler, S, Hormis, A, Hornan, D, Hornby, N, Horne, T, Horne, Z, Horner, R, Horrobin, C, Horsford, L, Horsford, M, Horsham, V, Horsley, A, Horsley, E, Horton, S, Hosea, J, Hoskins, T, Hossain, M, Hossain, R, Hough, S, Houghton, C, Houghton, K, Houlihan, R, Housely, K, Houston, H, Hovvels, R, How, L, Howard, J, Howard, K, Howard, L, Howard, M, Howard-Griffin, R, Howard-Sandy, L, Howe, S, Howell, A, Howells, M, Howlett, K, Howlett, S, Howman, R, Hrycaiczuk, J, Htet, H, Htoon, N, Htwe, S, Hu, Y, Huah, C, Huang, S, Hubbard, K, Huckle, A, Huda, S, Hudak, A, Hudig, L, Hudson, O, Hudson, H, Hudson, S, Hufton, A, Huggins, C, Hughes, A, Hughes, C, Hughes, E, Hughes, G, Hughes, H, Hughes, L, Hughes, M, Hughes, R, Hughes, S, Hughes, V, Hughes, W, Huhn, L, Hui, C, Hulbert, R, Hull, D, Hull, G, Hull, R, Hulme, A, Hulme, P, Hulse, W, Hulston, G, Hum, R, Hume, M, Humphrey, C, Humphries, A, Humphries, J, Hunt, C, Hunt, F, Hunt, J, Hunt, K, Hunt, L, Hunt, M, Hunt, S, Hunter, A, Hunter, C, Hunter, E, Hunter, K, Hunter, N, Hunter, R, Hunter, S, Huq, F, Hurditch, E, Hurdman, J, Hurley, C, Hurley, K, Husain, M, Husaini, S, Huson, C, Hussain, A, Hussain, C, Hussain, I, Hussain, M, Hussain, R, Hussain, S, Hussain, Y, Hussam El-Din, M, Hussein, S, Hussein, Z, Hussey, R, Hussien, A, Hutchinson, A, Hutchinson, C, Hutchinson, D, Hutchinson, E, Hutchinson, J, Hutsby, C, Hutton, P, Huynh, H, Hydes, D, Hyde-Wyatt, J, Hynes, N, Hyslop, M, I Tay, S, Iakovou, A, Ibison, K, Ibraheim, M, Ibrahim, A, Ibrahim, J, Ibrahim, M, Ibrahim, W, Icke, B, Idowu, A, Idrees, M, Idrees, N, Iftikhar, H, Iftikhar, M, Igwe, C, Igwe, O, Ijaz, M, Ikomi, A, Iles, C, Iliodromiti, S, Ilsley, M, Ilves, L, Ilyas, F, Imam-Gutierrez, L, Iman, M, Imray, C, Imtiaz, H, Ingham, J, Ingham, R, Ingle, T, Inglis, J, Inglis-Hawkes, S, Ingram, A, Ingram, L, Ingram, T, Innes, N, Inns, P, Inpadhas, V, Inweregbu, K, Ionescu, A, Iordanov, I, Ipe, A, Iqbal, J, Iqbal, M, Iqbal Sait, F, Irabor, I, Ireland, J, Irisari, J, Irons, R, Irshad, M, Irvine, J, Irvine, V, Irving, R, Ishak, M, Isherwood, E, Isitt, G, Islam, A, Islam, M, Islam, S, Islim, A, Ismail, A, Ismail, O, Ison, C, Israa, M, Isralls, S, Ivan, M, Ivenso, C, Ivin, N, Ivy, A, Iwanikiw, S, Ixer, K, Iyer, M, Jabbar, K, Jack, C, Jackman, J, Jackman, S, Jackson, A, Jackson, B, Jackson, E, Jackson, H, Jackson, L, Jackson, M, Jackson, N, Jackson, Y, Jacob, J, Jacob, P, Jacob, R, Jacques, N, Jafar, A, Jafferji, D, Jaffery, A, Jagadish, C, Jagannathan, V, Jagpal, M, Jai, N, Jain, S, Jaiswal, S, Jajbhay, D, Jallow, B, Jaly, Y, Jama, R, Jamal, A, Jamal, S, Jamal, Z, Jameel, Y, James, A, James, C, James, K, James, L, James, M, James, N, James, O, James, P, James, R, James, S, James, T, Jameson, J, Jamieson, L, Jamison, A, Jane, P, Janes, K, Janmohamed, A, Japp, D, Jaques, P, Jardim, V, Jardine, C, Jarman, C, Jarnell, E, Jarvie, E, Jarvis, C, Jarvis, R, Jastrzebska, P, Javed, H, Javier, A, Jawad, M, Jawaheer, L, Jayachandran, A, Jayachandran, D, Jayadev, A, Jayakumar, A, Jayaram, D, Jayaram, R, Jayasekera, G, Jayatilleke, T, Jayebalan, A, Jeater, J, Jeddi, S, Jeebun, V, Jeelani, M, Jeffery, H, Jeffery, K, Jeffrey, R, Jeffreys, N, Jeffs, B, Jeffs, C, Jeganathan Ponraj, J, Jegede, D, Jemima, T, Jenkin, I, Jenkin, S, Jenkins, A, Jenkins, C, Jenkins, D, Jenkins, E, Jenkins, I, Jenkins, P, Jenkins, S, Jennings, F, Jennings, J, Jennings, L, Jennings, V, Jerome, E, Jerry, D, Jervis, G, Jessup-Dunton, E, Jesus Silva, J, Jetha, C, Jethwa, K, Jhanji, S, Jian, K, Jiao, Z, Jimenez, L, Jimenez Gil, A, Jith, J, Joefield, T, Johal, S, Johal, N, Johannessen, K, Johari, A, John, A, John, M, John, N, Johns, E, Johns, M, Johnson, A, Johnson, E, Johnson, K, Johnson, L, Johnson, M, Johnson, N, Johnson, O, Johnson, R, Johnston, B, Johnston, C, Johnston, J, Johnston, S, Johnston, V, Johnstone, D, Johnstone, E, Johnstone, J, Joishy, M, Jone, S, Jones, A, Jones, B, Jones, C, Jones, D, Jones, E, Jones, G, Jones, J, Jones, K, Jones, L, Jones, M, Jones, N, Jones, O, Jones, P, Jones, R, Jones, R E, Jones, S, Jones, T, Jonnalagadda, R, Jordache, R, Jordan, M, Jordan, S, Jose, A, Jose, L, Jose, S, Joseph, A, Joseph, G, Joseph, P, Joseph, R, Joseph, S, Joshi, D, Joshi, P, Joshi, T, Joshi, M, Josiah, B, Joy, L, Joyce, T, Ju, H, Ju Wen Kwek, A, Judd, A, Jude, E, Juhl, J, Jujjavarapu, S, Juniper, M, Kabiru Dawa, K, Kacar, M, Kadam, N, Kader, N, Kailey, A, Kain, M, Kakoullis, G, Kalayi, R, KalBhushan, A, Kaliannan Periyasami, R, Kallistrou, E, Kalmus Eliasz, T, Kalsoom, S, Kam, E, Kamara, J, Kamath, A, Kamath, P, Kamath, R, Kamerkar, S, Kametas, N, Kamfose, M, Kamundi, C, Kanabar, D, Kane, L, Kankam, O, Kannan, T, Kant, A, Kapil, V, Kapoor, R, Kapoor, S, Kaprapina, S, Kar, S, Kara, J, Karbasi, E, Karelia, S, Kark, R, Karmali, S, Karunanithi, V, Karunaratne, N, Kasianczuk, N, Kasiappan Balasubramanian, A, Kasipandian, V, Kassam, R, Kathirgamachelvam, J, Katsande, V, Kaul, K, Kaur, D, Kaur, J, Kaur, S, Kausar, Z, Kavanagh, L, Kavanagh, S, Kawser, M, Kay, A, Kay, J, Kay, R, Kay, S, Kayappurathu, J, Kaye, C, Kazeem, A, Ke, M, Keady, T, Kearns, R, Kearsley, N, Keating, J, Keating, L, Keddie-Gray, E, Keegan, B, Keen, R, Keenan, N, Kefas, J, Kegg, S, Keith, L, Keke, U, Kellett, J, Kelliher, J, Kelly, A, Kelly, E, Kelly, H, Kelly, L, Kelly, M, Kelly, R, Kelly, S, Kelly-Baxter, M, Kelsall, O, Keltos, M, Kemp, T, Kendall, E, Kendall-Smith, A, Kennard, S, Kennedy, J, Kennedy, M, Kennedy-Hay, S, Kenny, J, Kent, M, Keogan, L, Keough, A, Kernaghan, D, Kerr, A, Kerrison, C, Kerry, A, Kerslake, H, Kerslake, I, Kerss, H, Keshet-Price, J, Keyte, G, Khadar, A, Khalid, A, Khalid, H, Khalid, M, Khalid, S, Khalifa, T, Khalil, A, Khalil, S, Khan, A, Khan, B, Khan, F, Khan, K, Khan, M, Khan, N, Khan, O, Khan, R, Khan, S, Khan, T, Khan, W, Khan, Z, Khan Tharin, M, Khatana, U, Khatri, J, Khatun, H, Khatun, T, Kheia, M, Khera, J, Khin, H, Khoja, N, Khokhar, K, Khoo, J, Khurana, C, Kibaru, J, Kibutu, F, Kidd, A, Kidd, M, Kidney, J, Kidney, S, Kieffer, W, Kilbane, J, Kilby, C, Killen, E, Kilner, B, Kilroy, S, Kim, B, Kim, J, Kim, M, Kimber, A, Kimber, S, King, B, King, H, King, J, King, K, King, M, King, R, King, S, King, V, King-Oakley, E, Kingsmore, L, Kinnear, D, Kinney, F, Kiran, S, Kirby, A, Kirk, A, Kirkby, A, Kirkham, E, Kirkman, G, Kirkpatrick, L, Kirwan, U, Kitching, T, Kitto, L, Kittridge, L, Klaczek, S, Kleemann, F, Kmachia, S, Knapp, C, Knibbs, L, Knight, A, Knight, S, Knight, T, Knights, E, Knights, J, Knolle, M, Knopp, P, Knowles, C, Knowles, K, Knowles, L, Knox, E, Knox, L, Koch, O, Kocsor, M, Kodituwakku, R, Koduri, G, Koe, Y, Koirata, A, Kolakaluri, E, Kolodziej, M, Kolokouri, E, Kon, S, Konar, N, Kononen, M, Konstantinidis, A, Kontogonis, R, Koo, H, Koopmans, I, Kopyj, E, Korcierz, L, Korolewicz, J, Koshy, G, Kosmidis, C, Kosztolanyi, C, Kotecha, J, Kothandaraman, E, Koukou, K, Kountourgioti, A, Kouranloo, K, Kousar, R, Kousteni, M, Koutalopoula, A, Kovac, M, Kozak Eskenazia, A, Krasauskas, K, Krishnamurthy, R, Krishnamurthy, V, Krishnan, H, Krishnan, M, Krishnapalli, N, Krizak, S, Krueper, S, Krupej, S, Krzowski, J, Kubaisi, R, Kubisz-Pudelko, A, Kuckreja, S, Kudsk-Iversen, S, Kudzinskas, A, Kukadiya, C, Kulkarni, N, Kumar, A, Kumar, M, Kumar, R, Kumar, S, Kumar, V, KundU, A, Kunst, H, Kupiec, K, Kurani, A, Kurdy, M, Kuriakose, K, Kurian, R, Kurmars, V, Kuronen-Stewart, C, Kusangaya, R, Kushakovsky, V, Kutera, A, Kuverji, A, Kyei-Mensah, A, Kyere-Diabour, T, Kyi, M, Kyi, N, Kyle, L, Kyriaki, K, Labao, J, Lacey, L, Lack, N, Lacson, M, Ladan, Z, Ladlow, E, Lafferty, H, Lagnado, A, Laha, S, Lahane, S, Lai, C, Lai, J, Laidler, P, Laing, R, Laing-Faiers, I, Laity, E, Lake, K, Lakeman, N, Lalloo, F, Lam, A, Lam, C, Lamb, F, Lamb, L, Lamb, T, Lambert, P, Lameirinhas, C, Lami, M, Lamont, H, Lamparski, M, Lamrani, D, Lanaghan, C, Lancona-Malcolm, I, Landers, G, Lane, M, Lane, N, Lang, A, Lang, S, Langer, D, Langley, M, Langoya, C, Langridge, E, Langthorne, E, Langton, H, Lara, B, Large, T, Lassa, S, Last, A, Latham, S, Latham, V, Latheef, A, Latif, L, Latt, N, Lau, C, Lau, D, Lau, E, Laura, G, Laurenson, M, Lavington, E, Law, H, Law, J, Law, K, Law, P, Law, R, Lawless, L, Lawrence, C, Lawrence, E, Lawrence, G, Lawrence, H, Lawrence, N, Lawrie, R, Lawson, L, Lawson, N, Lawson, R, Laybourne, S, Laycock, C, Layug, R, Lazo, M, Le, V, Lea, A, Lea, W, Leach, L, Leadbitter, I, Leahy, T, Lean, R, Leandro, L, Leaning, D, Leary, R, Leason, S, Ledingham, M, Lee, C, Lee, E, Lee, H, Lee, I, Lee, J, Lee, R, Lee, S, Lee, T, Lee, X, Lees, D, Lees, J, Legge, H, Leggett, J, Leigh-Ellis, K, Leitch, D, Leitch, N, Lekoudis, E, Lemessy, P, Lenagh, R, Leng, K, Lennon, K, Lennon, L, Leonard, B, Leonard, K, Leong, W, Leopold, N, Lepiarczyk, O, Leslie, I, Lester, E, Levell, E, Levynska, A, Lewazuk, A, Lewin, A, Lewis, A, Lewis, C, Lewis, D, Lewis, H, Lewis, J, Lewis, K, Lewis, L, Lewis, M, Lewis, N, Lewis, R, Lewis-Clarke, C, Lewthwaite, P, Ley, S, Liao, A, Licence, V, Lieberman, D, Liebeschuetz, S, Light, T, Lightfoot, N, Lillie, P, Lillis, A, Lim, B, Lim, C, Lim, E, Lim, I, Lim, T, Lim, W, Limb, J, Limbu, D, Limbu, U, Linares, C, Linden, D, Lindergard, G, Lindley, K, Lindsay, C, Lindsay, E, Lindsay, M, Lindsay-Clarke, H, Ling, M, Lingam, C, Linkson, L, Linn, T, Linney, M, Lippold, C, Lipscomb, G, Lipscomb, K, Lipskis, L, Lisboa, A, Lister, E, Little, J, Little, S, Littlejohn, L, Liu, S, Liu, X, Llanera, D, Llewellyn, R, Llewelyn, M, Lloyd, A, Lloyd, O, Lloyd, R, Lo, S, Loader, D, Loan, C, Lobosco, L, Lock, L, Locke, A, Locke, J, Locke, T, Lodge, J, Lodhia, K, Lofthouse, M, Loftus, H, Logue, C A, Loh, S, Lokanathan, S, London, E, Long, G, Long, N, Longbotttom, K, Longhurst, B, Longshaw, M, Longstaffe, S, Lonita, A, Lonnen, J, Lonsdale, C, Looby, L, Loosley, R, Lopes, L, Lopez, P, Lord, R, Lord, S, Lorimer, C, Loro, F, Lorusso, R, Loughlin, C, Lovegrove, W, Loveless, R, Lovell, M, Loverdou, A, Low, A, Low, J, Low, S, Lowe, A, Lowe, C, Lowe, E, Lowe, F, Lowe, L, Lowe, M, Lowsby, R, Lowthorpe, V, Lubimbi, G, Lubina Solomon, A, Lucas, G, Lucas, J, Lucey, A, Lucey, O, Luck, S, Lui, L, Luintel, A, Luke, H, Luke, J, Lungu, N, Lunia, A, Luscombe, M, Luveta, J, Luximon, C, Lwin, K, Lwin, M, Lye, A, Lyell, B, Lyka, E, Lynas, A, Lynch, C, Lynch, D, Lynch, S, Maamari, R, Mabb, H, Mabelin, L, Mabeza, G, Macaro, J, Macconaill, K, Macdonald, C, Macduff, A, Macfadyen, C, Macfarlane, J, Macfarlane, L, Macharia, I, MacInnes, L, MacIntyre, I, MacIntyre, J, Mack, K, Mackay, C, Mackay, E, Mackay, L, Mackenzie, A, Mackenzie, M, MacKenzie Ross, R, Mackey, A, Mackie, F, Mackie, J, Mackie, R, Mackinlay, C, Mackintosh, C, Mackintosh, K, MacLeod, M, Macleod, S, Maclom, H, Macmahon, M, MacNair, A, Macphee, C, Macpherson, I, Macrae, C, MacRaild, A, Madden, A, Madden, M, Madden-McKee, C, Maddison, S, Madeja, N, Madhivathanan, P, Madhusudhana, M, Madu, A, Madziva, L, Magee, N, Magezi, F, Maghsoodi, N, Magier, C, Magnaye, L, Magriplis, M, Magtalas, M, Mahabir, N, Mahadevan-Bava, S, Maharajh, A, Mahaveer, A, Mahay, B, Mahay, K, Mahdi, A, Mahdi, H, Mahdi, N, Mahendiran, T, Mahendran, S, Maher, S, Maheswaran, A, Maheswaran, S, Maheswaran, T, Mahjoob-Afag, P, Mahmood, A, Mahmood, F, Mahmood, H, Mahmood, W, Mahmood, Z, Mahmoud, H, Mahmud, M, Mahony, E, Mahungu, T, Mair, L, Majekdunmi, T, Majid, K, Major, A, Major, R, Majumdar, J, Majumder, M, Mak, T, Makan, A, Makanju, E, Makin, S, Makinde, W-O, Makkeyah, Y, Malanca, M, Malein, F, Malhan, N, Malicka, A, Malik, A, Malik, G, Maljk, M, Mallett, P, Mallinder, P, Mallison, G, Mallon, L, Malone, E, Maloney, G, Mamman, M, Man, I, Man, K, Mancinelli, R, Mancuso-Marcello, M, Mandal, S, Manders, T, Manderson, L, Mandeville, J, Mane, T, Manhas, R, Maniero, C, Manikonda, R, Manjra, I, Mankiewitz, R, Mann, B, Manning, J, Manning, S, Mannion, P, Mansi, K, Manso, K, Mansour, D, Mansour, M, Mansour, R, Mapfunde, I, Mappa, P, Maqsood, A, Maraj, H, Marchand, C, Marcus, N, Marcyniuk, A, Marecka, M, Maren, D, Margabanthu, G, Margalef, J, Margarit, L, Margaritopoulos, G, Margarson, M, Maria del Rocio, F, Mariano, V, Maric, A, Markham, G, Marks, B, Marks, M, Marks, P, Marler, E, Marouzet, E, Marriott, A, Marriott, C, Marriott, N, Marsden, C, Marsden, K, Marsden, P, Marsden, S, Marsden, T, Marsh, C, Marsh, G, Marsh, R, Marshall, A, Marshall, G, Marshall, H, Marshall, J, Marshall, N, Marshall, R, Marshall, S, Martin, E, Martin, G, Martin, H, Martin, J, Martin, K, Martin, L, Martin, M, Martin, N, Martin, S, Martin, T, Martin, W, Martindale, T, Martineau, M, Martinez, L, Martinez Garrido, J, Martin-Lazaro, J, Maruthamuthu, V, Marwan, B, Maryan, G, Mary-Genetu, R, Maryosh, S, Masani, V, Mascagni, A, Maseda, D, Maseko, Z, Mashate, S, Mashhoudi, Y, Mashta, A, Masih, I, Masih, S, Maskell, N, Maskell, P, Masoli, M, Mason, C, Mason, J, Mason, R, Masood, M, Masood, S, Massa, T, Massey, I, Masters, J, Masud, A, Matapure, L, Matei, C, Matewe, R, Matharu, M, Mathen, S, Mather, A, Mathers, J, Matheson, J, Mathew, A, Mathew, B, Mathew, M, Mathew, V, Mathews, J, Mathias, K, Mathioudakis, A, Matila, D, Matimba-Mupaya, W, Matin, N, Matisa, E, Matkins, E, Matonhodze, M, Matovu, E, Mattappillil, J, Matthews, A, Matthews, C, Matthews, H, Mattocks, L, Maughan, C, Mauzzam, A, Mawson, E, Maxton, F, Maxwell, A, Maxwell, V, May, J, May, P, May, E, Mayanagao, I, Maycock, M, Mayer, J, Mayers, G, Maynard, V, Mayo, T, Mayola, L, Mayor, S, Mazen, I, Mazhani, T, Mazzella, A, Mburu, N, Mbuyisha, A, Mc Cague, C, McAleese, E, McAlinden, P, McAllister, L, McAlpine, A, McAlpine, G, McAndrew, J, McAuley, H, McAuliffe, S, McBrearty, C, McBride, E, McBuigan, M, McBurney, J, McCabe, L, McCafferty, G, McCafferty, L, McCairn, A, McCallagh, L, McCammon, J, McCammon, N, McCann, C, McCann, E, McCarrick, A, McCarron, B, McCarthy, E, McCarthy, M, McCarthy, N, McCaughey, S, McClay, T, McClelland, B, McClintock, D, McCloskey, M, McCollum, K, McCorkindale, A, McCormack, P, McCormick, J, McCormick, W, McCourt, P, McCrae, J, McCready, S, McCreath, G, McCreedy, H, McCue, C, McCullagh, I, McCullagh, M, McCullough, S, McCullough, C, McCullough, K, McCullough, N, McCurrach, F, McDermott, J, McDermott, P, McDermott, R, McDevitt, K, McDill, H, McDonald, C, McDonald, D, McDonald, R, McDonald, S, McDonard, B, McDonnell, N, McDougall, C, McDougall, L, McDougall, R, McEleavy, I, McElwaine, F, McEntee, J, McEvoy, E, McEwan, C, McEwen, R, McFadden, M, McFarland, D, McFarland, M, McFarland, R, McFlynn, J, McGarry, E, McGarvey, L, McGeachan, A, McGee, F, McGenily, L, McGettigan, C, McGettrick, M, McGhee, C, McGill, F, McGinnity, S, McGlinchey, N, McGlone, P, McGlynn, D, McGoldrick, C, McGough, E, McGovern, C, McGovern, R, McGowan, A, McGown, A, McGrath, B, McGregor, A, McGuigan, M, McGuinness, H, McGuire, S, McHugh, T, McInnes, C, McInnes, N, McIntosh, J, McIntyre, K, McIntyre, M, McKay, L, McKeag, C, McKeane, J, McKee, M, McKeever, J, McKenna, J, McKenna, S, McKenzie, M, McKeogh, D, McKerr, C, Mckie, L, McKie, A, Mckie, H, McKnight, G, McLachlan, H, McLaren, A, McLaren, B, McLarty, N, Mclaughlan, E, McLaughlin, M, McLay, J, McLeish, M, McLennan, T, McLure, S, McMahon, A, McMahon, G, McMahon, M, McMahon, S, McManus, T, McMaster, P, McMaster, M, Mcmeeken, F, McMeekin, S, McMillen, K, McMinn, J, McMorrow, L, McMullen, H, McMurran, C, McNally, H, McNeela, F, McNeil, L, McNeill, C, McNeill, J, McNeill, S, McNelis, U, McNulty, M, McNulty, R, McParland, C, McPhail, M, McQueen, A, McSkeane, A, McSorland, D, McSorley, T, McTaggart, J, McTaggart, G, Mead, J, Mead, P, Meadows, E, Meakin, O, Mearns, B, Mearns, C, Mears, K, Mears, W, Meda, M, Mediana, A, Medine, R, Medveczky, T, Meehan, S, Meeks, E, Megan, A, Meghani, N, Meghjee, S, Megson, S, Mehar, A, Mehmood, M, Mehra, R, Mehta, R, Meirill, J, Meiring, J, Mejri, R, Mekonnen, E, Melander, S, Melinte, A, Mellersh, J, Melling, L, Mellish, C, Mellor, F, Mellor, J, Mellor, S, Mellor, Z, Mellows, K, Melnic, V, Melville, A, Melville, D, Melville, J, Mencias, M, Mendelski, A, Mendonca, C, Meney, C, Mensah, W, Mentzer, A, Menzies, D, Menzies, S, Mepham, S, Mercer, O, Mercer, P, Merchant, A, Merchant, F, Mercioniu, M, Meredith, M, Merida Morillas, M, Merrick, B, Merritt, J, Merritt, S, Merron, P, Merwaha, E, Message, S, Messenger, J, Metcalf-Cuenca, G, Metcalfe, A, Metcalfe, B, Metcalfe, K, Metherell, S, Metryka, A, Mew, L, Meyrick, S, Miah, A, Miah, J, Miah, N, Mian, A, Mic, G, Micallef, D, Michael, A, Michael, S, Michalak, N, Michalca-Mason, L, Michalec, O, Middle, J, Middleton, H, Middleton, J, Middleton, M, Middleton, S, Mieres, S, Mihalca-Mason, L, Mikolasch, T, Milgate, S, Millar, C, Millar, J, Millard, J, Miller, D, Miller, J, Miller, L, Miller, R, Miller-Biot, N, Miller-Fik, A, Millett, L, Milligan, B, Milligan, H, Milligan, I, Milliken, C, Millington, K, Millington, R, Millington, S, Mills, H, Mills, J, Mills, R, Millward, H, Miln, R, Milne, A, Milne, C, Milne, L, Milner, J, Milner, L, Min, Z, Mindel, S, Minnis, C, Minnis, P, Minou, K, Minskip, N, Miranda, F, Mirela, M, Mirza, T, Misbahuddin, A, Mishr, E, Mishra, A, Mishra, B, Mishra, R, Misra, S, Mistry, D, Mistry, H, Mital, D, Mitchard, S, Mitchell, B, Mitchell, C, Mitchell, L, Mitchell, P, Mitchelmore, P, Mitr, A, Mitra, S, Mlambo, N, Moakes, E, Moar, K, Moatt, E, Mock Font, D, Modgil, G, Mohamed, A, Mohamed, O, Mohammad, A, Mohammad, W, Mohammed, A, Mohammed, O, Mohammed, Y, Mohamud, B, Moharram, A, Mok, H-P, Mok, J, Mokogwu, L, Molina, M, Moller-Christensen, C, Mollet, M, Molloholli, M, Molloy, A, Molloy, L, Molyneux, A, Molyneux, R, Momoniat, T, Monaghan, K, Mongolu, S, Monsell, K, Montasser, M, Montgomery, H, Moodley, P, Moody, M, Moody, N, Moon, A, Moon, J, Moon, M, Moonan, M, Moondi, P, Moorby, S, Moorcroft, J, Moore, A, Moore, C, Moore, D, Moore, F, Moore, J, Moore, L, Moore, N, Moore, S, Moore, V, Moores, R, Morab, E, Morales, J, Moramorell, N, Moran, L, Moray, G, Moreno-Cuest, J, Morgan, A, Morgan, C, Morgan, H, Morgan, K, Morgan, L, Morgan, M, Morgan, P, Morgan-Jones, K, Morgan-Smith, E, Morilla, J, Morley, A, Morley, T, Morley, W, Morris, A, Morris, D, Morris, F, Morris, H, Morris, J, Morris, K, Morris, L, Morris, M, Morris, N, Morris, P, Morris, S, Morrison, D, Morrison, M, Morrison, S, Morrissey, M, Morrow, A, Morselli, F, Mortem, G, Mortland, V, Morton, C, Morton, G, Morzaria, P, Mosby, D, Moseley, L, Moshal, K, Moshy, B, Moss, A, Moss, C, Moss, J, Moss, S, Mostafa, O, Moth, G, Motherwell, N, Mottershaw, S, Mouce, G, Moudgil, H, Mouland, J, Moulds, C, Moulton, H, Mousley, E, Mowatt, C, Moxham, K, Moya, B, Moyo, Q, Mshengu, E, Mtuwa, S, Muazzam, I, Muchenje, N, Mudawi, D, Muddegowda, G, Mufti, R, Mugal, I, Mughal, A, Muglu, J, Muhammad, F, Muhammad, J, Muir, C, Mukherjee, D, Mukhtar, J, Mukhtar, S, Mukimbiri, D, Mulcahy, J, Mulcahy, M, Mulgrew, P, Mulhearn, B, Mulla, A, Mullan, D, Mullasseril Kutten, D, Mulle, N, Mullett, R, Mulligan, C, Mulligan, S, Mumelj, L, Munby, H, Munday, H, Munro, A, Munt, S, Mupudzi, M, Murad, A, Muraina, O, Muralidhara, K, Murdoch, M, Murira, J, Murphy, A, Murphy, B, Murphy, C, Murphy, E, Murphy, G, Murphy, H, Murphy, P, Murphy, R, Murray, E, Murray, K, Murray, L, Murray, T, Murtagh, E, Murthy, M, Murton, C, Murton, R, Muru, N, Musanhu, R, Mushabe, M, Mushtaq, O, Mustafa, A, Mustafa, E, Mustafa, M, Mustapha, I, Mustfa, N, Mustufvi, Z, Mutch, C, Mutch, R, Mutema, E, Muthukrishnan, B, Mutton, S, Mwadeyi, M, Mwale, B, Mwaura, E, Myagerimath, R, Myers, A, Myers, S, Myerson, J, Myint, K, Myint, Y, Mynott, G, Myslivecek, L, N Oo, Z, Nabayego, P, Nadar, E, Nadeem, I, Nadheem, M, Naeem, A, Naeem, H, Naeem, S, Nafees, S, Nafei, M, Nagarajan, T, Naglik, L, Nagra, I, Nagra, D, Naguib, M, Naguleswaran, K, Nagumantry, K, Naicker, K, Naidoo, S, Nair, D, Naik, G, Naik, R, Naik, S, Nair, T, Naisbitt, J, Naismith, K, Nakiboneka-Ssenabulya, D, Nallapareddy, S, Nallapeta, S, Nallasivan, A, Nand, U, Nandani, A, Nandwani, T, Naqvi, A, Naqvi, S, Nasa, S, Nash, D, Nasheed, N, Nasimudeen, A, Nasir, U, Nasser, T, Natarajan, A, Natarajan, G, Natarajan, N, Natarajan, R, Nath, P, Nathaniel, N, Nathvani, M, Nathwani, P, Nava, G, Navaneetham, N, Navaratnam, J, Navarra, H, Naveed, S, Navin, J, Nawaz, K, Nawaz, S, Nayar, B, Naylor, S, Nayyar, M, Naz, F, Nazari, B, Nazir, A, Nazir, S, Ncomanzi, D, Ndefo, O, Ndoumbe, N, Neal, A, Neary, E, Negmeldin, M, Nei, L, Neil, J, Neill, P, Neils, H, Nejad, A, Nelson, A, Nelson, B, Nelson, L, Nelson, M, Nelson, R, Nelson, S, Nemane, R, Nepal, S, Nethercott, D, Netherton, K, Nettleton, K, Newby, A, Newby, D, Newcombe, T, Newell, H, Newman, C, Newman, D, Newman, H, Newman, J, Newman, O, Newman, T, Newport, R, Newton, M, Ng, A, Ng, H, Ng, K, Ng, M, Ng, W, Ng, Y, Ngan, T, Ngui, G, Ngumo, S, Nguyen, Q, Ngwenya, K, Nic Fhogartaigh, C, Nicholas, N, Nicholas, P, Nicholas, R, Nicholls, D, Nicholls, L, Nicholls, S, Nicholson, A, Nicol, E, Nicol, R, Nicola, P, Nicoll, A, Nightingale, T, Nikita, F, Nikolaos, P, Nikonovich, G, Nilsson, A, Nimako, K, Nimako, L, Nimmo, C, Ninan, P, Nirmalan, M, Nisar, A, Nisar, M, Nisar, T, Nisbett, T, Nisha James, A, Nishat, S, Nishiyama, T, Nix, S, Nixon, J, Nixon, M, Nizam Ud Din, K, Nizami, M, Nizamis, S, Njafuh, R, Noakes, I, Noba, L, Noble, H, Noble, J, Noe, H, Nolan, J, Nolasco, J, Noor, Z, Noori, Z, Norcliffe, J, Norman, L, Norman, R, Norris, E, Norris, K, Norris, L, Nort e, J, Nortcliffe, S, North, F, North, J, North, T, Northfield, J, Northover, S, Norton, D, Norton, R, Notman, H, Nourein, K, Novak, T, Novas Duarte, N, Novis, C, Nowak, J, Nu, K, Nugdallah, M, Nugent, A, Nugent, J, Numbere, N, Nundlall, K, Nune, A, Nunn, K, Nunnick, J, Nupa, Y, Nur, F, Nurgat, Z, Nuttall, A, Nwafor, L, Nwajiugo, P, Nyamugunduru, G, Nyirenda, M, Nyland, K, O Rinn, D, O Shea, D, O Toole, M, O'Hara, M, O'Keefe, L, O'Reilly, K, O'Rourke, W, Oakley, C, Oakley, N, Oakley, S, Obale, B, Oboh, C, O'Brien, C, O'Brien, J, O'Brien, K, O'Brien, L, O'Brien, N, O'Brien, R, O'Brien, T, O'Bryan, E, Obukofe, R, O'Callaghan, C, O'Connell, L, O'Connor, C, O'Connor, G, Oconnor, T, Oddie, S, Oddy, S, Odedina, Y, Odedra, K, Odelberg, S, Odell, N, Oderinde, O, Odone, J, O'Donohoe, L, O'Donovan, C, Odysseos-Beaumont, I, O'Farrell, S, Offord, P, O'Flaherty, M, Ogbara, T, Ogilvie, C, O'Gorman, C, Ogunjembola, I, Ogunkeye, O, O'Hara, C, Ojha, S, Ojo, O, O'kane, F, O'Kane, M, Okeke, T, Okines, A, Okpala, I, Okpo, E, Okpoko, F, Okubanjo, M, Oladipo, C, Olaivar, L, Olaiya, R, Olatujoye, J, Old, T, Oleszkiewicz, G, Oliver, C, Oliver, J, Oliver, L, Oliver, M, Oliver, Z, Olokoto, N, Olonipile, F, Olufuwa, O, Olukoya, O, Oluwole-Ojo, A, O'Malley, L, Omar, M, Omar, Z, Omer, N, Omoregie, E, O'Neill, C, O'Neill, L, Ong, C, Onuoha, O, Onyeagor, C, Oo, C, Ooi, S, Oomatia, A, Opena, M, Oram, R, Ord, C, Ord, J, Oreilly, C, Orekoya, L, O'Riordan, D, O'Riordan, S, Orlikowska, I, Orme, A, Orme, H, O'Rourke, L, Orr, C, Orr, S, Orton, C, Osadcow, A, Osagie, R, Osanlou, R, Osborne, L, Osborne, N, Osborne, W, Osbourne, C, Osbourne, R, Osei-Bobie, J, Osman, B, Osman, J, Osman, W, Osoata, G, Ostermann, M, O'Sullivan, E, O'Sullivan, S, Otey, N, Otite, O, Ouyang, J, Owen, R, Owen, S, Owens, E, Owoseni, Y, Owston, M, Oxlade, R, Ozdes, F, Pack, J, Packham, A, Packham, S, Paczko, P, Padden, G, Padmakumar, A, Page, C, Page, I, Page, J, Page, S, Page, V, Paget, J, Pagett, K, Paisley, L, Pajak, S, Pakou, G, Pakozdi, A, Pal, S, Palacios, A, Palagiri Sai, V, Palaniappan, V, Palanivelu, P, Palfreeman, A, Palfrey, H, Palissery, V, Palit, D, Pallipparambil Antony, S, Palman, J, Palmer, A, Palmer, H, Palmer, J, Palmer, L, Palmer, R, Pambouka, A, Pamela, D, Pamphlett, I, Pan, D, Pandey, A, Pandian, N, Pandya, K, Pandya, T, Panes, A, Pang, J, Pang, Y, Pannell, L, Pannu, K, Panthakalam, S, Pantin, C, Pao, N, Papaconstantinou, H, Papineni, P, Paques, K, Paracha, A, Paradowski, K, Parambil, V, Paranamana, S, Parashar, S, Parberry, I, Parekh, A, Parekh, D, Parfitt, L, Parfrey, H, Parikh, O, Parish, G, Park, J, Parkash, V, Parker, A, Parker, B, Parker, E, Parker, H, Parker, J, Parkin, K, Parker, L, Parker, N, Parker, S, Parkinson, A, Parkinson, M, Parkinson, V, Parmar, C, Parmar, V, Parris, V, Parrish, C, Parry, B, Parry, H, Parslow-Williams, S, Parsonage, M, Parsons, G, Parsons, J, Parsons, P, Partridge, R, Parvez, Z, Parvin, K, Passby, L, Passey, S, Passmore, H, Pastrana, J, Patachako, J, Patal, M, Patch, S, Patel, A, Patel, B, Patel, D, Patel, H, Patel, J, Patel, K, Patel, M, Patel, N, Patel, P, Patel, S, Patel, T, Patel, V, Patel, Z, Paterson, K, Pathak, S, Patience, A, Patience, D, Patmore, R, Patole, S, Paton, L, Patrick, A, Patrick, G, Patrick, J, Patten, S, Pattenden, B, Patterson, C, Patterson, J, Patterson, L, Patterson, M, Patterson, R, Pattrick, M, Paul, M, Paul, S, Pauls, L, Paulus, S, Pavely, A, Pavitt, M, Payne, B, Payne, E, Payne, M, Payne, R, Peacock, L, Peacock, S, Peake, H, Pearce, J, Pearse, R, Pearson, A, Pearson, D, Pearson, H, Pearson, S, Peasley, A, Peddie, H, Peebles, S, Peek, R, Peer, A, Peerbhoy, S, Pegg, C, Peggie, E, Peggie, H, Peglar, S, Peirce, B, Peirse, M, Pelham, C, Pemberton, A, Penacerrada, M, Pender, A, Pendlebury, C, Pendlebury, J, Penfold, R, Penman, C, Penman, J, Penman, R, Penner, J, Penney, K, Pennington, A, Penny, J, Pepperell, J, Percival, R, Pereira, A, Pereira, R, Pereira Dias Alves, C, Perera, I, Perera, M, Perez, E, Perez, J, Perinpanathan, T, Periyasamy, L, Perkins, E, Pernicova, I, Perritt, E, Perry, A, Perry, E, Perry, M, Perumpral, T, Petch, R, Peter, L, Peters, C, Peters, L, Peters, M, Peters, S, Peters, T, Petersen, R, Peterson, A, Petras, I, Petrova, B, Petrova, M, Petrovics, E, Pettigrew, T, Pezard-Snell, M, Pfeffer, P, Pfyl, T Maria, Phalod, G, Phanish, M, Phelan, P, Philbey, C, Philbin, J, Phillips, A, Phillips, B, Phillips, D, Phillips, N, Phillips, P, Phillips, R, Phillips, T, Phipps, M, Phongsathorn, V, Phull, M, Phyo, A, Pick, S, Pickard, J, Pickering, C, Pickering, F, Pickering, G, Pickett, T, Pickles, J, Pickstock, S, Pickwell-Smith, B, Pieniazek, N, Piercy, C, Pieris, A, Pilgrim, S, Pillai, P, Pilling, L, Pilsworth, Z, Pinches, S, Pinjala, M, Pintu, S, Piper, G, Pirani, T, Pitchford, M, Pittman, M, Pitts, S, Pl, M, Plaatjies, N, Platt, N, Plowright, M, Plummer, L, Plumptre, C, Pobjoy, J, Pogreban, T, Poku, S, Polgarova, P, Pollard, R, Poluyi, O, Polwarth, G, Pomery, F, Ponce, I, Ponnusamy, P, Ponnusamy, S, Ponnuswamy, A, Ponte Bettencourt dos Reis, I, Pooboni, S, Poole, A, Poole, L, Poole, M, Poon, S, Poonian, T, Porteous, J, Porteous, M, Porter, J, Porter, R, Posada, A, Postlethwaite, K, Potdar, M, Pothecary, C, Pothina, N, Potla, P, Potoczna, D, Pott, J, Potter, J, Potter, S, Potter, T, Potton, E, Potts, J, Potts, K, Poultney, U, Poulton, K, Powell, J, Powell, N, Powell, S, Power, D, Power, N, Power, S, Poxon, J, Poyner, E, Poyner, R, Prabhu, A, Pradhan, V, Prady, H, Prasad, A, Prasad, K, Prasad, U, Prasanth Raj, F, Prasath, S, Prately, A, Prendergast, C, Prentice, L, Prentice, P, Prescott, V, Presland, L, Prest, C, Preston, S, Pretorius, M, Prevatt, N, Prew, S, Price, C, Price, D, Price, E, Price, K, Price, L, Price, N, Price, V, Price-Eland, R, Prieto, J, Primrose, L, Prince, C, Prince, J, Prince, L, Pringle, S, Prior-Ong, M, Pristopan, V, Pritchard, K, Pritchard, L, Pritchard, S, Priyash, V, Procter, A, Proctor, C, Protopapas, M, Proudfoot, R, Prudon, B, Pryor, D, Pudi, S, Puffett, A, Pugh, J, Pugh, L, Pugh, M, Pugh, N, Pugh, R, Puisa, V, Puliyakkadi, S, Pullen, J, Punia, K, Punnilath Abdulsamad, S, Purandare, L, Purchase, D, Purdue, C, Purdy, R, Purewal, B, Purnell, R, Pursell, M, Purssord, G, Purves, R, Purvis, S, Putensen, D, Puvaneswaran, B, Puxty, A, Puxty, K, Puyrigaud, Z, Pyart, E, Pye, E, Pynn, M, Qadeer, T, Qayum, M, Quah, C, Quaid, S, Quail, N, Quamina, C, Quartermaine, G, Quasim, T, Quayle, A, Quek, E, Quenby, S, Qui, X, Qui ano-Campos, J, Quick, V, Quigley, J, Quindoyos, J, Quinn, A, Quinn, J, Quinn, T, Quratulain, Q, Qureshi, D, Qureshi, E, Qureshi, H, Qureshi, I, Qureshi, K, Qureshi, N, Qurratulain, Q, Qutab, S, R Naqvi, A, Ra eswary, J, Ra kanna, J, Rabinowicz, S, Raceala, M, Rachid, A, Rachman, R, Rad, L, Radford, L, Radford, J, Radhakrishnan, J, Rafferty, H, Rafiq, M, Rafiq, S, Rafique, C, Rafique, J, Rafique, M, Ragatha, R, Raghunathan, A, Raguro, A, Raha, S, Rahama, S, Rahilly, K, Rahim, F, Rahimi, A, Rahimi, H, Rahman, M, Rahman, S, Rahmany, S, Rai, P, Rai, S, Raisova, L, Raithatha, A, Raj, A, Rajagopal, A, Rajagopalan, P, Rajaiah, N, Rajalingam, K, Rajasekaran, A, Rajasri, A, Rajeswaran, T, Rajkumar, I, Rajmohan, G, Rallan, R, Ralson, M, Ralston, K, Ralston, M, Ram, M, Ramabhadran, B, Ramali, F, Ramali, M, Ramanna, S, Ramasamy, M, Ramchandani, A, Ramdin, D, Ramirez, J, Ramirez, M, Ramnarain, G, Ramnarine, A, Ramos, L, Rampling, T, Ramraj, S, Ramsay, J, Ramshaw, A, Rand, A, Rana, G, Rand, J, Rana, N, Rana, R, Randheva, H, Ranga, P, Rangar, M, Rangarajan, H, Ranjan, S, Rank, H, Ranka, P, Rankhelawon, R, Rankin, A, Rao, A, Rao, D, Rao, S, Rarnakumar, A, Rasheed, A, Rashid, K, Rason, M, Raspa, V, Rastogi, S, Rasul, F, Ratcliff, S, Ratcliffe, S, Rath, P, Rath, S, Rather, M, Rathod, K, Rathore, S, Ratoff, J, Rattehalli, D, Ravaccia, D, Raval, M, Ravencroft, P, Raw, J, Raw, R, Rawashdeh, S, Rawlins, H, Ray, G, Raymond-White, A, Raynard, D, Rayner, H, Rayner, N, Raynsford, A, Razvi, S, Razvi, Z, Read, K, Read, S, Reay, M, Reddington, A, Reddy, A, Reddy, H, Redfearn, H, Redfern-Walsh, A, Redknap, I, Redman, N, Redome, A, Redome, J, Reed, A, Reed, J, Rees, C, Rees, J, Rees, M, Rees, T, Rees-Jones, E, Regan, F, Regan, K, Regan, M, Regan, S, Rege, K, Rehan, A, Rehman, A, Rehman, H, Rehman, S, Rehman, Z, Reid, A, Reid, J, Reid, S, Reilly, M, Reilly, S, Reka, A, Remegoso, A, Rengan, D, Renouf, L, Renshaw, C, Renu Vattekkat, R, Renville, J, Reschreiter, H, Revels, M, Revill, A, Rewitzky, G, Rey, S, Reynard, C, Reynish, D, Reynolds, H, Reynolds, P, Rhodes, J, Riaz, N, Ribeiro, P, Rice, E, Rice, M, Rice, N, Rich, M, Richards, A, Richards, L, Richards, S, Richardson, C, Richardson, E, Richardson, F, Richardson, J, Richardson, M, Richardson, N, Riches, J, Riches, K, Richmond, L, Richmond, R, Ricketts, W, Rickman, H, Riddell, A, Ridgway, S, Ridha, M, Ridley, C, Ridley, P, Rieck, G, Rigby, L, Rigby, M, Rigler, D, Riley, H, Riley, M, Riley, R, Rimba, Z, Rimmer, D, Rintoul, R, Ripley, D, Rippon, N, Rishton, C, Riste, M, Ritchie, D, Ritchie, J, Ritchings, A, Rivera Ortega, P, Rivers, V, Rizvi, B, Rizvi, S, Robb, J, Robbins, E, Roberts, G, Roberts, J, Roberts, K, Roberts, M, Roberts, N, Roberts, P, Roberts, R, Roberts, V, Robertson, C, Robertson, J, Robertson, K, Robertson, M, Robertson, N, Robertson, S, Robin, N, Robinson, A, Robinson, C, Robinson, E, Robinson, G, Robinson, H, Robinson, J, Robinson, K, Robinson, L, Robinson, M, Robinson, N, Robinson, R, Robinson, S, Robson, S, Roche, L, Roche, S, Rodden, N, Roddy, E, Roddy, J, Roderick, M, Rodger, A, Rodger, F, Rodger, M, Rodgers, D, Rodgers, N, Rodriquez-Belmonte, R, Roe, N, Rogers, G, Rogers, J, Rogers, L, Rogers, M, Rogers, P, Rogers, S, Rojkova, J, Rokadiya, S, Rollins, L, Rollo, J, Rolls, C, Rond-Alliston, A, Rooney, K, Rooney, L, Rosaroso, L, Rosby, E, Rose, A, Rose, S, Rose, Z, Rosier, J, Roskilly, A, Ross, G, Ross, I, Ross, J, Rossdale, J, Ross-Parker, A, Rostron, A, Rothman, A, Rothwell, J, Roughley, L, Rourke, C, Rowan, N, Rowan, S, Rowe, A, Rowe, N, Rowe-Leete, L, Rowlands, E, Rowlands, B, Rowley, M, Roy, S, Roycroft, M, Roynon-Reed, A, Royson, A, Rozewicz, S, Rudenko, A, Rudrakumar, S, Rudran, B, Ruff, S, Rughani, P, Rule, R, Rundell, S, Rushforth, E, Rushmer, J, Rusk, D, Russell, P, Russell, R, Russo, C, Rutgers, M, Rutkowski, K, Ryan, A, Ryan, B, Ryan, K, Ryan, L, Ryan, M, Ryan-Wakeling, D, Rybka, E, Ryder, M, Ryder, S, S Bhuiyan, M, S Rabbani, M, Saad, M, Saalmink, G, Sabale, J, Sabaretnam, S, Sadiq, N, Sadler, E, Saffy, A, Sage, B, Sagoo, H, Sagrir, S, Saha, R, Saha, S, Sahdev, N, Sahedra, S, Sahota, J, Said, N, Saini, S, Saint, B, Sajid, A, Sakthi, S, Sakuri, H, Saladi, M, Salam, A, Salberg, A, Salciute, E, Saleeb, G, Saleh, M, Salih, L, Salim, D, Salisbury, S, Saliu, S, Salman, R, Salmon, R, Salmon, J, Salutous, D, Sam, M, Samakomva, T, Saman, R, Samar, S, Saminathan, S, Samlal, R, Sammut, D, Sammut, M, Sammut, S, Sammut, T, Sampath, S, Sampson, C, Sampson, J, Samson, A, Samuel, J, Samuel, M, Samuel, R, Samuel, T, Samuel, Y, Samuels, K, Samuels, T, Samways, J, Samyraju, M, Sana, I, Sanches Gonzalez, A, Sanchez, V, Sanda-Gomez, A, Sanders, J, Sanderson, A, Sanderson, T, Sandhu, K, Sandhu, L, Sandow, S, Sandrey, V, Sands, S, Sanga, L, Sangha, H, Sanghera, J, Sangombe, M, Sanju, M, Sankaran, L, Santos, F, Santos FerreirDe Almeida, C, Santosh, R, Sanyal, J, Sanz-Cepero, A, Saralaya, D, Saraswatula, A, Saravanamuthu, P, Sarella, J, Sarfatti, A, Sargent, R, Sari, B, Sarkar, K, Sarkar, R, Sarma, S, Sarmiento, P, Sarwar, Z, Sass, T, Satchithananthasivam, K, Sathe, S, Sathianandan, S, Sathyanarayanan, A, Sathyanarayanan, L, Sathyapalan, T, Satodia, P, Saulite, V, Saunders, A, Saunders, R, Saunders, S, Saunderson, A, Savill, H, Savlani, K, Saxena, G, Saxton, M, Sayan, A, Sayers, I, Scaletta, D, Scanlon, D, Scanlon, J, Scarratt, L, Scattergood, S, Schadenberg, A, Schafers, J, Schneblen, W, Schofield, E, Schofield, R, Schofield, S, Scholes, D, Scholes, K, Schoolmeesters, A, Schumacher, N, Schunke, N, Schuster Bruce, M, Schwarz, K, Scobie, A, Scoones, T, Scorrer, T, Scott, A, Scott, C, Scott, E, Scott, K, Scott, L, Scott, M, Scott, S, Scott, T, Scott, Z, Scourfield, S, Scrase, W, Scriven, N, Scullion, A, Scullion, T, Seager, E, Seagrave, C, Seaman, R, Sear, E, Seaton, I, Seatter, A, Seckington, A, Sedano, J, Seddon, G, Sedgwick, G, See, Y, Seelarbokus, M, Sefton, C, Segovia, M, Seidu, F, Sekadde, G, Selby, F, Selby, G, Sellar, C, Sellars, R, Sellers, K, Selley, J, Sellick, V, Selvadurai, G, Selvarajah, B, Selvaskandan, H, Selvendran, S, Selwyn, J, Semmens, A, Semple, G, Sen, N, Sen, M, Sen, S, Sengupta, A, Sengupta, N, Senra, S, Senya, H, Serafimova, T, Sernicola, E, Sethi, D, Sethi, S, Setty, N, Seward, A, Sewdin, T, Sewell, T, Seymour, J, Seymour, K, Shabbir, H, Shackley, F, Shafi, T, Shafique, F, Shah, A, Shah, B, Shah, H, Shah, M, Shah, N, Shah, P, Shah, Q, Shah, R, Shah, S, Shah, W, Shahad, S, Shahi, S, Shahnazari, S, Shahzad, N, Shahzeb, M, Shaibu, A, Shaida, Z, Shaikh, A, Shaikh, M, Shail, R, Shaji, M, Shakeel, M, Shalan, K, Shamim, N, Shamji, U, Shams, A, Shams, K, Shamsah, R, Shanahan, T, Sharaf, H, Sharif, A, Sharma, A, Sharma, B, Sharma, M, Sharma, O, Sharma, P, Sharma, R, Sharma, S, Sharp, A, Sharp, C, Sharp, G, Sharp, K, Sharp, L, Sharrocks, K, Shashaa, S, Shaw, A, Shaw, C, Shaw, D, Shaw, J, Shaw, L, Shaw, M, Shaw, T, Shawcross, A, Shawcross, J, Shawe, J, Shayler, L, Shedwell, S, Shehata, Z, Sheik, A, Sheikh, A, Sheikh, N, Shelley, B, Shelton, S, Shenoy, A, Shephardson, S, Shepherd, A, Sheppard, G, Shepherd, K, Shepherd, L, Shepherd, S, Sheppeard, R, Sheridan, H, Sheridan, R, Sherridan, S, Sherris, L, Sherwin, S, Shibly, S, Shiham, F, Shilladay, C, Shillitoe, B, Shingadia, D, Shioi, C, Shirgaonkar, A, Shirt, H, Shonubi, A, Shoote, J, Shorrocks, R, Shortman, R, Shotton, R, Shotton, S, Shovelton, C, Shpuza, E, Shrestha, N, Shuker, K, Shurlock, J, Shurmer, J, Shuvo, M, Siame, G, Siamia, L, Siddavaram, S, Siddique, N, Siddique, S, Siddle, E, Sidebotham, E, Sidebottom, J, Sievers, R, Siggens, K, Sikondari, N, Silva, S, Silva Moniz, C, Sim, M, Simangan, T, Simbi, V, Sime, R, Simmons, G, Simmons, O, Simms, R, Simon, L, Simon, M, Simon, N, Simpkins, S, Simpson, A, Simpson, D, Simpson, G, Simpson, J, Simpson, K, Simpson, M, Simpson, P, Simpson, T, Sinclair, D, Sing, C, Singh, A, Singh, C, Singh, D, Singh, J, Singh, L, Singh, M, Singh, N, Singh, P, Singh, S, Singhal, P, Singizi, B, Singler, V, Sinh, M, Sinha, U, Sinha, P, Sinha, S, Sisson, G, Sithiravel, S, Sivakumar, K, Sivakumar, S, Sivakumran, D, Sivanadarajah, S, Sivasothy, P, Skaria, A, Skehan, N, Skelly, R, Skelton, O, Skene, I, Skinner, V, Skinner, D, Skorko, A, Skorupinska, I, Skorupinska, M, Slack, A, Slack, K, Slade, M, Slater, L, Slawson, N, Slingsby, R, Sloan, A, Sloan, B, Sloan, D, Sloane, G, Slowinska, M, Small, B, Small, E, Small, S, Smallridge, A, Smalls, D, Smallshaw, K, Smallwood, A, Smart, B, Smart, L, Smeaton, J, Smit, C, Smith, A, Smith, C, Smith, D, Smith, E, Smith, H, Smith, I, Smith, J, Smith, K, Smith, L, Smith, M, Smith, N, Smith, O, Smith, P, Smith, R, Smith, S, Smith, T, Smith, V, Smolen, S, Smuts, S, Smyth, N, Snell, A, Snell, D, Snell, L, So, A, So, B, Soan, M, Sobande, T, Sobowiec Kouman, S, Sobrino Diaz, A, Sohail, B, Sohal, H, Soiz, R, Solademi, O, Soleimani, B, Solesbury, A, Soliman, M, Solis, B, Solly, R, Solomon, L, Somalanka, S, Somashekar, C, Sommerfield, S, Soni, G, Sonia, R, Sonoiki, T, Soo, S, Soor, P, Soothill, G, Soren, J, Sothinathan, A, Sothirajah, P, Sousa, J, Soussi, N, Southam, D, Southern, D, Southern, I, Southern, L, Southin, S, Southwell, J, Southworth, T, Sowden, S, Sowter, J, Spalding, C, Speare, C, Spears, K, Spears, M, Speirs, L, Speirs, S, Spence, M, Spence, N, Spencer, B, Spencer, G, Spencer, R, Spencer, S, Spencer, T, Spickett, H, Spillane, J, Spiller, W, Spinks, K, Spinks, M, Spittle, N, Spray, S, Spring, O, Springgs, J, Squires, G, Squires, J, Squires, R, Sreenivasan, R, Sreenivasan, S, Sri Paranthamen, K, Srikantaiah, R, Srinivasan, K, Srinivasan, R, Srirajamadhuveeti, A, Srirathan, V, Stacey, R, Stacpoole, S, Stadon, L, Stagg, W, Staines, J, Staines, N, Stammers, K, Stanciu, R, Stanczuk, G, Standley, T, Staniforth, B, Stanton, A, Stanton, L, Staples, R, Stapley, S, Stark, A, Starkey, E, Starnes, D, Starr, M, Stead, R, Stebbing, C, Steele, C, Steer, H, Steer, J, Stefania, V, Stefanowska, P, Steffensen, F, Stemp, C, Stenson, E, Stephens, A, Stephensen, D, Stephenson, E, Sterrenburg, M, Stevens, J, Stevens, M, Stevenson, A, Stevenson, L, Stevenson, S, Steward, M, Stewart, C, Stewart, D, Stewart, K, Stewart, M, Stewart, R, Stickley, J, Stiller, G, Stirrup, S, Stock, S, Stockdale, A, Stocker, D, Stockham, L, Stockton, P, Stoddard, E, Stokes, C, Stone, B, Stone, R, Stone, S, Storey, I, Storton, K, Stourton, F, Strachan, A, Strait, C, Stratton, E, Stratton, J, Straw, S, Streit, D, Stride, E, Stringer, S, Strong-Sheldrake, S, Struik, S, Stuart, C, Stubbs, A, Stubbs, H, Sturdy, A, Sturney, S, Stuttard, M, Suarez, C, Subba, K, Subbe, C, Subramaniam, K, Subramanian, M, Subramanian, V, Subudhi, C, Suckling, R, Sudershan, S, Sugden, P, Sukla, R, Sukumara, A, Suleiman, E, Suliman, A, Suliman, F, Sultan, S, Sundar, S, Sundaram, R, Sundhar, R, Sung, E, Sunni, N, Suntharalingam, J, Sur, A, Suresh, D, Suresh, N, Suresh, S, Surtees, M, Susan, C, Suter, D, Suthar, R, Sutherland, H, Sutherland, R, Sutherland, S, Sutinyte, D, Sutton, D, Sutton, S, Svensson, M, Svirpliene, S, Swain, A, Swain, R, Swaine, T, Swales, C, Swanson-Low, C, Swart, T, Sweetman, S, Swift, E, Swift, P, Swift, R, Swingler, R, Swinhoe, S, Swist-Szulik, K, Swithenbank, L, Syed, O, Sykes, C, Sykes, D, Sykes, E, Sylvester, L, Symington, D, Symon, D, Syndercombe, A, Syrimi, Z, Syson, J, Szabo, G, Szabó, D, Szakmany, T, Szarazova, N, Szekely, M, Szekeres, A, Szeto, M, Szymiczek, K, Tadros, M, Tageldin, A, Tague, L, Tahir, H, Tahir, M, Tai, M, Tait, J, Takyi, A, Talbot, P, Talbot -Smith, A, Talbot-Ponsonby, J, Tallent, R, Tallon, B, Tan, A, Tan, B, Tan, H, Tan, J, Tan, K, Tan, W, Tana, A, Tanner, A, Tanney, C, Tanqueray, T, Tanton, E, Tanzil-Al-Imran, T, Tarft, H, Taribagil, P, Tarin, O, Tariq, S, Tarpey, D, Tarr, E, Tarrant, L, Tasiou, A, Tate, A, Tate, M, Tate, P, Tatham, K, Tavares, S, Tavoukjian, V, Taylor, A, Taylor, B, Taylor, C, Taylor, D, Taylor, E, Taylor, H, Taylor, L, Taylor, M, Taylor, N, Taylor, R, Taylor, S, Taylor, T, Taylor, V, Taylor-Siddons, M, Taynton, T, Te, A, Teasdale, F, Teasdale, J, Teasdale, K, Tebbutt, J, Tee, C, Teeluck, I, Tejero Moya, B, Tejwani, R, Telfer, A, Teli, V, Tempany, J, Temple, J, Temple, N, Tench, H, Teoh, Y, Tereszkowski-Kaminski, R, Terrett, L, Terry, L, Tetla, D, Tewari, S, Tewkesbury, D, Texeira, J, Tey, C, Thake, M, Thakker, C, Thakker, M, Thakrar, J, Thamu, B, Thatcher, H, Thayanandan, A, Thazhatheyil, K, Thein, E, Theocharidou, L, Thet, P, Thevarajah, K, Thevendra, M, Thiri Phoo, N, Thirlwall, Y, Thirumaran, M, Thomas, A, Thomas, C, Thomas, H, Thomas, J, Thomas, K, Thomas, L, Thomas, R, Thomas, S, Thomas, T, Thomas, V, Thomasson, K, Thomas-Turner, R, Thompson, C, Thompson, E, Thompson, F, Thompson, H, Thompson, J, Thompson, K, Thompson, L, Thompson, M, Thompson, O, Thompson, R, Thompson, Y, Thomson, N, Thorburn, P, Thorn, N, Thorne, C, Thorne, N, Thornton, A, Thornton, D, Thornton, J, Thornton, R, Thornton, S, Thornton, T, Thorpe, S, Thorpe, C, Thorpe, N, Thozthumparambil, P, Thrasyvoulou, L, Thraves, H, Thueux, G, Thu-Ta, P, Thwaiotes, V, Tiberi, S, Tieger, S, Tierney, C, Tighe, M, Tilbey, S, Till, C, Tiller, A, Tiller, H, Timerick, J, Timlick, E, Timmins, A, Timmis, A, Timms, H, Timoroksa, A, Tinashe, S, Tingley, S, Tinker, N, Tinkler, M, Tipper, J, Tirumalai Adisesh, A, Tivenan, H, Tluchowska, K, T-Michael, H, Todd, A, Todd, J, Todd, S, Toffoletti, O, Tohfa, M, Tohill, S, Tolson, M, Tomasova, N, Tomlin, S, Tomlins, S, Tomlinson, J, Tomlinson, K, Tonkin, J, Tonna, I, Toohey, C, Topham, K, Topping, M, Torokwa, A, Torrance, C, Touma, O, Tous Sampol, L, Tousis, R, Tout, M, Tovey, P, Towersey, G, Townley, J, Tozer, R, Tran, M, Tranter, H, Travers, J, Travill, C, Traynor, S, Trethowan, L, Treus Gude, E, Trevelyan, M, Trewick, N, Tridente, A, Triggs, S, Trim, F, Trimmings, A, Trinick, T, Trivedi, K, Troedson, S, Tropman, E, Trotter, A, Trous, S, Trower, H, Trowsdale Stannard, M, Trudgill, N, Truman, N, Truslove, M, Trussell, S, Trussell, T, Tsakiridou, K, Tsang, C, Tsang, P, Tsawayo, T, Tsilimpari, K, Tsinaslanidis, G, Tso, S, Tucker, S, Tucker, N, Tudor, D, Tufail, A, Tuff, J, Tuffney, J, Tully, R, Tunesi, G, Turbitt, K, Turel, R, Turgut, T, Turley, C, Turnbull, A, Turner, A, Turner, C, Turner, K, Turner, L, Turner, M, Turner, P, Turner, S, Turner, V, Turner-bone, I, Turney, S, Turvey, J, Tweed, C, Tweed, D, Twemlow, R, Twohey, E, Tyagi, B, Tyagi, V, Tyer, A, Tyler, A, Tyler, J, Tyzack, A, Tzavaras, P, Tzinieris, I, Uddin, A, Uddin, M, Uddin, R, Ugoji, J, Ukaegbu, E, Ul Haq, M, Ul Hassan, W, Ul-Haq, Z, Ullah, S, Um, J, Umaipalan, A, Umate, A, Umeadi, J, Umeh, A, Umeojiako, W, Ummat, B, Underhill, E, Underwood, C, Underwood, J, Uppal, V, Upson, G, Ur Rasool, M, Uriel, A, Urruela, S, Uru, H, Usher, J, Usher, M, Usher-Rea, A, Ustianowski, A, Uzu, H, Vaccari, L, Vaghela, U, Vaidya, A, Vail, D, Valecka, B, Valentine, J, Valeria, B, Vallabhaneni, P, Vallotton, N, Vamplew, L, Vamvakiti, E, Vamvakopoulos, J, van Bruggen, L, van de Venne, M, van der Meer, A, van der Stelt, N, van Koutrik, L, Van Loggerenberg, A, Vance-Daniel, J, Vancheeswaran, R, Vandeyoon, S, Vankayalapati, P, Vanmali, P, Vansomeren, C, Vara, S, Vardy, S, Varghese, A, Varghese, M, Varney, W, Varnier, G, Varouxaki, A, Varquez, R, Vasadi, V, Vassell, K, Vassell, O, Vasu, V, Vasudevan, V, Vatish, M, Vaughan, S, Vayalaman, H, Vayapooree, D, Vaz, C, Veale, N, Veerasamy, S, Velankar, S, Velauthar, L, Veli, N, Vella, N, Velugupati, A, Velusamy, A, Venables, I, Venditti, M, Venkataramakrishnan, R, Venn, R, Ventilacion, L, Vere, J, Veres, M, Vergnano, S, Verling, W, Verma, A, Vernall, R, Vernon, B, Vertue, M, Verueco, L, Verula, J, Vethanayagam, N, Vettikumaran, S, Veys, L, Vickers, C, Victor, S, Victoria, S, Vidler, J, Vijayakumar, B, Vijayaraghavan Nalini, V, Vilcinskaite, B, Vileito, A, Vilimiene, N, Vinall, L, Vinay, S, Vinayakarao, L, Vincent, O, Vincent, R, Virdee, P, Virgilio, E, Virk, A, Visentin, E, Vitaglione, M, Vithian, K, Vittoria, S, Vivekananthan, S, Vlad, E, Vlies, B, von Oven, L, Vooght, C, Vutipongsatorn, K, Vuylsteke, A, Vyras, E, W Hay, A, Wach, R, Wadams, B, Wadd, S, Waddington, N, Wade, P, Wadsley, J, Wadsworth, K, Wafa, S, Wagstaff, D, Wagstaff, L, Wahab, D, Wahbi, Z, Waheed Adigun, A, Waidyanatha, S, Waite, A, Wake, R, Wakefield, A, Wakeford, W, Wakinshaw, F, Waldeck, E, Walden, A, Walding, L, Waldron, A, Waldron, J, Wales, E, Wali, B, Walker, D, Walker, G, Walker, H, Walker, I, Walker, K, Walker, L, Walker, O, Walker, R, Wallace, G, Wallbutton, R, Wallen, J, Waller, A, Waller, R, Wallis, G, Wallis, L, Wallis, M, Walmsley, E, Walsh, D, Walsh, E, Walsh, L, Walstow, D, Walter, D, Walters, A, Walters, H, Walton, L, Walton, M, Walton, O, Walton, S, Wands, M, Wane, R, Wang, F, Wang, N, Wang, R, Wang, S, Warbrick, D, Warburton, S, Ward, C, Ward, D, Ward, E, Ward, H, Ward, J, Ward, L, Ward, N, Ward, R, Ward, T, Warden, S, Wardere, G, Wardle, S, Wardy, H, Waring, G, Waring, S, Warner, B, Warner, C, Warnock, L, Warran, S, Warren, J, Warren, L, Warren, R, Warren, Y, Warrender, D, Warren-Miell, H, Warwick, G, Wassall, H, Wasson, E, Wastson, E, Watchorn, H, Waterfall, H, Waters, A, Waters, D, Waterstone, M, Watkin, A, Watkins, C, Watkins, E, Watkins, K, Watkins, L, Watson, A, Watson, E, Watson, F, Watson, J, Watson, K, Watson, L, Watson, P, Watson, R, Watters, M, Watterson, D, Watts, D, Watts, J, Watts, M, Waugh, V, Wayman, M, Wazir, A, Weatherhead, M, Weatherly, N, Webb, C, Webb, H, Webb, K, Webb, S, Websdale, C, Webster, D, Webster, I, Webster, J, Webster, T, Wedlin, J, Wee, L, Weerakoon, R, Weerasinghe, T, Weeratunga, J, Weetman, M, Wei, S, Weichert, I, Welch, E, Welch, H, Welch, L, Welch, S, Welham, B, Weller, S, Wellings, L, Wells, B, Wellstead, S, Welsh, B, Welters, I, Welton, R, Wenn, V, Wentworth, L, Wesonga, J, Wesseldine, K, West, J, West, M, West, R, West, S, Western, L, Westhead, R, Weston, H, Westwood, A, Westwood, K, Westwood, S, Wetherill, B, Wheaver, S, Wheeler, H, Whelan, B, Whelband, M, Whileman, A, Whitcher, A, White, A, White, B, White, C, White, D, White, J, White, K, White, M, White, N, White, S, White, T, Whitehead, C, Whitehorn, K, Whitehouse, C, Whitehouse, T, Whiteley, J, Whiteley, L, Whiteley, S, Whitham, R, Whitlingum, G, Whitmore, D, Whittam, L, Whittington, A, Whittle, H, Whittle, R, Wiafe, E, Wiblin, L, Wickens, O, Widdrington, J, Wieboldt, J, Wieringa, H, Wiesender, C, Wiffen, L, Wight, A, Wignall, A, Wignall, C, Wilce, A, Wilcock, D, Wilcock, E, Wilcox, L, Wild, B, Wild, L, Wild, S, Wilde, M, Wilding, L, Wilding, P, Wildsmith, T, Wileman, J, Wiles, K, Wilhelmsen, E, Wiliams, T, Wilkie, J, Wilkin, D, Wilkins, H, Wilkins, J, Wilkins, S, Wilkinson, I, Wilkinson, L, Wilkinson, N, Wilkinson, T, Willetts, S, Williams, A, Williams, C, Williams, D, Williams, E, Williams, G, Williams, H, Williams, J, Williams, K, Williams, M, Williams, R, Williams, S, Williams, T, Williamson, A, Williamson, H, Williamson, R, Willis, E, Willis, H, Willis, J, Wills, L, Willsher, L, Willshire, C, Wilson, A, Wilson, B, Wilson, D, Willson, F, Wilson, I, Willson, J, Wilson, K-A, Wilson, L, Wilson, M, Wilson, T, Win, K, Win, M, Win, T, Win, W, Winckworth, L, Winder, L, Winder, P, Winearl, S, Winmill, H, Winn, S, Winpenny, C, Winslow, H, Winter, H, Winter, J, Winter-Goodwin, B, Winterton, J, Winwood, H, Wischhusen, J, Wisdom, S, Wise, M, Wiselka, M, Wiseman, R, Wiseman, S, Wishart, S, Wishlade, T, Witele, E, Withers, N, Wixted, D, Wodehouse, T, Wolf, W, Wolff, N, Wolffsohn, K, Wolf-Roberts, R, Wolodimeroff, E, Wolstencroft, A, Wong, A, Wong, C, Wong, C H, Wong, E, Wong, J, Wong, K, Wong, M, Wong, N, Wong, S, Wong, T, Wood, A, Wood, D, Wood, F, Wood, G, Wood, H, Wood, J, Wood, L, Wood, M, Wood, S, Wood, T, Woodall, K, Woodfield, R, Woodford, C, Woodford, E, Woodford, J, Woodhead, L, Woodhead, T, Woodland, P, Woodman, M, Woodmansey, S, Woods, C, Woods, J, Woods, K, Woods, S, Woodward, Z, Woolcock, M, Wooldridge, G, Woolf, R, Woollard, C, Woollen, L, Woolley, E, Woolley, J, Woosey, D, Wootton, D, Wootton, J, Worley, D, Worton, S, Wraight, J, Wray, M, Wren, K, Wren, L, Wrey Brown, C, Wright, C, Wright, D, Wright, F, Wright, H, Wright, I, Wright, L, Wright, R, Wright, S, Wright, T, Wroe, C, Wroe, H, Wu, H, Wu, P, Wubetu, J, Wulandari, R, Wurie, S, Wyatt, C, Wyn-Griffiths, F, Wynter, I, Xavier, B, Xhikola, A, Xia, B, Xia, Z, Y Ellis, T, Yacoba, E, Yakubi, M, Yan, M, Yanagisawa, Y, Yang, F, Yang, Y, Yanney, M, Yap, W, Yaqoob, N, Yasmin, S, Yates, B, Yates, D, Yates, E, Yates, H, Yates, M, Yates, T, Ye, J, Yearwood Martin, C, Yein, K, Yeoh, A, Yeung, C, Yew, P, Yewatkar, D, Ylquimiche Melly, L, Ynter, I, Yong, H, Yorke, J, Youens, J, Younes Ibrahim, A, Young, E, Young, G, Young, L, Yousafzar, A, Youssouf, S, Yousuf, A, Yu, C, Yuan, J, Yung, B, Yusef, D, Yusef, S, Yusuf, I, Zafar, A-M, Zagalo, S, Zaher, S, Zahoor, A, Zainab, M, Zak, T, Zaki, K, Zakir, N, Zalewska, K, Zamalloa, A, Zaman, M, Zaman, S, Zamikula, J, Zammit, L, Zammit-Mangion, M, Zawadzka, M, Zebracki, E, Zehnder, D, Zeidan, L, Zeinali, D, Zhang, J, Zhao, X, Zheng, D, Zia, M, Zibdeh, O, Zill-E-Huma, R, Zin, E, Zincone, E, Zindoga, G, Zinkin, E, Zinyemba, V, Zipitis, C, Zitter, L, Zmierczak, A, Zubikarai, G, Zubir, A, Zuhra, N, Zulaikha, R, Zulfikar, S, Zullo, C, and Zuriaga-Alvaro, A
Published: 2024
Full Text: View/download PDF

45. Polymorphism of class A scavenger receptors in C57BL/6 mice1

Author: Alan Daugherty, Stewart C. Whitman, Amy E. Block, and Debra L. Rateri
Subjects: lipoprotein metabolism, adhesion, atherosclerosis, macrophages, Biochemistry, QD415-436
Abstract: Scavenger receptors class A (SR-A) have been hypothesized to regulate the development of atherosclerotic lesions through recognition of modified low density lipoprotein (LDL) and macrophage adhesion to substrata. Supporting data have been collected from studies using the monoclonal antibody 2F8, an antibody developed from the BALB/c strain-derived macrophage cell line, RAW.264. Although 2F8 immunostained both cultured peritoneal macrophages (MPM) and thymic macrophages from Swiss, BALB/c, and DBA/2 mice, no immunostaining was detected in cells and tissues from C57BL/6 mice, one of the most commonly used atherosclerosis-susceptible mouse strains. Similarly, 2F8 detected SR-A protein in MPM by Western blotting in all strains except C57BL/6. However, a guinea pig antiserum developed to a fusion protein of the extracellular SR-A domain detected appropriately sized bands in all strains. Incubation with 2F8 antagonized acetylated low-density lipoprotein (AcLDL)-induced cholesterol esterification in MPM from BALB/c, Swiss, and DBA/2 strains but had no effect on MPM from C57BL/6 mice. Sequencing of SR-A cDNA from C57BL/6 mice demonstrated complete identity with published sequence in the collagenlike domain. However, four single-residue substitutions were noted in the α-helical coiled-coil domain. Site-directed mutagenesis demonstrated that a single substitution (L168S) in this domain accounted for the loss of 2F8 immunoreactivity. Differing reactivities toward a commonly used monoclonal antibody were used to identify polymorphism of SR-A in C57BL/6 mice.—Daugherty, A., S. C. Whitman, A. E. Block, and D. L. Rateri. Polymorphism of class A scavenger receptors in C57BL/6 mice. J. Lipid Res. 2000. 41: 1568–1577.
Published: 2000
Full Text: View/download PDF

46. Regulation of acetylated low density lipoprotein uptake in macrophages by pertussis toxin-sensitive G proteins

Author: Stewart C. Whitman, Alan Daugherty, and Steven R. Post
Subjects: atherosclerosis, endocytosis, cholesterol, ACAT, class A scavenger receptor, β-VLDL, Biochemistry, QD415-436
Abstract: Class A scavenger receptors (SR-A) mediate the uptake of modified low density lipoprotein (LDL) by macrophages. Although not typically associated with the activation of intracellular signaling cascades, results with peritoneal macrophages indicate that the SR-A ligand acetylated LDL (AcLDL) promotes activation of cytosolic kinases and phospholipases. These signaling responses were blocked by the treatment of cells with pertussis toxin (PTX) indicating that SR-A activates Gi/o-linked signaling pathways. The functional significance of SR-A-mediated Gi/o activation is not clear. In this study, we investigated the potential role of Gi/o activation in regulating SR-A-mediated lipoprotein uptake. Treatment of mouse peritoneal macrophages with PTX decreased association of fluorescently labeled AcLDL with cells. This inhibition was dependent on the catalytic activity of the toxin confirming that the decrease in AcLDL uptake involved inhibiting Gi/o activation. In contrast to the inhibitory effect on AcLDL uptake, PTX treatment did not alter β-VLDL-induced cholesterol esterification or deposition of cholesterol. The ability of polyinosine to completely inhibit AcLDL uptake, and the lack of PTX effect on β-VLDL uptake, demonstrated that the inhibitory effect is specific for SR-A and not the result of non-specific effects on lipoprotein metabolism. Despite having an effect on an SR-A-mediated lipoprotein uptake, there was no change in the relative abundance of SR-A protein after PTX treatment. These results demonstrate that activation of a PTX-sensitive G protein is involved in a feedback process that positively regulates SR-A function.—Whitman, S. C., A. Daugherty, and S. R. Post. Regulation of acetylated low density lipoprotein uptake in macrophages by pertussis toxin-sensitive G proteins. J. Lipid Res. 2000. 41: 807–813.
Published: 2000
Full Text: View/download PDF

47. On prime factors of terms of binary recurrence sequences

Author: Stewart, C. L.
Subjects: Mathematics - Number Theory, 11B37
Abstract: We give estimates from below for the greatest prime factor of the n-th term of a binary recurrence sequence.
Published: 2022

48. Uptake of type IV hypertriglyceridemic VLDL by cultured macrophages is enhanced by interferon-γ

Author: Stewart C. Whitman, Carmen A. Argmann, Cynthia G. Sawyez, David B. Miller, Robert A. Hegele, and Murray W. Huff
Subjects: cytokine, lipid deposition, lipoprotein, atherosclerosis, lipoprotein lipase, ACAT, Biochemistry, QD415-436
Abstract: Hypertriglyceridemic (HTG) very low density lipoproteins (VLDL) from subjects with type IV hyperlipoproteinemia induce both cholesteryl ester (CE) and triglyceride (TG) accumulation in cultured J774 macrophages. We examined whether the cytokine interferon-γ (IFN-γ), which is expressed by lymphocytes in atherosclerotic lesions, would modulate macrophage uptake of HTG-VLDL. Incubation of cells with HTG-VLDL alone significantly increased cellular CE and TG mass 17- and 4.3-fold, respectively, while cellular free cholesterol (FC) was unaffected. Preincubation of cells with IFN-γ (50 U/ml) prior to incubation with HTG-VLDL caused a marked enhancement in cellular CE and TG 27- and 6-fold over no additions (controls), respectively, and a 1.5-fold increase in FC. IFN-γ increased low density lipoprotein (LDL)-induced cellular CE 2-fold compared to LDL alone. IFN-γ did not enhance the uptake of type III (apoE2/E2) HTG-VLDL or VLDL from apoE knock-out mice. Incubations in the presence of a lipoprotein lipase (LPL) inhibitor or an acylCoA:cholesterol acyltransferase (ACAT) inhibitor demonstrated that the IFN-γ-enhanced HTG-VLDL uptake was dependent on LPL and ACAT activities. IFN-γ significantly increased the binding and degradation of 125I-labeled LDL. Binding studies with 125I-labeled α2-macroglobulin, a known LDL receptor-related protein (LRP) ligand, and experiments with copper-oxidized LDL indicated that the IFN-γ-enhanced uptake was not due to increased expression of the LRP or scavenger receptors. Thus, IFN-γ may promote foam cell formation by accelerating macrophage uptake of native lipoproteins. IFN-γ-stimulated CE accumulation in the presence of HTG-VLDL occurs via a process that requires receptor binding-competent apoE and active LPL. IFN-γ-enhanced uptake of both HTG-VLDL and LDL is mediated by the LDL-receptor and requires ACAT-mediated cholesterol esterification.—Whitman, S. C., C. A. Argmann, C. G. Sawyez, D. B. Miller, R. A. Hegele, and M. W. Huff. Uptake of type IV hypertriglyceridemic VLDL by cultured macrophages is enhanced by interferon-γ. J. Lipid Res. 1999. 40: 1017–1028.
Published: 1999
Full Text: View/download PDF

49. AFSegNet: few-shot 3D ankle-foot bone segmentation via hierarchical feature distillation and multi-scale attention and fusion

Author: Huang, Yuan, Holcombe, Sven A., Wang, Stewart C., and Tang, Jisi
Published: 2024
Full Text: View/download PDF

50. Local Assessment and Small Bowel Crohn’s Disease Severity Scoring using AI

Author: Enchakalody, Binu E., Wasnik, Ashish P., Al-Hawary, Mahmoud M., Wang, Stewart C., Su, Grace L., Ross, Brian, and Stidham, Ryan W.
Published: 2024
Full Text: View/download PDF

Catalog

Books, media, physical & digital resources

See catalog results

Searchworks

Select search scope, currently: Articles Catalog books, media & more in Jio Institute collections Articles journal articles & other e-resources

Search

Search Constraints

Refine your results

Search Limiters

Topic

Publication Year Range

Language

Category

Publication Type

Journal

Region

Database

Publisher

12,824 results on '"Stewart C."'

Search Results

Catalog

Select search scope, currently: Articles

Catalog

books, media & more in Jio Institute collections

Articles

journal articles & other e-resources