Search

Gaeumannomyces graminis var. graminis (Ggg) has been the etiological agent of take-all root rot (TARR) in St. Augustinegrass (Stenotaphrum secundatum) and root decline of the other warm-season turfgrasses. Seventy-five Ggg isolates were obtained from St. Augustinegrass in central and east Texas. Evaluation of colony morphologies on potato dextrose agar (PDA) within 2 wk and follow-up multilocus phylogenic analyses revealed three phenotypic groups associated with different Gaeumannomyces species: (i) G. floridanus, highly melanized with round colony formation; (ii) G. arxii, none to slightly melanized with round colony formation; and (iii) G. graminicola, highly melanized with irregular colony formation. Further examination with representative isolates from each group revealed that their phenotypic characterizations supported the distinctive genetic groups within Ggg associated with St. Augustinegrass TARR. Gaeumannomyces floridanus isolates grew faster at warmer temperature (30 C) than G. arxii or G. graminicola. Pathogenicity assays using rice seedlings indicated that G. floridanus was more aggressive in disease symptom development than G. arxii or G. graminicola. A multilocus phylogeny reconstruction supported that most of Gaeumannomyces isolates tested in this study were separated into three phylogenetically distinct groups: G. floridanus, G. arxii, and G. graminicola. The resolution of intravarietal complexities of causal fungi of TARR is important for proper diagnostics and management strategies for TARR in St. Augustinegrass and other root-decline diseases in warm-season turfgrasses.

Short Communication Since October 2019, chinch bugs have been detected in large sunken dead patches of St. Augustinegrass (Stenotaphrum secundatum) lawns in different locations of Lisbon and Setubal districts, in Portugal. Based on morphological and molecular studies, using mitochondrial Cytochrome C Oxidase subunit I (COI) gene, the collected insects were identified as Blissus insularis (Hemiptera, Heteroptera, Blissidae). This is the first record of this noxious chinch bug species in Europe and in the Palaearctic region The project was funded by Laboratório de Patologia Vegetal “Veríssimo de Almeida”, School of Agriculture, University of Lisbon info:eu-repo/semantics/publishedVersion

The twolined spittlebug, Prosapia bicincta (Say) (Hemiptera: Cercopidae), is an important insect pest of turfgrass in the eastern United States. Although twolined spittlebug infests most warm-season turfgrasses, the influence of low and high relative humidity (RH) on the expression of feeding damage in warm-season turfgrasses is not well understood. Experiments were conducted in which five warm-season turfgrasses were caged with ten twolined spittlebug adults and exposed to 40% and 95% RH for 5 days. The extent of damage was measured with a SPAD meter (chlorophyll content), and ratings of greenness, yellowness, and purpleness were obtained using a scale system. Physiological parameters such as stomatal conductance (GS), photosynthesis (A), evapotranspiration (E), and water use efficiency (WUE) were measured. Under both 40 and 95% RH, bermudagrass [Cynodon L.C. Rich, spp.] exhibited injury symptoms after twolined spittlebug exposure. The rate of A was lower in the presence of twolined spittlebug in bermudagrass under both RHs. Injury symptoms in centipedegrass [Eremochloa ophiuroides (Munro) Hack] were only observed under high-RH conditions, whereas in zoysiagrass [Zoysia matrella (L.) Merrill.] symptoms were only observed under low RH. Minimal levels of symptom expression were observed in St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze], and no feeding symptoms were observed in seashore paspalum [Paspalum vaginatum Sw.] under low RH. Overall, the presence of twolined spittlebug A was influenced by high RH, whereas WUE was affected by low RH in most of the turfgrass genotypes.

Background Stenotaphrum secundatum is an important grass with a rich variety of accessions and great potential for development as an economically valuable crop. However, little is known about the genetic diversity of S. secundatum, limiting its application and development as a crop. Here, to provide a theoretical basis for further conservation, utilization, and classification of S. secundatum germplasm resources, we used phenotypic and molecular markers (single-nucleotide polymorphisms, SNPs; sequence-related amplified polymorphism, SRAP; inter-simple sequence repeat, ISSR) to analyze the genetic diversity of 49 S. secundatum accessions. Results Based on seven types of phenotypic data, the 49 S. secundatum accessions could be divided into three classes with great variation. We identified 1,280,873 SNPs in the 49 accessions, among which 66.22% were transition SNPs and 33.78% were transversion SNPs. Among these, C/T was the most common (19.12%) and G/C the least common (3.68%). Using 28 SRAP primers, 267 polymorphic bands were detected from the 273 bands amplified. In addition, 27 ISSR markers generated 527 amplification bands, all of which were polymorphic. Both marker types revealed a high level of genetic diversity, with ISSR markers showing a higher percentage of polymorphic loci (100%) than SRAP markers (97.8%). The genetic diversity of the accessions based on SRAP markers (h = 0.47, I = 0.66) and ISSR markers (h = 0.45, I = 0.64) supports the notion that the S. secundatum accessions are highly diverse. S. secundatum could be divided into three classes based on the evaluated molecular markers. Conclusions Phenotypic and molecular marker analysis using SNP, SRAP, and ISSR markers revealed great genetic variation among S. secundatum accessions, which were consistently divided into three classes. Our findings provide a theoretical basis for the genetic diversity and classification of S. secundatum. Our results indicate that SNP, SRAP and ISSR markers are reliable and effective for analyzing genetic diversity in S. secundatum. The SNPs identified in this study could be used to distinguish S. secundatum accessions.

The integration of livestock with plantations is one of efforts to support livestock agribusiness. The large potential land area can be used for the development of cattle. However, the low production, nutrient content and digestibility of natural grasses in the plantation are still an obstacle to increase cattle productivity. Therefore, the development of shade tolerant of forages is one of the strategies to improve the quality and production of forages in the plantation area. This paper aims to review the role of Stenotaphrum secundatum as a shade tolerant forage in oil palm plantations in supporting cattle productivity. Biomass production of Stenotaphrum secundatum obtained was relatively high at 42,209 kg DM/ha/yr in oil palm plantations aged 3.5 years, estimated to be able to accommodate cattle of 11.8 AU/ha. With a moderate composition of nutrition, it can improve cattle growth performance with an average body condition score of 3.8. The livestock integration system by developing S. secundatum in the oil palm plantation area has a positive effect because it can reduce fertilizer and weeding costs of 4 million IDR/ha/yr. The average production of fresh fruit bunches (FFB) reaching 19.5 tons/ha/yr. It can be concluded that the role of S. secundatum in oil palm plantations can support cattle productivity and increase palm oil production.

Samama (Anthocephalus marcophyllus Roxb.Havil) is a tree with a canopy like a large umbrella so that if planted at any distance it will not affect the shape of the stem (Halawane et al. 2011). This type can flourish in tropical forests with an altitude of 50-1000 mdpl. This is including native Indonesian plants that have the potential to be developed in the development of plantation forests and for other purposes, such as reclamation of ex-mining land, reforestation and shade trees (Mansur and Tuheteru 2010). This is because samama can grow on various types of soil, do not have serious pests and diseases (Pratiwi 2003). In accordance with the permit for the implementation of silvopatura activities in production forest areas which are explained in full in the regulations of the Ministery of Environment and Forestry of the Republic of Indonesia No. P.14/Menlhk-11/2015 concerning procedures for granting business licenses for the utilization of silvopastura areas in production forests with the aim of ensuring sustainable forest management by applying the principles of good governance. In the framework of sustainable production forest management to support food sovereignty programs. Provision of sufficient light space, fertilize and selection of tolerant grass species under stands are the key to the success of silvopastura. Based on the results of the study, it was found that the density of trees with 2 tree/plot with light intensity in the morning was 70.48% and 95.29% during the day. Addition of nitrogen to grass is not needed if the soil used has good fertility. Pennisetum purpureum Cv. Mott has the best tolerance under the same stand as a source of cut grass (intensive retention) and Stenotaphrum secundatum a coarse, hardly perennial grass in the management of silvopastura extensive. Key words: silvopasture, density of tree, shade, samama

The complete plastid genome of Stenotaphrum subulatum Trin. was determined and analyzed in this work. The plastid genome was 139,282 bp in length with 82,220 bp of the large single-copy (LSC) regio...

Turfgrasses are ubiquitous in urban landscapes and can provide numerous ecosystem services. However, most warm season turfgrasses are produced, planted, and maintained as cultivar monocultures, which may predispose them to herbivore attack and reduce the services lawns provide. Though rarely done, host plant resistance can be used as a strategy to reduce herbivory and preserve beneficial services. Increasing turfgrass cultivar diversity may provide similar or greater benefits through associational resistance, whereas conserving desirable maintenance and aesthetic traits. However, no studies have examined this in warm season turfgrasses. To address this, we evaluated host plant resistance to fall armyworm (Spodoptera frugiperda [J.E. Smith] [Lepidoptera: Noctuidae]) in commercially available cultivars of St. Augustinegrass (Stenotaphrum secundatum [(Walt.) Kuntz] [Lepidoptera: Noctuidae]) and then investigated if the resistance or susceptibility of St. secundatum cultivars carried over in mixed cultivar plantings. Through a no-choice experiment and a limited-choice experiment, we detected no host plant resistance in monocultures of St. secundatum cultivars. However, we did find that as cultivar diversity increased, female Sp. frugiperda larval weight and herbivory decreased. Additionally, choice tests indicated that larvae prefer less diverse stands of St. secundatum cultivars. Interestingly, our results suggest that in the absence of host plant resistance, warm season turfgrass cultivar diversity may reduce herbivore pest fitness and damage. These results demonstrate that warm season turfgrass cultivar diversity may be a viable integrated pest management tool that warrants further investigation.

Larvae of the endemic dynastine scarabs Pericoptus truncatus and P. punctatus (Coleoptera: Scarabaeidae) occur in coastal sand dunes. Life cycles from egg to egg-laying adults were determined by rearing for the first time. They were 3–5 years (mean ± SD = 3.41 ± 0.53 years, n = 172) and 2–4 years (2.90 ± 0.45 years, n = 53) for P. truncatus and P. punctatus, respectively. The modal life cycle length was three years for both species. In the first year of development, survival of P. truncatus and P. punctatus was superior when larvae were provided with driftwood than with grass (Spinifex sericeus or Stenotaphrum secundatum). Head-capsule width could be used to reliably differentiate between instars of P. punctatus and P. truncatus except for second instar P. truncatus and third instar P. punctatus. These data may inform planning to protect sand scarabs and associated fauna of coastal sand dunes.

Made available in DSpace on 2022-05-01T08:44:44Z (GMT). No. of bitstreams: 0 Previous issue date: 2021-01-01 Successive mowing are the major maintenance costs of lawns. Thus, both the expenditure with mowing and the visual and physiological aspect of the lawn have led to the search for alternatives to mechanical management. Thus, this work aimed to study the effects of different rates of imazapic herbicide applied alone or combined with imazapyr as a growth regulator of Bahiagrass (Paspalum notatum) and St. Augustine grass (Stenotaphrum secundatum). The experimental design was a randomized block with four replicates, and the treatments consisted of six rates of imazapic herbicide (35; 70; 105; 140; 175 and 210 g a.i. ha-1) for both species, three rates of imazapic + imazapyr in tank mix (15.57 + 5.25; 23.625 + 7.875; 32.5 + 10.5 g a.i. ha-1) for Bahiagrass and four rates of imazapic + imazapyr mixture (7.875 + 2.625; 15.57 + 5.25; 23.625 + 7.875; 32.5 + 10.5 g a.i. ha-1) for St. Augustine grass. The effect of the treatments was evaluated by observing visible injury symptoms, canopy height, height and number of inflorescences and total dry matter of clippings. Applications of imazapic alone or combined with imazapyr were effective in reducing plant height, number and height of inflorescences and total amount of dry matter of clippings produced by Bahiagrass plants. Imazapic provided satisfactory control of St. Augustine growth, but its utilization caused an increase in the number of inflorescences present in the lawns. São Paulo State University Department of Agronomy State University of Mato Grosso Department of Plant Science São Paulo State University São Paulo State University Department of Plant Science São Paulo State University

This study presents the first report of sugarcane mosaic virus (SCMV) infecting Stenotaphrum secundatum (buffalo grass) in Australia, from a turf farm in the Hunter Valley, New South Wales. The plant displayed mosaic symptoms and contained flexuous, filamentous virions of 700–750 × 10–11 nm typical of members of the genus Potyvirus. Infection of the sample by SCMV was confirmed by double antibody sandwich ELISA and RT-PCR amplification of the coat protein coding region of the viral genome. In a phylogenetic analysis, the buffalo grass isolate was sister to a clade of maize-infecting isolates of SCMV from eastern Africa and was 75.8% and 79.4% identical to the exemplar isolate of SCMV at nucleotide and amino acid levels, respectively.

Orthosiphon stamineus (Java tea) is a perennial herbaceous plant in the family Lamiaceae and is cultivated extensively in Southeast Asia for its medicinal value (Arifullah et al. 2014). During October 2018, leaf blight symptoms were observed on leaves of ~210 plants O. stamineus grown in experimental plots of a research farm at Faculty of Engineering, Serdang, Selangor, Malaysia (3°00'30.4"N 101°43'19.9"E) with 80% disease incidence. Initial symptoms were brown-to-black lesions on the leaves that enlarged and coalesced until the leaf withered and abscissed. Diseased tissues (4 × 4 mm) of six infected leaves were excised, surface disinfected with 0.5% NaOCl for 1 min, rinsed twice with sterile distilled water, placed onto potato dextrose agar (PDA) plates, and incubated at 25°C with a 12-h photoperiod under fluorescent light for 7 days. A total of six single-spore isolates were obtained from sampled leaves. All isolates exhibited similar morphology and two representative isolates, MK and MK1, were characterized further. Colonies on PDA were initially white then turned dark gray with age and had a pale green underside. Hyphae were branched, septate and hyaline to pale brown. The conidia were one-celled, black, smooth-walled, spherical to subspherical in shape measuring 11.0 μm × 16.5 μm in diameter (n=30) and which are borne on hyaline vesicles at the tip of each conidiophore or formed directly from the mycelia. Based on morphological characteristics, the fungal isolates were identified as Nigrospora osmanthi (Wang et al. 2017). Total genomic DNA of the isolates was extracted from fresh mycelium using DNeasy Plant Mini kit (Qiagen, USA) and the internal transcribed spacer (ITS), translation elongation factor 1-alpha (TEF1) and Beta-tubulin (TUB2) gene regions were amplified using ITS5/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone and Kohn 1999) and Bt-2a/Bt-2b primer set (Glass and Donaldson 1995), respectively. BLASTn analysis showed that the ITS, TEF1 and TUB sequences of the isolates shared 99%-100% identity with Nigrospora osmanthi ex-type strain CGMCC 3.18126 (GenBank accession nos. KX986010, KY019421, KY019461). The sequences of two representative isolates (MK and MK1) were deposited in GenBank (ITS: accession nos. MT645782, MW363019; TEF1: MW366861, MW366862; TUB: MW366863, MW366864). Phylogenetic analysis by the maximum likelihood method based on the concatenated ITS-TEF1-TUB sequences showed that the isolates in this study were clustered in a strongly supported group 98% maximum likelihood with type strain N. osmanthi (Kumar et al. 2016). The pathogenicity of all isolates was confirmed by inoculation on ten healthy leaves of five potted 4-week-old O. stamineus plants using a conidial suspension (1 x 106 spores/ml) produced on 7-days-old PDA cultures. An equal number of plants were sprayed with sterile distilled water only to serve as a control and the treated plants were kept in a growth chamber for 2 weeks at 28 ± 1°C and 95% relative humidity. The experiment was repeated twice. The inoculated leaves developed brown lesions which enlarged into blight symptoms similar to those observed on naturally infected leaves after 5 days of inoculation, while control plants remained healthy. Nigrospora osmanthi was successfully re-isolated from the infected leaves, but not from leaves of non-inoculated control plants, thus satisfying Koch's postulates. . N. osmanthi has been recently reported to cause leaf blight on Ficus pandurata (Liu et al. 2019) and Stenotaphrum secundatum in China (Mei et al. 2019). This disease can cause a significant threat to the cultivation of O. stamineus which has been extensively grown for the production of herbal Java tea. Accurate identification of this pathogen could assist in developing an effective disease management strategy to control this disease.

Soil nitrification (microbial oxidation of ammonium to nitrate) can lead to nitrogen leaching and environmental pollution. A number of plant species are able to suppress soil nitrifiers by exuding inhibitors from roots, a process called biological nitrification inhibition (BNI). However, the BNI activity of perennial grasses in the nutrient-poor soils of Australia and the effects of BNI activity on nitrifying microbes in the rhizosphere microbiome have not been well studied. Here we evaluated the BNI capacity of bermudagrass (Cynodon dactylon L.), St. Augustinegrass (Stenotaphrum secundatum (Walt.) Kuntze), saltwater couch (Sporobolus virginicus), seashore paspalum (Paspalum vaginatum Swartz.), and kikuyu grass (Pennisetum clandestinum) compared with the known positive control, koronivia grass (Brachiaria humidicola). The microbial communities were analysed by sequencing 16S rRNA genes. St. Augustinegrass and bermudagrass showed high BNI activity, about 80 to 90% of koronivia grass. All the three grasses with stronger BNI capacities suppressed the populations of Nitrospira in the rhizosphere, a bacteria genus with a nitrite-oxidizing function, but not all of the potential ammonia-oxidizing archaea. The rhizosphere of saltwater couch and seashore paspalum exerted a weak recruitment effect on the soil microbiome. Our results demonstrate that BNI activity of perennial grasses played a vital role in modulating nitrification-associated microbial populations.

Gray leaf spot (GLS), caused by Magnaporthe grisea, is a major fungal disease of St. Augustinegrass (Stenotaphrum secundatum), causing widespread blighting of the foliage under warm, humid conditions. To identify quantitative trait loci (QTL) controlling GLS resistance, an F1 mapping population consisting of 153 hybrids was developed from crosses between cultivar Raleigh (susceptible parent) and plant introduction PI 410353 (resistant parent). Single-nucleotide polymorphism (SNP) markers generated from genotyping-by-sequencing constituted nine linkage groups for each parental linkage map. The Raleigh map consisted of 2,257 SNP markers and spanned 916.63 centimorgans (cM), while the PI 410353 map comprised 511 SNP markers and covered 804.27 cM. GLS resistance was evaluated under controlled environmental conditions with measurements of final disease incidence and lesion length. Additionally, two derived traits, area under the disease progress curve and area under the lesion expansion curve, were calculated for QTL analysis. Twenty QTL were identified as being associated with these GLS resistance traits, which explained 7.6 to 37.2% of the total phenotypic variation. Three potential GLS QTL “hotspots” were identified on two linkage groups: P2 (106.26 to 110.36 cM and 113.15 to 116.67 cM) and P5 (17.74 to 19.28 cM). The two major effect QTL glsp2.3 and glsp5.2 together reduced 20.2% of disease incidence in this study. Sequence analysis showed that two candidate genes encoding β-1,3-glucanases were found in the intervals of two QTL, which might function in GLS resistance response. These QTL and linked markers can be potentially used to assist the transfer of GLS resistance genes to elite St. Augustinegrass breeding lines.

The obstacle in planting and developing forage plants is limited land. One solution to anticipate this is to utilize land in plantations by introducing forage shade-tolerant among the main crops. The area of oil palm plantations in Indonesia reaches 14,677,560 ha potentially used in the integration system. This article outlines the superiority of Stenotaphrum secundatum from the selection results so that the reader gets comprehensive information about this grass, both in terms of production, nutritional quality and digestibility. Stenotaphrum secundatum selection’s variety grass is a forage shade tolerant that had derived by positive mass selection method which had had been tried it’s adaptability at two different elevation in North Sumatra. This grass is very suitable to be integrated in plantation land. The average fresh yield of S. secundatum at 55 and 75% shading level reached 2,386 and 2,001 g/m2/harvest, respectively. The digestibility of Steno grass selection’s result on growing Boerka goat shows a fairly good value, which ranges from 60.7% to 72.8%. Palatability of S. secundatum grass in goats is very good with consumption reaching 3.6% of body weight. S. secundatum grass, besides being tolerant of shade, is also resistant to pests, as long as it is maintained with good management. The crossing of polyploid Steno grass with diploid has produced drought tolerant varieties. This grass also has advantages in terms of dry matter production, nutrient content and crude protein production compared to other grass species and can be planted in wider plantation areas with 55-75% shade.

The genome sequence of a new subgroup C nepovirus from Stenotaphrum secundatum in Australia is described. This virus, tentatively named Stenotaphrum nepovirus (SteNV), was present in separate plants as a mixed infection with either sugarcane mosaic virus or Panicum mosaic virus. The virus genome was divided between two RNA segments, 7,824 and 7,104 nucleotides (nt) in length, which each encode a single long polyprotein with putative 3C-like cysteine protease sites of the type H/G, H/S or L/S. The 3' untranslated region of RNA2, at 2,155 nt, is the longest observed for any subgroup C nepovirus. Phylogenetic analyses using protease-polymerase and coat protein amino acid alignments suggest that SteNV is most closely related to cherry leaf roll virus. Using a newly developed RT-PCR assay, this virus was detected at multiple localities in New South Wales, Queensland and Western Australia, and in a second host species, Digitaria didactyla. No consistent association between virus infection and symptoms could be established. The economic importance, pathogenicity and transmission of this novel virus species warrant further investigation.

Irrigation of residential and commercial lawns in excess of plant water requirements can result in waste of potable water supply and negative public perception regarding turf landscapes. A 3-year field study was conducted to evaluate simple historical ETo-based irrigation scheduling for maintenance of St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze ‘Raleigh’] lawns in College Station, TX, USA. Whole main plots were assigned crop coefficients of 1.00, 0.60, 0.36, or 0.24 (K100, K60, K36, and K24) used to adjust historical ETo (47-year average). Sub-plots received N rates of either 0.0, 0.4, or 0.8 kg ha−1 month−1 during the experimental period each year. Irrigation treatments were applied 3 days per week from July through September each year. Acceptable turf quality was maintained when irrigation depths were ≥47% of actual ETo. The K60 treatment provided adequate irrigation for turf performance but caused 31% overwatering in the wettest year. The K36 treatment resulted in acceptable turf quality not only in the wettest year, but also showed complete recovery of the turf sward by the end of fall in each year. This research has outlined a simple and effective method for conserving water used to irrigate St. Augustinegrass lawns.

Shade affects turf quality by reducing light for photosynthesis. The shade tolerance of the tropical grasses, Digitaria longiflora and Axonopus compressus were evaluated against Stenotaphrum secundatum (St. Augustinegrass). The grasses were established under shade structures that provide 0%, 50%, 75% or 90% shade level for 30 days. A suite of leaf traits, recorded from similar leaf developmental stage, displayed distinct responses to shade conditions. Leaf length, relative to control, increased in all three species as shade level increased. The mean leaf extension rate was lowest in St. Augustinegrass (80.42%) followed by A. compressus (84.62%) and D. longiflora (90.78%). The higher leaf extension rate in D. longiflora implied its poor shade tolerance. Specific leaf area (SLA) increased in all species with highest mean SLA increase in D. longiflora (348.55 cm2 mg−1) followed by A. compressus (286.88 cm2 mg−1) and St. Augustinegrass (276.28 cm2 mg−1). The highest SLA increase in D. longiflora suggested its lowest performance under shade. The percent green cover, as estimated by digital image analysis, was lowest in D. longiflora (53%) under 90% shade level compared to both species. The relative shade tolerance of the three turfgrasses could be ranked as St. Augustinegrass > A. compressus > D. longiflora.

The potential growth of buffalo grass (Stenotaphrum secundatum) and couch grass (Cynodon dactylon) on artificial floating islands (AFIs) and their ability to remove total nitrogen (TN) and total phosphorus (TP) from a simulated paper mill wastewater was studied. This was done to assess the potential of AFIs for removal of nutrients from aerated stabilization basins (ASBs) that had occasional growth of blue-green algae (BGA) to bloom levels. Small scale AFIs were prepared using polyethylene foam and planted with the grasses in 30 L of tested water. Trials were conducted in a plastic covered greenhouse over a three-month period where temperatures ranged from 15 to 44 °C. The results showed that both buffalo and couch grasses can adapt to planting in AFIs showing increases of 125% and 148% in wet weight, respectively. Nutrient uptake by buffalo grass and couch grass were found to be similar. Percentage uptakes of TP and TN from the synthetic water by the buffalo grass were 82% and 47%, whereas by couch grass, uptakes were 83% and 45%, respectively.

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

The study was done in order to determine the effect of Arbuscular mycorrhizal fungi (AMF) addition in the soil on plant height, fresh weight, dry matter yield and botanical composition of mixed plants of A. pintoi legume and Stenotaphrum secundatum grass within coconut trees. Completely Randomized Design (CRD) was used in this experiment, with 4 treatments as follows: T0 = 0 gr AMF, T1 = 5 gr AMF, T2 =10 gr AMF and T3 = 15 gr AMF, 5 replications each treatment. So, there were 20 of experimental units. Measurements were taken after 30 days of planting. The level of AMF showed a significantly effects (PA. pintoi and S. secundatum. In short, the highest plant height, fresh weight and dry matter yield as well as the more proportional of botanical composition of A. pintoi and S. secundatum were found in the soil with application of 15 gr AMF.

• Understanding the differences between C3 and C4 turfgrasses to shade are crucial for turfgrass maintenance and future shade tolerance breeding. The objectives of this study were to compare and analyze shade tolerance mechanism of both C3 and C4 turfgrasses in turf performance, growth, tissues and physiological aspects. Species Poa supina ‘SupraNova’ (C3 grass), and Stenotaphrum secundatum ‘S5′ (C4 grass) were subjected to a gradient of shading levels of 34.7 %, 69.8 %, 92.3 % and the control group CK (un - shaded). Visual turf quality (TQ) and turf color intensity (TCI) exhibited lower in S5compared to SupraNova on most testing days. S5 tended to have greater total biomass (TB), above- and below-ground biomass (AGB, BGB) under the 34.7 % shading level in contrast to SupraNova, whereas the ratio of above- to below-ground biomass (RAB) was higher in SupraNova. The average daily growth rate (ADGR) of both turfgrasses increased first, then declined during the shade periods, however, SupraNova under shading levels of 69.8 % and 92.3 % grew poorly than S5. The lowest ratio of Chlorophyll a/b showed under 34.7 % shade but the decreases of the ratio were different with S5 decreased by 40.5 % and SuperNova decreased by only 2.2 % compared to controls. Light shading (34.7 %) caused the qP, ETR and Fv/Fm increased greatly for both species, while severe shading induced higher qP, ETR and Fv/Fm in S5 than in SupraNova. Severe shading also caused more severe alterations in the leaf anatomical structure of SupraNova compared to S5. Our results indicated that 34.7 % shading is more favorable for the normal growth of two species. The promoted biomass and TQ of S5 may due to higher photochemical efficiency and unique leaf Kranz structure under severe shading.

The erosion of drains is a major limitation of the quality, the increasing of banana production and the environmental protection of industrial banana in Cote d'Ivoire. It leads inundations, death of banana trees and significant loss of production. Thence, the construction and the maintenance of drain costs too much and causes injure, snake bite, physical traumatisms, many diseases, … These events compromise the sustainable production of banana by reducing seriously worker’s the activities and finally increase the cost of production. The aim of the present work is to contribute to the sustainable development and human capacity building in the third world nations as far as banana production is concerned. The methods used so far to address this phenomenon proved inefficient. The technology innovation in this area has been to grow grass on the outer edges of the channels drained water. This resulted in a systematic reduction of erosion. Better still, it helped fertilize the soil, reduce the deportations of fertilizer and improve the quality of landscape of the plantations. Stenotaphrum secondatum is the best vegetable specie adapted to the biological control against water erosion of drains.

Developing turfgrass with good drought resistant is a major goal in breeding programs when water scarcity is one of the long-term challenges facing the turfgrass industry. It has been shown that plant transpiration does not decline until available soil water drops below a certain threshold. Studying the species and genotypic differences in this threshold may lead to turfgrass that conserve water and retain turfgrass quality during drought. The objective of this study was to characterize and compare the transpiration response of 19 warm-season turfgrass genotypes and cultivars in five species during soil drying and well-watered conditions in the greenhouse. The species included in the study were: Zoysia japonica (Steud), Zoysia matrella L., common bermudagrass (Cynodon dactylon L. Pers. var. dactylon), African bermudagrass (Cynodon transvaalensis Burtt-Davy), hybrid bermudagrass (C. dactylon L. var. dactylon × C. translvaalensis Burtt-Davy) and St. Augustinegrass [Stenotaphrum secundatum (Walter) Kuntze]. They were evaluated for evapotranspiration rate (ET) and the sensitivity of transpiration to soil drying which was indicated by a break point of the fraction transpirable soil water (FTSW). The range of break point during dry down was from 0.25 to 0.41, and genotypes within species had different ET when well-watered (ETck). Break point values were not correlated with the number of days to the endpoint, where ET declined below 10% of the control. Instead, the number of days to endpoint was negatively correlated with ETck (−0.59, P ≤ 0.01). Thus, these results found significant variability in turfgrass break point and ETck that could contribute to water conservation, and a better understanding of drought responses in warm season turfgrasses.

The role of turfgrasses in C and N cycling in the southeastern U.S. has not been well documented. The objectives of this research were to determine the characterization of chemical quality, clipping decomposition rates, and C and N release from warm- and cool-season turfgrasses. The study was conducted for 46 weeks in 2012 in Auburn, AL. Four warm season turfgrasses were used included (bermudagrass [Cynodon dactylon (L.) Pers. × C. transvaalensis Burtt Davy], centipedegrass (Eremochloa ophiuroides (Munro) Hack), St. Augustinegrass (Stenotaphrum secundatum (Walter) Kuntze), zoysiagrass (Zoysia japonica Steud.), and one cool season turfgrass (tall fescue (Festuca arundinacea Schreb)). Litter was placed into nylon bags at an oven dry rate of 3.6 Mg?ha?1. Litter bags were retrieved after 0, 1, 2, 4, 8, 16, 24, 32, and 46 weeks, and analyzed for total C and N. A double exponential decay model was used to describe mass, C, and N loss. Results indicated that tall fescue decomposition occurred rapidly compared to warm season turfgrasses. Litter mass loss measured after 46 weeks was determined to be 61.7%, 73.7%, 72.2%, 86.8%, and 45.4% in bermudagrass, centipedegrass, St. Augustinegrass, tall fescue, and zoysiagrass respectively. Zoysiagrass litter had a higher lignin concentration, while tall fescue had the lowest lignin. Over 46 weeks’ release of C was in the order: zoysiagrass > bermudagrass = centipedegrass = St. Augustinegrass > tall fescue, and release of N was in the order zoysiagrass > centipedegrass > bermudagrass = St. Augustinegrass > tall fescue. Our study concluded that, zosiagrass is a better choice for home lawns.

As population growth and demands for potable water increase, use of low-quality or effluent sources of irrigation is becoming more prevalent. Because these water sources often contain elevated levels of dissolved salts, turfgrasses must increasingly possess mechanisms for coping with salinity stress. The objectives of this research were to utilize Scanning Electron Microscopy (SEM) combined with Energy Dispersive X-ray Spectroscopy (EDS) to explore and characterize anatomical and physiological responses of four salinity-tolerant cultivars/experimental lines of warm-season turfgrass species including bermudagrass (Cynodon ssp.), zoysiagrass (Zoysia ssp.), St. Augustinegrass (Stenotaphrum secundatum), and seashore paspalum (Paspalum vaginatum) to salinity stress. Grasses were grown in the greenhouse under two levels of salinity stress (control = 2.5 and 30 dS m−1) prior to examination of adaxial and cross-sectional leaf surfaces using SEM and EDS. St. Augustinegrass leaf anatomy did not differ between control and elevated salinity. In bermudagrass, salt glands were observed at the 30 dS m−1 salinity level, however, none were detected at the 2.5 dS m−1 level. Zoysiagrass appeared to possess constitutive salt gland development, which although were present under 2.5 dS m−1 salinity, noticeably increased in density with increasing salinity. Seashore paspalum did not possess salt glands, but rather, exhibited bladder-like structures, in which EDS detected high levels of Na following salinity stress. These findings highlight differences in anatomical responses to salinity stress among warm-season turfgrass species. The information may aid breeders and physiologists in developing a more comprehensive understanding of warm-season turfgrass anatomical responses to salinity stress.

St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] is a warm-season turfgrass commonly grown in the southern USA. In this study, the first linkage map for all nine haploid chromosomes of the species was constructed for cultivar ‘Raleigh’ and cultivar ‘Seville’ using a pseudo-F2 mapping strategy. A total of 160 simple sequence repeat markers were mapped to nine linkage groups (LGs) covering a total distance of 1176.24 cM. To demonstrate the usefulness of the map, quantitative trait loci (QTL) were mapped controlling field winter survival, laboratory-based freeze tolerance, and turf quality traits. Multiple genomic regions associated with these traits were identified. Moreover, overlapping QTL were found for winterkill and spring green up on LG 3 (99.21 cM); turf quality, turf density, and leaf texture on LG 3 (68.57–69.50 cM); and surviving green tissue and regrowth on LGs 1 (38.31 cM), 3 (77.70 cM), 6 (49.51 cM), and 9 (34.20 cM). Additional regions, where QTL identified in both field and laboratory-based/controlled environment freeze testing co-located, provided strong support that these regions are good candidates for true gene locations. These results present the first complete linkage map produced for St. Augustinegrass, providing a template for further genetic mapping. Additionally, markers linked to the QTL identified may be useful to breeders for transferring these traits into new breeding lines and cultivars.