Search

El conocimiento sobre los Sphaerodoridae (Annelida, Polychaeta) es todavia insuficiente en muchas partes del planeta, incluyendo los fondos del sistema marino profundo de la peninsula Iberica. El estudio de las muestras recogidas entre 100 y 2000 m de profundidad durante varias campanas oceanograficas en el Margen Continental de Galicia (NW peninsula Iberica) entre 2003 y 2009 ha mostrado la presencia de seis especies de poliquetos pertenecientes a la familia Sphaerodoridae. Dos de estas especies son mencionadas por primera vez desde su descripcion original: Sphaerodoropsis sibuetae Desbruyeres, 1980 y S. amoureuxi Aguirrezabalaga & Ceberio, 2005; estos registros extienden la distribucion conocida de ambas especies hacia el Oeste en el Oceano Atlantico. Asimismo, se mencionan todas las especies encontradas aportando datos sobre su distribucion y ecologia, y se incluye una clave con todas las especies conocidas de la peninsula Iberica.

A new species of Sphaerodoridae (Annelida: Polychaeta),Sphaerodoropsis solissp. nov., is described from the Challenger Plateau in the Tasman Sea, south-west Pacific. It is the third species of the genus with ventral macrotubercles and is further characterized by the lack of dorsal papillae and the specific arrangement pattern of ventral papillae. A character indicating sexual dimorphism, that has been observed in three morphologically similar species,S. arctowskyensisHartmann-Schröder & Rosenfeldt, 1988,S. bisphaeroserialis(Hartmann-Schröder, 1974c), andS. garciaalvareziMoreira, Cacabelos & Troncoso, 2004, is confirmed forS. solissp. nov. BesidesS. solissp. nov.,S. arctowskyensisandS. parva(Ehlers, 1913) are newly recorded from the Challenger Plateau and the East Campbell Plateau in the south-west Pacific. An updated key for the genusSphaerodoropsisis provided.

Sphaerodoropsis megatuberculata n. sp. Fig. 4 Q–R, 5 K, 13 Sphaerodoropsis sp. MoV 632 Wilson & Bakken 2003 (in part). Material examined. Holotype: NMV F. 69689, 15.5 km SW of Pt Ricardo, Eastern Bass Strait, 37 ° 53 ' 08'' S, 148 ° 28 ' 56 '' E, 45 m, Feb 1991, medium sand. Paratypes: NMV F. 69687 (1 spec. for SEM), 15.5 km SW of Pt Ricardo, Eastern Bass Strait, 37 ° 53 ' 08'' S, 148 ° 28 ' 56 '' E, 45 m, Feb 1991, medium sand; NMV F. 69688 (1 spec.), 15.5 km SW of Pt Ricardo, Eastern Bass Strait, 37 ° 53 ' 08'' S, 148 ° 28 ' 56 '' E, 45 m, 4 Jun 1991, medium sand; NMV F. 69686 (1 spec. for SEM), 15.5 km SW of Pt Ricardo, Eastern Bass Strait, 37 ° 53 ' 08'' S, 148 ° 28 ' 56 '' E, 45 m, 4 Jun 1991, medium sand; NMV F. 63844 (1 spec.), 15.5 km SW of Pt Ricardo, Eastern Bass Strait, 37 ° 53 ' 10 '' S, 148 ° 28 ' 57 '' E, 45 m, 26 Sep 1990, sand-shell; NMV F. 132659 (1 spec.), 14 km SW of Marlo, Eastern Bass Strait, 37 ° 54 ' 00'' S, 148 ° 25 ' 07'' E, 26 m, 12 Aug 1989, sand-shell; NMV F. 63845 (1 spec.), 3.2 km S of Cape Conran, Eastern Bass Strait, 37 ° 50 ' 37 '' S, 148 ° 43 ' 28 '' E, 49 m, 28 Sep 1990, sand-shell; NMV F. 132902 (1 spec.), 43 km SE of Port Albert, Bass Strait, 38 ° 53 ' 42 '' S, 147 ° 06' 30 '' E, 58 m, 18 Nov 1981. Diagnosis. Ellipsoid body with 17 longitudinal rows of large ellipsoid to cylindrical macrotubercles in two transversal rows per segment, with eight macrotubercles between parapodia and nine in posterior transversal row. Dorsum with additional spherical papillae in 2–3 transversal rows per segment; ventrum with spherical papillae in four longitudinal rows. Two parapodial papillae, one on each of anterior and posterior surfaces. Parapodia with 5–6 chaetae per fascicle, blades 2–3 times as long as wide. Females with an oval tubercle between chaetigers 5–6, males with modified ventral cirrus in chaetigers 4–7. Description. Measurements and general morphology. Holotype female with ellipsoid body measuring 2.5 mm long and 0.5 mm wide, for 20 chaetigers, convex dorsum and flattened ventrum (Fig. 13 A). Segmentation unremarkable, tegument with transverse wrinkles (Fig. 13 C–E). Preserved specimen lacking pigmentation. Head. Anterior end bluntly rounded. Prostomium with short appendages, including a pair of digitiform blunt lateral antennae, a pair of palps similar in shape and length to lateral antennae, median antenna half the length than lateral antennae (Fig. 13 B). Tentacular cirri similar to median antenna. Antenniform papillae not observed. A few scattered spherical papillae on the head, in different sizes (Fig. 13 B). Tubercles. First chaetiger with two dorsal macrotubercles, sessile large, ellipsoid to cylindrical. Number increases towards chaetiger 5. Following chaetigers with 17 longitudinal rows of macrotubercles, arranged in double transverse rows on each segment in a zig-zag pattern (Figs 4 Q, 13 A–B, E), with eight macrotubercles in rows between parapodia and nine in posterior transverse rows. Macrotubercles ellipsoidal to cylindrical of different sizes (Fig. 13 B, D–F), with pores mainly over the distal surface (Fig. 13 H). Dorsum with additional small spherical papillae arranged in 2–3 transverse rows per segment, with 6–8 papillae per row (Figs 4 Q, 13 D–E). Ventral surface with spherical papillae in 4–6 (zig-zag) longitudinal rows, two rows close to parapodia and 2–4 rows in mid-body, arranged in more or less two segmental and one intersegmental transverse row, where the mid-body longitudinal rows are skewed in position compared to outer lines giving a zig-zag pattern (Figs 4 R, 13 C). Body epithelium with microscopic rounded granules (Fig. 13 G). Parapodia. Parapodia sub-conical, about 1–2 times longer than wide. Digitiform acicular lobe projecting anterior to chaetae, projecting beyond ventral cirri, ventral cirri slender digitiform. Two parapodial papillae, one close to base on anterior surface and one on posterior surface (Figs 5 K, 13 C–F). Chaetae. Compound chaetae present in all chaetigers, arranged in a curved transverse row posterior to acicular lobe, numbering 5–7 per fascicle (Figs 5 K, 13 D–F). Shaft with slender distal end and strong spinulation on edge (Fig. 13 I–K). Blades mostly similar in length within each fascicle and along chaetigers (2–3 times longer than maximum width), with recurved distal end and conspicuous spinulation along the proximal 3 / 4 th length of blade (Fig. 13 I–K). Some blades observed with fine distal spines on the edge opposite to serration (Fig. 13 J). Pygidium. Pygidium sub-terminal, with a mid-ventral digitiform anal cirrus (Fig. 13 C). Internal features. Eyes present in holotype, as dark brown to black spots positioned deep in integument in chaetigers 1–2. Muscular pharynx not observed. Reproductive features. Holotype and one paratype female with ‘copulatory organs’ as oval tubercle between chaetigers 5 and 6. Males with modified ventral cirri swollen at the base, with a distal knob and surface with pores in chaetigers 4–7 (Fig. 13 F). Eggs not observed. Variation. Specimens measuring 1.5–4.5 mm long and 0.3–0.6 mm wide, for 18–23 chaetigers. Prostomial appendages barely visible in contracted specimens, in specimens relaxed appendages clearly visible and longer than shown in SEM (Fig. 13 B), shape and relative length of appendages as described for holotype. Macrotubercles similar in shape in all specimens examined but in some individuals they are relatively larger than those described for holotype and observed under SEM (Fig. 13 D–F). Number of macrotubercles in examined specimens agree with holotype; being six on second chaetiger, remaining chaetigers with eight between parapodia and nine in rows posterior to "parapodial row", per segment; last chaetiger with four macrotubercles. Parapodial papilla on anterior surface of parapodia difficult to observe in stereo microscope at its position at the base of parapodia, it gives an appearance of this papilla sit on body surface in contracted specimens. Remarks. A distinct and unique feature of Sphaerodoropsis megatuberculata n. sp. is the large ellipsoid to cylindrical macrotubercles, not described in any other Sphaerodoropsis species. This species belongs in Sphaerodoropsis Group 3 (sensu Borowski 1994), and resembles S. solis, but the latter has ventral ‘macrotubercles’ which are absent in S. megatuberculata n. sp., and has double transverse rows of six and seven macrotubercles per segment, while S. megatuberculata n. sp. has eight and nine. The new species also resembles S. bisphaeroserialis, S. garciaalvarezi and S. arctowskyensis in arrangement of macrotubercles and dorsal and ventral papillae (Moreira et al. 2004). With its 8 + 9 macrotubercles in double transverse rows per segment S. megatuberculata n. sp. has higher number of macrotubercles than the group of three closely related species which all have 6 + 7. Further, there are differences in number and distribution of dorsal and ventral papillae between the species (Moreira et al. 2004). Moreira et al. (2004) use "microtubercles" for dorsal and "papillae" for ventral papillae, for what is termed "papillae" here. Sphaerodoropsis megatuberculata n. sp., S. bisphaeroserialis, S. garciaalvarezi and S. arctowskyensis, seem to be a group of species with close affinities (Moreira et al. 2004). The group also shares an austral distribution where respective species have been found in southern Australia, Sub-Antarctic and Antarctic environments. Sexual dimorphism is observed in this species. A structure believed to be genital opening in female specimens has been observed as a disc-like tubercle immediately ventral to parapodia between chaetigers 5 and 6, being similar to what has been observed in other Sphaerodoropsis species (Moreira et al. 2004; Reuscher & Fiege 2011). In male specimens ‘copulatory organs’ appear as modified ventral cirri in chaetigers 4–7. Etymology. The species is named after its characteristic enlarged and uniquely looking macrotubercles. Type locality. 15.5 km SW of Pt Ricardo, Eastern Bass Strait (Fig. 15). Distribution Bass Strait (Fig. 15). Habitat. Sand, 26–58 m depth.

Sphaerodoropsis aurantica n. sp. (Figs 2 C, D, 3) Sphaerodoropsis sp A.— Helm & Capa, 2015. Type material. Holotype: AM W. 44209, MI QLD 2380, on SEM stub. Paratype: AM W. 44210, MI QLD 2380, posterior end used for DNA sequencing. Other material examined. AM W. 44218, MI QLD 2390, live photo, further used for confocal microscopy, Helm & Capa 2015; AM W. 44220, MI QLD 2387, used for confocal microscopy, Helm & Capa 2015. Diagnosis. Body ellipsoid, with strongly convex dorsum. Nine longitudinal rows of sessile and spherical dorsal macrotubercles, arranged in a single transverse row per segment row and four transverse rows (with up to 38) of spherical papillae per segment. Parapodia with digitiform acicular lobe, shorter ventral cirrus and around 10 spherical papillae. Over 10 compound chaetae per parapodium with thin shafts, long blades (6–8 times longer than its maximum width), with fine and short spinulation along superior edge and a distal recurved tip. Description. Holotype 1.8 mm long after fixation, 0.6 mm maximum width; with 20 chaetigers. Body ellipsoid (Fig. 3 A–B); with convex dorsum and flattened ventrum. Tegument with transverse wrinkles, segmentation inconspicuous (Fig. 3 A–B). Head externally indistinct (Fig. 3 A–C). Anterior end bluntly rounded (Fig. 3 B–C). Prostomium with five appendages, including a pair of palps, in ventral most position, sub-conical and slightly wrinkled; a pair of lateral antennae, similar in shape and size to palps; and a median antenna, shorter (two thirds) and wider than lateral antennae and with a rounded distal end (Fig. 3 B–C). Antenniform papillae cannot be unequivocally recognised (Fig. 3 C). Around 30 digitiform small papillae confined by prostomial appendages and mouth in frontal view (Fig. 3 C). A pair of tentacular cirri, similar in shape and size to lateral antennae and palps, and several scattered papillae similar to prostomial. Macrotubercles, sessile, rounded or provided with an incipient rounded terminal papillae (Fig. 3 B, G–H), arranged in longitudinal rows along dorsum, and single transversal rows per segment. First and following chaetigers with nine macrotubercles, decreasing to eight in posterior chaetigers. Macrotubercles with two different sizes, following pattern in Fig. 2 C; provided with pores arranged on groups (Fig. 3 G–H), some of them with incipient terminal papillae or at least pear-shaped (Fig. 3 H). Spherical papillae over dorsum, arranged in four transverse rows per segment; digitiform in anterior-most chaetigers and spherical in following (Fig. 3 C–D). Ventral surface with similar spherical papillae, arranged in about 5–6 irregular transverse rows, with a total of around 50 papillae per segment, in mid-body (Fig. 3 B). Parapodia sub-conical, increasing in size towards chaetiger 5 and around 1–2 times longer than wide, wrinkled (Fig. 3 C–D). Acicular lobe anterior to chaetal fascicle, projecting distally (Fig. 3 D–E, J). Ventral cirri sub-conical to pear-shaped, shorter than acicular lobe (Fig. 3 D–E, J). Mid-body parapodia with around 10 small spherical papillae, slightly different in size: one or two on dorsal surface, three on anterior surface, three on ventral surface and three on posterior surface (Fig. 2 D). Compound chaetae present in all chaetigers, arranged in a curved transverse fascicle around acicular lobe and numbering 10–22 per parapodium. Shaft with similar width all along, slightly widened distal end with delicate almost inconspicuous spinulation. Blades similar in length within fascicles (6–8 times longer than its maximum width), with fine and short spinulation along superior edge and a distal recurved tip (Fig. 3 J–L). Pygidium terminal, with mid-ventral digitiform anal cirrus and a pair of dorsal anal cirri, similar in shape to macrotubercles (Fig. 3 F). Mouth located ventrally near base of palps (Fig. 3 C). Gut visible by transparency with muscular pharynx occupying about four segments. Eyes and copulatory organs or gametes not seen. Colour pattern. Live specimens white, with a bright orange transverse band on dorsum of chaetigers 12–13. Lateral most and dorsal most macrotubercles of all except for anterior and posterior two chaetigers also partially pigmented (Fig. 3 A). Colour lost in preserved material. Variation. Paratype with 21 chaetigers. Number of epithelial tubercles and papillae matches those described in holotype. Parapodia of mid-body chaetigers with higher number of chaeate and papillae, within the range described in holotype. Pigmentation pattern varied slightly among described specimens and the orange band was more or less evident in some specimens, and within chaetigers 10–13 but the dorsolateral macrotubercles, were in all cases partially bright orange. Copulatory organs or gametes not observed in any specimen. COI Barcode (Paratype, AM W. 44210). AAAATCAAAACAAATGTTGAAATAAAATAGGATCTCCTCCTCCTGCCGGATCAAAAAACCTAGTATTT AGATTACGATCAGTTAATAATATAGTAATTACACCTGCCAATACAGGCAAAGCTAATAATAATAAAATAG CTGTAATCAATACAGATCAAGTAAATAAAGGAATACGCTTAAACTTCATACCCACTACATGATCAAATA TAATAGTAACAATAAAATTAATAGCACCTAAAATAGAAGAAACACCAGCTATATGTAATGAAAAAATAG CTATATCAACAGAAGGCCCCGAATGAGTTATATTACTTGATAAAGGAGGATAAACTGTTCATCCTGTAC CAGCACCTTTCTCTACTAATGTAGATCCCAATAATAATATTAAAGAAGGAGGCAAAAATCAAAACCTTA TATTATTTAATCGAGGAAAAGCTATATCAATAGCACCTAACATTAAAGGAACTAATCAATTACCAAAAC CACCCATTATAACTGGTATTACAAGAAAAAAAATTATTAAAAAAGCATGACCAGTAACAATAGTATTAT ATAATTGATCTCTACCTAATAAACTACCTGGTTGACCTAATTCAGCACGAATCAACAAACTTATAGATGT ACCTAAAAATCCAGATCATATACCAAAAATAAAATACAAAGTACCAATATCTT Remarks. Even though some macrotubercles were observed with distal papillae, this is not a constant attribute of all tubercles or present in all specimens of Sphaerodoropsis aurantica n. sp. examined and may be an artefact due to the collapse of some of these structures. Nevertheless, and as indicated previously (Capa et al. 2015; Capa & Bakken 2015), distinguishing Sphaerephesia and Sphaerodoropsis is confusing at present because there are species within each genus presenting pear-shaped macrotubercles that lack terminal papillae. This species would belong within the Group 2 proposed by Borowski (1994), together with other Sphaerodoropsis species with more than four longitudinal rows of macrotubercles arranged in a single transverse row per segment. There are nine other species in the group (Borowski 1994; Aguirrezabalaga & Cebeiro 2005; Moreira & Parapar 2011), considering that S. minuta (Webster & Benedict, 1887) and S. polypapillata Hartmann-Schröder & Rosenfeldt, 1988, have recently been synonymised with other genera (Moreira & Parapar 2011; Capa et al. 2015). Species distinguished from S. aurantica n. sp. due to the lower (S. amoreuxi Aguirrezabalaga & Cebeiro, 2005, S. benguellarum (Day, 1963), S. octopapillata (Hartmann-Schröder, 1965), S. sphaerulifer (Moore, 1909) and S. uzintunensis Kudenov, 1987. Of the remaining species, S. aestuarum Averincev, 1990 is distinguished from S. auranticus n. sp. because it has two transverse rows of additional papillae per segment in addition to the 8–10 macrotubercles and compound chaetae with blades around three times longer than wide; S. balticum (Reimers, 1933) also has two transverse rows of papillae per segment in addition to the 7–9 rows of macrotubercles and short chaetal blades (less than twice as long as wide); S. gudmunduri Moreira & Parapar 2012, lacks dorsal papillae among the nine macrotubercles and has short chaetal blades (around three times longer than wide); and S. katchemakensis Kudenov, 1987 bears two transverse rows of papillae in addition to the 8–9 macrotubercles and chaetae with blades ranging 3–4 times as long as wide (Reimers 1933; Hartmann-Schröder 1996; Kudenov 1987 a; Moreira & Parapar 2012). Sphaerephesia gesae Moreira & Parapar, 2011 is the only species in that genus with more than four longitudinal rows of macrotubercles (Moreira & Parapar 2011; Alalykina 2015). It can be distinguished from S. aurantica n. sp. by the presence of two transverse rows of macrotubercles per segment, instead of only one found in the new species and the chaetal morphology with short blades (maximum twice as long and wide) in comparison to those described in S. aurantica n. sp. Etymology. The species name refers to the bright orange pigmentation (orange in Latin= auranticus) present in mid body tubercles. Distribution. Species only known from type locality.

Sphaerodoropsis plurituberculata n. sp. (Figs 2 E, F, 4, 5, 6) Type material: Holotype: AM W. 47516, Australia, Queensland, Great Barrier Reef, beach near research station, 14 �� 40 ' 43 "S, 145 �� 26 ' 50 "E, intertidal, coarse sand, 5 Nov 2002. Paratypes: AM W. 47517 (1 spec.), AM W. 47518 (1 spec, on SEM stub), SIO-BIC A 3645 (2 males and 2 females, in resin blocks), SIO-BIC A 3647 (2 specs), all same collection information as holotype. Comparative material examined. Holotype of Sphaerodoropsis multipapillata heteropapillata Hartmann- Schr��der, 1987, ZMH P. 18875, Australia, Victoria, Geelong, Point Lonsdale, Abrasion terrace near lighthouse, on coralline algae, 24 Dec 1975. Holotype of Sphaerodoridium multipapillata Hartmann-Schr��der, 1979, ZMH P. 14336, Tanzania, Mtwara, fine sand near coral reef south to the entrance of the harbour, 13 Nov 1967. Diagnosis. Body ellipsoid, with strongly convex dorsum. Over 12 more or less clearly arranged longitudinal rows of spherical, variable in size, and sessile dorsal tubercles, in four transverse row per segment. Parapodia with digitiform acicular lobe similar in shape and size to ventral cirrus, lacking papillae. Around six semi-compound chaetae per parapodium with distally enlarged shaft and short blades (up to twice longer than wide), serrated, with distal long spines; shaft with conspicuous spinulation. Male with enlarged, bottle-shaped and porous copulatory organ present in chaetiger 6 ventral to each parapodia instead of the normal ventral cirri. Females with oval and flat tubercle with a porous surface also ventral to parapodia of chaetiger 6. Description. Male holotype. Body more or less ellipsoid, anterior end bluntly rounded and posterior end tapering (Figs 4 A���D, 5 A���B), measuring 1.5 mm long, 0.5 mm wide, with 18 chaetigers. Strongly convex dorsum and flat ventrum; segmentation inconspicuous (Figs 4 A���D, 5 A���B). Live colour transparent with brown gut, milky white coelom; dark brown after preservation. Bright orange subdermal eyes (Fig. 4 A���D). Tegument with microscopic oblong granules. Head externally indistinct (Fig. 5 A���C). Prostomium with five appendages; a pair of ventral-most palps, digitiform and about three times as long as wide; a pair of lateral antennae similar in shape and size to palp; and a spherical median antenna (Figs 4 A���D, 5 A). Around 10 small and spherical papillae confined by these appendages. A pair of tentacular cirri, shorter than palps and lateral antennae. Body surface covered in tubercles of two different sizes arranged in more or less 16���18 longitudinal rows in mid-body, four rows per segment, adding a total of around 30 in mid-chaetigers (Figs 2 E, 4 A���D, 5 B). Microtubercles absent. Ventrum with papillae similar in shape and size to dorsal, arranged in about 10 longitudinal rows, four transverse rows per segment and a total of about 20 papillae per chaetiger in mid-body (Fig. 5 A). Ventral papillae containing different type of granules (Fig. 4 E). Parapodial sub-conical, increasing in size towards chaetiger 3 and decreasing in last three chaetigers, as long as wide in mid-chaetigers (Fig. 5 A���E, G). Acicular lobe, digitiform, three times longer than wide, similar in shape as size as ventral cirrus (Fig. 5 D���E). Parapodia lacking parapodial papillae; but one spherical papilla located close to anterior base of each parapodia (Figs 2 F, 5 D). Bottle-shaped copulatory organ present in chaetiger 6 ventral to each parapodia, which lack ventral cirri (Figs 4 D, 5 A, 6 A), suggesting these structures are transformed ventral cirri. Usually six chaetae arranged in a more or less curved transverse line behind the acicular lobe (Fig. 5 D���E). Hooks in anterior segments not observed. All chaetae simple (Fig. 5 F), appearing semi-compound in some cases, denoting that shaft and blade have probably fused. Distal end enlarged, three times longer than wide, with spinulation in cutting edge and a conspicuous distal projection (Fig. 5 F), similar along body and within fascicles. Chaetae showing a thin groove running parallel to edge, in distal end. Pygidium terminal, with inconspicuous spherical single anal cirrus (Fig. 5 G). Brown gut seen by transparency, coiled in some parts (Fig. 4 A���D) without a distinct muscular structure. Variation. Paratypes range from 0.6 to 1.5 mm long, and 12���20 segments, showing two different body shapes, more or less elongated, probably due to contraction. The length of the anterior appendages also varies, being contracted in one paratype and resembling prostomial papillae (Fig. 5 B), while in rest of paratypes they are digitiform and conspicuous. Number and size of epithelial tubercles vary slightly along chaetigers but they are constantly arranged in about four dorsal and ventral more or less evident transverse rows per segment. Longitudinal rows range between 13���18, however numbers are often difficult to count due to the different size of tubercles and their zigzag arrangement. Papillae seem absent of parapodia in all specimens, however and as mentioned in the holotype, an anterior ventral papillae can be considered part of the parapodia when these are relaxed and enlarged. Chaetae often broken but those that are intact are as those described in holotype, simple with spinulation along cutting edge and a distal spine. All specimens (live and preserved) lack external pigmentation. Male paratypes share the presence of copulatory organs as described in holotype, and ventral to parapodia of chaetiger 6 (Fig. 6 A). Females bear an oval and flat tubercle with a porous surface also ventral to parapodia of chaetiger 6 (Fig. 6 B). Females, instead, show ventral cirri on the parapodia of this chaetiger (Fig. 6 B). Remarks. The present species agrees with the diagnostic features attributed to those Sphaerodoropsis species with macrotubercles in more than two transverse rows per chaetigers (Group 3, according to Borowski 1994), but also with other genera considered to lack macrotubercles and with large papillae instead, such as Amacrodoum Kudenov 1987, Commensodoum L��tzen, 1961 and Euritmia Sard��-Borroy, 1987. Distinguishing papillae and macrotubercle is imprecise since they are currently defined according to their size (Fauchald 1974) and this is continuous character. Consequently, the species sharing the presence of more than 10 longitudinal rows of tubercles (more or less similar in size) in around four transverse rows per chaetiger need revision to enlighten their relationships and address their correct classification (Capa & Bakken in prep.). There are two other species of Sphaerodoropsis in Borowski���s Group 3, S. multipapillata (Hartmann-Schr��der, 1974), from Tanzania, and S. mutipapillata heteropapillata Hartmann-Schr��der, 1987, from Victoria, Australia, recently given a species rank (Capa & Bakken 2015). Sphaerodoropsis plurituberculata n. sp. is most similar to S. heteropapillata because both species are covered with dissimilar dorsal tubercles, while in S. multipapillata these are of similar size (Hartmann-Schr��der 1974 b; Hartmann-Schr��der 1987; Capa & Bakken, 2015). Differences between S. heteropapillata and the new species include the length of the prostomial appendages (inconspicuous in S. heteropapillata and digitiform in S. plurituberculata n. sp., at least when not contracted); the number and of ventral papillae (around 50 per segments in S. heteropapillata and 30 in S. plurituberculata n. sp.); and the number of parapodial papillae (S. heteropapillata bears one at anterior surface while S. plurituberculata n. sp. lacks parapodial papillae). Amacrodorum bipapillatum Kudenov, 1987, from Alaska, is distinguished from the new species by the morphology of the antennae, with spurs in A. bipapillatum and apparently smooth in the new species; the presence of one pair of black eyes in A. bipapillatum, absent in the new species; and having chaetae with strongly recurved tips (Kudenov 1987 b: Fig. 1 J) instead of straight but provided with a long and thin distal spine. Moreover, A. bipapillatum was described with the apparently atypical attribute of bearing two different types of tubercles, elliptical and hemispherical while in S. plurituberculata n. sp. all papillae seem spherical. Euritmia hamulisetosa Sard��-Borroy, 1987 described from the south of Spain, differs from the new species in the chaetal morphology. Euritmia hamulisetosa bears simple chaetae, of different widths in all chaetigers all provided with a distal spine bent rearward to the cutting edge (Sard��-Borroy 1987) while S. plurituberculata n. sp. bears semi compound chaetae, all similar in width and with an erected thin spine. The other congener, Euritmia capense (Day, 1963) is provided with two defined rows of papillae of different size each, but they are not distributed in an apparently random pattern as in S. plurituberculata n. sp. Commensodorum commensalis L��tzen, 1961 is distinguished from the new species in the presence of four longitudinal rows of papillae along the dorsum (L��tzen 1961). Reproductive notes. Live specimens of Sphaerodorpsis plurituberculata n. sp. maintained in aquaria were studied during several days. White masses were observed attached to the body surface of both sexes during this time. These were found to be spermatophores when examined with a compound microscope (image not shown). On several occasions males were seen to be pseudo-copulating with females, or other males, for less than a minute and on detaching were seen to have left one or two spermatophores on the body surface (Fig. 4 C). Masses that corresponded to the size and colour of these spermatophores could be seen ventrally in chaetiger 6 (Fig. 4 D), suggesting this segment is indeed the location of copulatory papillae. Structures attributed to be copulatory organs have been described for several other sphaerodorids in Sphaerodoropsis and Sphaerodoridium (Moreira et al. 2004; B��ggemann 2009; Reuscher & Fiege 2011; Moreira & Parapar 2012, 2015; Capa & Bakken 2015). Males of Sphaerodoropsis plurituberculata n. sp. were observed to have various stages of spermiogenesis in their coelom. Sperm developed in cluster attached to a large central cytophore (Fig. 4 F���G). The sperm heads were elongate at ~ 35 ��m long (Fig. 4 G) with what appeared to be a free flagellum of similar length. Free sperm were visible in the coelom (Fig. 4 B) and it is not known how the sperm were packaged in the spermatophores. Males could be easily distinguished from females by having milky white coelomic contents surrounding the dark gut. Females had bluish/ gray oocytes at various stages of development, with up to 10 oocytes at what appeared to be a late stage of development (Fig. 4 A). Some females were observed to have free sperm in the coelom that had presumably come from the spermatophores (not shown). The largest eggs observed inside a female were about 150 ��m in diameter suggesting development is lecithotrophic, similarly to conclusions reached by Christie (1984)., Published as part of Capa, Mar��a & Rouse, Greg W., 2015, Sphaerodoridae (Annelida) from Lizard Island, Great Barrier Reef, Australia, including the description of two new species and reproductive notes, pp. 168-183 in Zootaxa 4019 (1) on pages 176-181, DOI: 10.11646/zootaxa.4019.1.9, http://zenodo.org/record/232849, {"references":["Hartmann-Schroder, G. (1987) Zur Kenntnis des Eulitorals der australischen Kusten unter besonderer Berucksichtigung der Polychaeten und Ostracoden. Teil 13. Die Polychaeten der antiborealen Kuste von Victoria (Australien) (zwischen Warrnambool im Western und Port Welshpool im Osten). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 84, 27 - 66.","Hartmann-Schroder, G. (1979) Zur Kenntnis des Eulitorals der australischen Kusten unter besonder Berucksichtigung der Polychaeten und Ostracoden. Teil 2. Die Polychaeten der tropischen Nordwestkuste Australiens (zwischen Derby im Norden und Port Hedland im Suden). Mitteilungen aus dem Hamburgischen zoologischen Museum und Institut, 76, 77 - 218","Borowski, C. (1994) Three new deep-sea species of Sphaerodoridae (Annelida, Polychaeta) from the eastern tropical South Pacific. Zoologica Scripta, 3, 193 - 203. http: // dx. doi. org / 10.1111 / j. 1463 - 6409.1994. tb 00384. x","Lutzen, J. (1961) Sur une nouvelle espece de Polychete Sphaerodoridium commensalis. n. gen., n. spec. (Polychaeta Errantia, famille des Sphaerodoridae), vivant en commensal de Terebellides stroemi Sars. Cahiers de Biologie Marine, 2, 409 - 416.","Sarda-Borroy, R. (1987) Sphaerodoridae (Annelida, Polychaeta) from the region of the Gibraltar Strait with description of Euritmia hamulisetosa gen. et sp. n. Zoologica Scripta, 16, 47 - 50.","Fauchald, K. (1974) Sphaerodoridae (Polychaeta: Errantia) from world-wide areas. Journal of Natural History, 8, 257 - 289. http: // dx. doi. org / 10.1080 / 00222937400770241","Hartmann-Schroder, G. (1974 b) Zur Polychaetenfauna von Natal (Sudafrika). Mitteilungen aus dem Hamburgischen zoologischen Museum und Institut, 71, 35 - 73.","Kudenov, J. D. (1987 b) Five new species of Sphaerodoridae (Annelida: Polychaeta) from the Gulf of Mexico. Proceedings of the Biological Society of Washington, 100, 927 - 935.","Day, J. H. (1963) The Polychaete fauna of South Africa. Part 8: New species and records from grab samples and dredgings. Bulletin of the British Museum (Natural History), Series Zoology, 10 (7), 383 - 445.","Boggemann, M. (2009) Polychaetes (Annelida) of the abyssal SE Atlantic. Organisms, Diversity and Evolution, 9, 251 - 428. http: // dx. doi. org / 10.1016 / j. ode. 2004.11.006","Reuscher, M. & Fiege, D. (2011) Sphaerodoridae (Annelida: Polychaeta) from the deep south - west Pacific, with the description of a new species of Sphaerodoropsis. Journal of the Marine Biological Association of the United Kingdom, 91, 439 - 445. http: // dx. doi. org / 10.1017 / s 0025315410000469","Moreira, J. & Parapar, J. (2012) Two new species of Sphaerodoropsis Hartman & Fauchald, 1971 (Polychaeta: Sphaerodoridae) from Iceland (BIOICE programme). Marine Biology Research, 8, 584 - 593. http: // dx. doi. org / 10.1080 / 17451000.2011.638929","Moreira, J. & Parapar, J. (2015) A new species of Sphaerodoridium Lutzen, 1961 from Iceland (Polychaeta: Sphaerodoridae). Zootaxa, 3911 (1), 91 - 105. http: // dx. doi. org / 10.11646 / zootaxa. 3911.1.5","Christie, G. (1984) The reproductive biology of a Northumberland population of Sphaerodorum gracilis (Rathke, 1843) (Polychaeta: Sphaerodoridae). Sarsia, 69, 117 - 121."]}

Sphaerodoropsis sp. Material examined. Western Australia: NMV F. 162489 (1 spec.), Two Rocks region, 31 �� 41 ' 48 '' S, 114 �� 52 ' 00'' E, 734 m, 5 Aug 2005. Description. Measurements and general morphology. Body short and arched measuring 1.2 mm long and 0.5 mm wide, with 10 chaetigers. Dorsum convex and ventrum flattened, inconspicuous segmentation. Preserved specimen white with red fibrillar material in most macrotubercles. Head. Retracted head, anterior appendages hard to observe in detail, but seem to consist of a median antenna, a pair of lateral antennae and a pair of palps. Tubercles. Dorsal macrotubercles sessile and semispherical. First chaetiger with 4 macrotubercles, following chaetigers with 13 macrotubercles in double transversal rows, with six tubercles between parapodia, and seven on posterior row, macrotubercles of similar size, dorsal papillae not observed. Ventral surface with two longitudinal rows of large tubercles close to parapodia. Fibrillar material, as coiled treads, beneath the epidermis of most dorsal and ventral macrotubercles. Ventral spherical papillae in 4���6 longitudinal rows, arranged in double transversal rows per segment, and in a zig-zag pattern. Parapodia. Parapodia wider than long. Acicular lobe only a low ridge anterior to chaetae, ventral cirri short rounded projecting beyond acicular lobe. Parapodial papillae not observed. Chaetae. Compound chaetae present in all chaetigers in an arch posterior to acicular lobe, numbering 5���6 chaetae in each fascicle. Slender blades with recurved tip, 3���4 times longer than maximum width. Pygidium. Pygidium with a pair of semispherical papillae, and a median rounded papilla, smaller than macrotubercles. Reproductive features. No eggs, sperm or ���copulatory organs��� observed. Remarks. The single specimen is well preserved and is in good condition and seems to represent a different species than the others reported in this work. It belongs in Sphaerodoropsis group 3 (sensu Borowski 1994), and most closely resembles S. solis and S. fauchaldi, which are the Sphaerodoropsis species up to now described with longitudinal rows of ventral macrotubercles. The present specimen can be distinguished from S. fauchaldi by having a single ventral large tubercle close to the parapodia, while in S. fauchaldi there are two (or three) longitudinal rows on each side. It also has fewer dorsal macrotubercles, 6���7 per transversal row, compared to 12��� 14 (8���10) in S. fauchaldi. In terms of dorsal macrotubercles the present specimen is more similar to S. solis, but has fewer ventral papillae per segment and seems to have shorter blades of chaetae than in S. solis. It should, however, be noted that the present specimen is small with only 10 chaetigers and presumably not fully grown. More specimens should be found before assessing the true identity of the species, in if appropriate describe it as new. Distribution. South Western Australia (Fig. 15). Ecology. Sand, 734 m depth., Published as part of Capa, Maria & Bakken, Torkild, 2015, Revision of the Australian Sphaerodoridae (Annelida) including the description of four new species, pp. 227-267 in Zootaxa 4000 (2) on page 262, DOI: 10.11646/zootaxa.4000.2.3, http://zenodo.org/record/234762, {"references":["Borowski, C. (1994) Three new deep-sea species of Sphaerodoridae (Annelida, Polychaeta) from the eastern tropical South Pacific. Zoologica Scripta, 23, 193 - 203. http: // dx. doi. org / 10.1111 / j. 1463 - 6409.1994. tb 00384. x"]}

Sphaerodoropsis wilsoni n. sp. Figs 4 S, T, 5 L, 14 Material examined. Holotype: Jervis Bay, New South Wales, Australia. NMV F. 217161, 35° 06' 04" S, 150 ° 44 ' 18 " E, 22. 4 m, 27 Jun 2008. Paratypes: NMV F. 166667 (6 specs), same sample. Additional material. New South Wales: AM W. 194299 (1 spec.), Murrays Basin, Jervis Bay, 35 ° 07' 30 " S, 150 ° 45 ' 30 " E, 17 Oct 1972, sand; AM W. 42741 (1 spec.), east of Malabar, 33 ° 59 ' 11 " S, 151 ° 17 ' 54 " E, 83.7 m, 18 Jan 1996; AM W. 42750 (2 specs), east of Malabar, 33 ° 58 ' 46 " S, 151 ° 17 ' 54 " E, 79.6 m, 19 Mar 1996. Victoria: NMV F. 131344 (1 spec.), Eastern Bass Strait, 38 ° 32 ' 15 " S, 146 ° 29 ' 24 " E, 40 m, 11 May 1998. South Australia: ZMH P. 18249 (1 spec. for SEM), Denial Bay, Ceduna, South Australia, Australia. 1,2 m, 30. Nov. 1975. Western Australia: AM W. 17728 (1 spec.), Horrocks, 28 ° 23 ' S, 114 ° 26 ' E, 17 Oct 1975, sandy reef platform with calcareous algae; AM W. 42676 (1 spec.), Two Peoples Bay, 2 km south-east of South Point, 34 ° 58 ' S, 118 ° 12 ' E, 10 m, 16 Dec 1983, dictyotalean algae. Comparative material. Sphaerodoropsis laevis Fauchald, 1974, holotype LACM-AHF POLY 0952; paratype LACM-AHF POLY 0953; Sphaerodoropsis martinae Desbruyères, 1980, holotype MNHN Type 1285. Diagnosis. Ellipsoid body with strongly convex dorsum. Four longitudinal rows of sessile and spherical dorsal macrotubercles and four transversal rows (with up to 38) of spherical papillae per segment. Distance between dorsal-most macrotubercles exceeds distance between those and lateral ones. Parapodia with digitiform acicular lobe, shorter ventral cirrus and a single rounded papilla on anterior end (often other two papillae, on anterior and posterior surfaces present). Four or six chaetae per parapodium with short blades (2–3 times longer than wide), serrated, with distal long spines; shaft with conspicuous spinulation. Description. Measurements and general morphology. Body ellipsoid, measuring 2.3 mm long and 0.5 mm wide, with 20 chaetigers. Tegument with transverse wrinkles, segmentation inconspicuous (Fig. 14 A). Dorsum convex and ventrum flattened (Fig. 14 A). Preserved specimen lacking pigmentation. Head. Anterior end bluntly rounded. Prostomium with five longer appendages, including a pair of digitiform palps, in ventral most position; a pair of lateral antennae similar in size and shape to palps; and a median antenna, about one third longer than lateral antennae (Fig. 14 A–B). Antenniform papillae not observed. Around 15–20 spherical papillae are confined by prostomial appendages and the mouth (Fig. 14 B). A pair of tentacular cirri similar in shape and size to lateral antenna and palps (Fig. 14 B). Nuchal organ pits anterior to tentacular cirri (Fig. 14 B). Tubercles. First chaetiger with two macrotubercles spherical and sessile (Fig. 14 A–B). Rest of chaetigers with four macrotubercles each, arranged in four longitudinal rows along dorsum. Distance between mid-rows is similar or slightly larger than between these and lateral macrotubercles. All macrotubercles similar in size, with distal pores arranged 4–6 groups (Fig. 14 E). Spherical papillae over dorsum, arranged in four transverse rows per segment, adding 16–20 papillae between mid-macrotubercles, 6–10 between these and the lateral ones in midsegments, and 6–8 papillae between lateral macrotubercles and parapodia (Figs 4 S, 14 A, C). All papillae similar in size and shape. Ventral surface with spherical papillae, arranged in three transverse rows, with around 20 papillae in mid-body segments; numbers decreasing towards posterior end (Figs 4 T, 14 D). Body epithelium with microscopic granules. Parapodia. Parapodia sub-conical, about 1–2 times longer than wide. First chaetiger with digitiform acicular lobe projecting; ventral cirri similar in shape and size, parapodial papillae absent. Second and following chaetigers similar, with one anterior spherical papillae, and sometimes a dorsal papilla and/or a ventral papilla close to base of parapodia (Figs 5 L, 14 A, C–D, F). Acicular lobe digitiform in middle chaetigers, longer than ventral cirri (Fig. 14 C, D, F). Chaetae. Compound chaetae present in all chaetigers, arranged in a curved transverse row around acicular lobe, numbering 7–8 per fascicle (Figs 5 L, 14 C–D, F). Shaft with widened distal end and fine and long spinulation on edge. Blades similar in length along fascicles, wide and short (2–3 times longer than maximum width), with fine and short spinulation along superior edge and a distal recurved tip (Fig. 14 F–H). One or two long and thin distal spines present behind distal tip (Fig. 14 G–H). Blades showing a design on their sides with an inverted V (Fig. 14 G–H). Pygidium. Pygidium terminal, with mid-ventral anal cirrus and a pair of dorsal anal cirri, all spherical and similar in size. Internal features. Eyes not observed on holotype, but a pair of eyes has been observed on one specimen. Muscular pharynx rounded, from first to third chaetiger. Reproductive features. ‘Copulatory organs’ not observed in types or additional material. Variation. Specimens measure 1.2–3mm long and 0.5–0.8mm wide, body is about 3–4 times longer than wide, with around 20 chaetigers. Macrotubercles are in all specimens spherical. Relative length of head appendages show no variation with holotype and median antenna is longer to rest of prostomial appendages, and with a distal knob. Relative length/width of parapodia and number of parapodial papillae do not vary among specimens. The dorsal papillae observed in some parapodia of the holotype, could be considered as not parapodial in some types and additional material. Methylene blue stains the ventral parapodial gland and ventral cirri of all parapodia, but not the macrotubercles. Most preserved specimens present an opaque tegument and the presence of gonads, eyes or the shape and length of the muscular pharynx could not be assessed. Remarks. The genus Sphaerodoropsis is very specious but only four species have been described as having four longitudinal rows of macrotubercles (Group 1 according to Borowski 1994) and falcigers with short blades (Aguado & Rouse 2006). These are S. exmouthensis, re-described above; S. laevis Fauchald, 1974 (from Chile and Peru); S. martinae Desbruyères, 1980 (from the North-East Atlantic); and S. simplex Amoureux, Rullier and Fishelson, 1978 (from the Red Sea). Sphaerodoropsis wilsoni n. sp. differs from these species in the number of epithelial papillae. Sphaerodoropsis simplex was described without tubercles other than the macrotubercles, S. laevis only showed papillae around the head, and S. exmouthensis and S. martinae have only a few (less than 10 per segment), while the new species is densely covered with up to 38 papillae in mid-body segments. The new species shares some superficial morphological attributes with S. exmouthensis Hartmann-Schröder, 1981 (re-described above) and erroneous identifications have been found in collections. Some specimens identified as S. exmouthensis by Hartmann-Schröder (ZMH P. 18249) belong in fact to S. wilsoni n. sp. Differences between these two Australian species are: the shape of macrotubercles (pear-shaped in S. exmouthesis and spherical in the new species), number and arrangement of epithelial papillae (scarce and different in size in S. exmouthensis and similar size papillae densely covering the surface in S. wilsoni n. sp.), and the morphology of chaetae (narrow shaft, longer blades and smooth distal end in S. exmouthensis, and wide shaft, short blades and distal spine in new species). Etymology. This species is dedicated to Robin Wilson, a generous college and good friend, for his contribution to polychaete systematics and continuous efforts of making taxonomic information available for all of us. Type locality. Jervis Bay, New South Wales (Fig. 15). Distribution. Along the southern Australian coastline (New South Wales, Victoria, South Australia and Western Australia) (Fig. 15). Ecology. Sand and algal communities, between 1–40 m depth.

Sphaerodoropsis spissum (Benham, 1921) Sphaerodorum spissum Benham, 1921: 74 ���77, Pl. 9, Figs 82���89.��� Augener 1927: 208 ���210, Fig. 11. Remarks. This species was originally described from the Sub-Antarctic Macquarie Island as a species densely covered with papillae of not exact same sizes (Benham 1921). It has been suggested that this species has longitudinal rows of macrotubercles on the ventrum (Reuscher & Fiege 2011), but this is not quite clear from the original description and illustrations. In the original description and remarks given there were obviously problems to observe necessary details, and uncertainty in observation of characters was explicitly stated (Benham 1921: 74��� 77). This species was reported a few years later from the head of Sydney Harbour (Augener 1927). Due to the small size of the single specimens found then (2.5 mm long), Augener had trouble observing all details and it is not unlikely that specimen belong to S. fauchaldi with its numerous macrotubercles distributed with no apparent pattern. It is necessary to study specimens reported as S. spissum to prepare a re-description in order to establish the true identity of this species. Until then, the species should not be considered to be a part of the continental Australian fauna, and should be considered known only from the original description. Nevertheless, it has not been possible to examine original or reported specimens., Published as part of Capa, Maria & Bakken, Torkild, 2015, Revision of the Australian Sphaerodoridae (Annelida) including the description of four new species, pp. 227-267 in Zootaxa 4000 (2) on page 262, DOI: 10.11646/zootaxa.4000.2.3, http://zenodo.org/record/234762, {"references":["Benham, W. B. (1921) Polychaeta. Scientific Reports Australasian Antarctic Expedition 1911 - 1914, Series C, 6, 1 - 128. http: // dx. doi. org / 10.5962 / bhl. title. 31708","Augener, H. (1927) Papers from Dr. Th. Mortensen's Pacific Expedition 1914 - 16. 38. Polychaeten von Sudost- und Sud- Australien. Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i Kobenhavn, 83, 71 - 275.","Reuscher, M. & Fiege, D. (2011) Sphaerodoridae (Annelida: Polychaeta) from the deep south-west Pacific, with the description of a new species of Sphaerodoropsis. Journal of the Marine Biological Association of the United Kingdom, 91, 439 - 445. http: // dx. doi. org / 10.1017 / S 0025315410000469"]}

Sphaerodoropsis heteropapillata Hartmann-Schr��der, 1987 new rank Figs 4 M���N, 5 I, 11 Sphaerodoropsis multipapillata heteropapillata Hartmann-Schr��der, 1987: 50 ���51, Figs 32���36. Material examined. Holotype ZMH P. 18875 Point Lonsdale, Geelong, Victoria, Australia, Abrasion terrace near lighthouse, on coralline algae, 24 Dec 1975. Additional material. New South Wales: AM W. 42683 (1 spec.), Split Solitary Island, 30 �� 14 ' S, 153 �� 10 ' 48 " E, 15 m, 7 Mar 1991, mixed red algae; AM W. 42686 (4 specs, 2 on SEM stubs), South Solitary Island, 30 �� 12 ' 07" S, 153 �� 15 ' 59 " E, 14.5 m, 1 May 2005, coarse sediment; AM W. 42684 (1 spec.), Burrill Rock, Ulladulla, 35 �� 23 ' 25 " S, 150 �� 28 ' 11 " E, 10 m, 1 May 1997, Ecklonia holdfasts. Tasmania: AM W. 42678 (2 specs), Maquarie Island, 54 �� 30 ' S, 158 �� 57 ' E, 15 m, 19 Oct 1983, algae. Victoria: NMV F. 90823 (2 specs), Beware reef, Cape Conran, 37 �� 49 ' 20 '' S, 148 �� 47 ' 23 '' E, 5 m, 15 Apr 1998, subtidal rocky reefs. Comparative material. Sphaerodoridium multipapillata Hartmann-Schr��der, 1974, holotype, ZMH P. 14336. Diagnosis. Ellipsoid body. Dorsum with more than 50 spherical sessile tubercles in two sizes in about five transversal rows per segment, in an irregular pattern. Ventrum with 50���60 spherical papillae in two sizes in 5 irregular transversal rows. Two parapodial papillae, one each on anterior and posterior surfaces. Parapodia with 6��� 10 chaetae per fascicle, blades as long as wide. Chaetae semi-compound, with shaft distally widened and blades short and wide (as long as broad), both provided of stout spines. Re-description. Measurements and general morphology. Female with eggs. Body ellipsoid, measuring 2.8 mm long, 1.0 mm wide, with 19 chaetigers, anterior end bluntly rounded (Fig. 11 B���C), slightly narrowing along posterior segments; convex dorsum (Fig. 11 A) and flat ventrum (Fig. 11 B). Segmentation inconspicuous (Fig. 11 B���D), tegument wrinkled (Fig. 11 A���B). Preserved specimen yellowish, lacking pigmentation. Head. Indistinguishable rounded appendages, similar to surrounding papillae (Fig. 11 B���C). Tubercles. Spherical and sessile tubercles dissimilar in size present on dorsum in 5���7 irregular transversal rows with more than 50 tubercles in each chaetiger (Figs 4 M, 11 A, C���D). Ventral surface with sessile and spherical papillae dissimilar in size, with 50���60 papillae per chaetiger in five irregular transversal rows, ventral papillae somewhat smaller than dorsal tubercles (Figs 4 N, 11 B, D). Body epithelium with microscopic oblong granules (Fig. 11 F). Parapodia. Parapodia sub-conical, increasing in size towards chaetiger 3, around 1���2 times longer than wide in mid-chaetigers (Fig. 11 E, G���H), and decreasing slightly towards posterior chaetigers. Acicular lobe anterior to chaetae fascicle, ellipsoid, 2���3 times longer than wide, projecting longer than ventral cirrus (Fig. 11 G���H), with pores on distal end (Fig. 11 H). Ventral cirri ellipsoid (Fig. 11 G���H). Parapodial papillae spherical, one at base of anterior surface (Figs 5 I, 11 G), and one at base of posterior surface (Figs 5 I, 10 H); similar throughout chaetigers. Chaetae. Chaetal fascicles arranged in a curved transverse row behind acicular lobe, numbering 6���10 chaetae per fascicle (Figs 5 I, 11 E, G���H). All chaetae semi-compound (Fig. 11 J���M), appearing sometimes as simple and suggesting a fusion of shaft and blades (Fig. 11 L���M). Blades as long as wide (Fig. 11 J���M); with an outer distal thin spine in some chaetae (Fig. 11 L���M). Shaft with widened distal end with saw-toothed spinulation (Fig. 11 L���M), continuing along most of blade length. Pygidium. Pygidium terminal, with inconspicuous spherical anal cirri similar in shape as surrounding papillae (Fig. 11 I). Internal features. One pair of eyes as sickle-shaped dark brown or black spots deeply embedded below integument in chaetigers 2���3. Muscular pharynx not observed. Reproductive features. Holotype and other two females with large eggs measuring approximately 130 ��m. ���Copulatory organs��� not observed in any specimen. Variation. Specimens examined are all ellipsoid, ranging 1.0��� 2.3 mm long, 0.3���0.7 mm wide, with 14���20 chaetigers and resemble the holotype in the short and inconspicuous prostomial appendages similar in shape to surrounding papillae and the shape and size of parapodia. In the original description four parapodial papillae were reported, only two have been observed after reexamination of the holotype and in additional material. Parapodial papillae are difficult to observe, and also judgment of their position as they are placed at the base of parapodia. Definition of chaetae is ambiguous. Most chaetae are simple when observed in the scanning electron microscope, although some give the impression of being semi-compound (Fig. 11 J���M), and even break at the joint between shaft and blade (Fig. 11 M). In the light microscope chaetae have a clear appearance of being compound (Fig. 11 J��� K), as they were described in the original description (Hartmann-Schr��der 1987: Fig. 36). Remarks. Sphaerodoropsis heteropapillata is characterized by having relatively large dorsal tubercles of a range of sizes and by bearing semi-compound chaetae. In addition, relatively large papillae are present on the ventral side. Dorsal and ventral tubercles are arranged in irregular transversal rows being difficult to outline, especially when specimens are contracted. It was included within the informal Sphaerodoropsis Group 4 (sensu Borowski 1994) gathering species with ���macrotubercles��� scattered in 3���4 transversal rows, together with S. multipapillata (Hartmann-Schr��der, 1974), from Tanzania. Both species also share the similar type of wide semicompound chaetae (Hartmann-Schr��der 1974 a, 1987). Sphaerodoropsis heteropapillata (which only the holotype had been reported to date) was originally described as a subspecies of S. multipapillata. The geographic distance suggests it is unlikely the two represent separated populations of the same species. There are also clear differences between the species. S phaerodoropsis heteropapillata bears parapodial papillae while in S. multipapillata parapodia lack papillae (Hartmann-Schr��der 1974 a, 1987; this study). Moreover, in S. heteropapillata dorsal tubercles clearly have different sizes, while in S. multipapillata papillae are of similar size. This warrants elevation of the subspecies to rank of species. S phaerodoropsis heteropapillata also resembles a recently described species from Lizard Island, Great Barrier Reef, Sphaerodoropsis plurituberculata Capa and Rouse, 2015. Both species bear several more or less clearly longitudinal rows of spherical and sessile tubercles, variable in size, arranged in several transverse rows per segment, over dorsum and ventrum; around six semi-compound chaetae per parapodium with distally enlarged shaft and short blades, serrated, with distal long spines on the edge opposite to serration and shaft with conspicuous spinulation continuing along most of blade. Differences between these two Australian species lay in the relative length of the head appendages, number and arrangement of dorsal and ventral tubercles. Sphaerodoropsis plurituberculata is most similar to S. heteropapillata because both species are covered with dissimilar dorsal tubercles, while in S. multipapillata these are of similar size (Hartmann-Schr��der 1974 a; Hartmann-Schr��der 1987; Capa & Rouse 2015). Differences between S. heteropapillata and the new species include the length of the prostomial appendages (inconspicuous in S. heteropapillata and digitiform in S. plurituberculata, at least when not contracted); the number of ventral papillae (around 50 per segment in S. heteropapillata and 30 in S. plurituberculata); and the number of parapodial papillae (S. heteropapillata bears one per parapodium: one at anterior surface while S. plurituberculata lacks parapodial papillae) (Capa & Rouse 2015). ���Copulatory organs��� have not been observed in S. heteropapillata, but in Sphaerodoropsis plurituberculata male copulatory organ were described as enlarged, bottle-shaped and porous ventral cirrus and females presented an oval and flat tubercle with a porous surface also ventral to parapodia of chaetiger 6, in addition to the ventral cirrus (Capa & Rouse 2015). Type locality. Point Lonsdale, Geelong, Victoria. Distribution. Victoria, New South Wales and the Sub-Antarctic Maquarie Island, from 0 to 15 m (Hartmann- Schr��der 1987, Fig. 15). Habitat. Coarse sediment and among algae in subtidal rocky reefs., Published as part of Capa, Maria & Bakken, Torkild, 2015, Revision of the Australian Sphaerodoridae (Annelida) including the description of four new species, pp. 227-267 in Zootaxa 4000 (2) on pages 251-254, DOI: 10.11646/zootaxa.4000.2.3, http://zenodo.org/record/234762, {"references":["Hartmann-Schroder, G. (1987) Zur kenntnis des Eulitorals der australischen Kusten unter besonderer Berucksichtigung der Polychaeten und Ostracoden. Teil 13. Die Polychaeten der antiborealen Kuste von Victoria (Australien) (zwischen Warrnambool im Westen und Port Welshpool im Osten). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 84, 27 - 66.","Borowski, C. (1994) Three new deep-sea species of Sphaerodoridae (Annelida, Polychaeta) from the eastern tropical South Pacific. Zoologica Scripta, 23, 193 - 203. http: // dx. doi. org / 10.1111 / j. 1463 - 6409.1994. tb 00384. x","Hartmann-Schroder, G. (1974 a) Weitere Polychaeten von Ostafrika (Mocambique und Tansania). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 71, 23 - 33.","Capa, M. & Rouse, G. W. (2015) Sphaerodoridae (Annelida) from Lizard Island, Great Barrier Reef, including the description of two new species and reproductive notes. Zootaxa. [in press]"]}

Sphaerodoropsis fauchaldi Hartmann-Schr��der, 1979 Figs 4 I���L, 5 H, 9, 10 Sphaerodoropsis fauchaldi Hartmann-Schr��der, 1979: 122 ���123, Figs 238���242; 1989: 39. Material examined. Holotype ZMH P. 15486, Port Hedland, Western Australia, sand with algae and detritus, 27 Sept 1975. Additional material. Western Australia: AM W. 42679 (1 spec.), off jetty at Green Island, Rottnest Island, 32 �� 01' S, 115 �� 30 ' E, intertidal, 21 Dec 1983, algal turf and sediment on reef flat. Northern Territory: NTM W. 10209 (1 spec.), Darwin Harbour, 12 �� 29 ' 52 '', 130 �� 50 ' 18 ''E, 7 m, 14 Jul 1993, 7 m; NTM W. 10205 (1 spec.), Darwin Harbour, 12 �� 31 ' 08'' S, E 130 �� 47 ' 05'' E, 7 m, Jul 1993; NTM W. 10207 (1 spec.), Darwin Harbour, 12 �� 34 ' 52 '' S, 130 �� 51 ' 03'' E, 6 m, 13 Jul 1993; NTM W. 15192 (1 spec.), Darwin Harbour, 12 �� 33 ' 45 ''S, 130 �� 52 ' 01'' E, 3 m, 18 Mar 1994; NTM W. 10204 (1 spec.), Darwin Harbour, 12 �� 31 ' 13 '' S, 130 �� 56 ' 02'', 11 m, 16 Jul 1993. New South Wales: AM W. 42692 (1. spec.), Red Head, 32 �� 03' 17 " S, 152 �� 33 ' 14 " E, 22 Mar 2003, 13 m, sand and rocky reef; AM W. 42687 (2 specs), Surgeons Reef, North West Solitary Island, 30 �� 00' 27 " S, 153 �� 16 ' 13 " E, 11 m, 30 Apr 2005, sand and shelly sediment; AM W. 42706 (1 spec.), Bass Point, 34 �� 36 ' S, 150 �� 54 ' E, 1 Feb 1991, 45 m; AM W. 42690, (2 specs), S. of Baronda Head, Tathra, 36 �� 41 ' 12 " S, 149 �� 59 ' 53 " E, 11 m, 5 Apr 2008, Ecklonia holdfasts; AM W. 42696 (2 spec.), NE side Little Broughton Island, north-east of Port Stephens, 32 �� 37 ' 05" S, 152 �� 20 ' 06" E, 17 m, 11 Mar 2006, alga Ecklonia holdfasts; AM W. 42697 (1 spec.), Esmeralda Cove, Broughton Island, Port Stephens, 32 �� 37 ' 19 " S, 152 �� 19 ' 10 " E, 18 m, 12 Mar 2006, coarse shelly sediment; AM W. 42698 (1 spec.), Esmeralda Cove, Broughton Island, Port Stephens, 32 �� 37 ' 19 " S, 152 �� 19 ' 10 " E, 18 m, 12 Mar 2006, bushy brown algae; AM W. 42689 (1 spec.), E. of Baronda Head, Tathra, 14 m, 4 Apr 2008, among red algae and bryozoans; AM W. 42685 (1 spec.), Halfway Reef, Ulladulla, 35 �� 21 ' 25 " S, 150 �� 29 ' 19 " E, 15 m, 3 May 1997, sponges, bryozoan and hydrozoan; AM W. 42686 (2 spec.), north west end of South Solitary Island, 30 �� 12 ' 07" S, 153 �� 15 ' 59 " E, 14.5 m, 1 May 2005, coarse sediment; MZH P. 20094 (3 specs), Malua Bay, Batemans Bay, 4 Jan 1976. Victoria: NMV F. 90824 (1 spec.), Schomberg Reef, near Peterborough 38 �� 36 ' 49 " S, 142 �� 53 ' 19 " E, 13 May 1998; NMV F. 90825 (1 spec.), Mutton Bird Island, near Port Campbell, 38 �� 38 ' 55 " S, 143 �� 03' 46 " E; NMV F. 132899, Central Bass Strait, 38 �� 30 ' 12 " S, 144 �� 15 ' 00" E; NMV F. 217162, 11.7 km W of Pt Ricardo, Eastern Bass Strait, 37 �� 49 ' 53 '' S, 148 �� 30 ' 07'' E, 27 m, Feb 1991, coarse sand. Diagnosis. Ellipsoid body with 10���14 longitudinal rows of spherical macrotubercles, in two transversal rows per segment, with 8���12 macrotubercles in a row between parapodia and 10���14 in posterior row. Dorsum with spherical papillae in two longitudinal rows next to parapodia. Ventrum with two longitudinal rows of large tubercles, near parapodia and four longitudinal rows of spherical papillae. One papilla on anterior surface of each parapodium. Parapodia with 5���6 chaetae per fascicle, slightly enlarged distally, blades 3���4 times as long as wide. Both females and males with porous swollen ventral cirri, in chaetigers 4���7 and 5���8, respectively; additionally, females bear with porous tubercle-like structure ventral to parapodia of chaetiger 6. Re-description. Measurements and general morphology. Body ellipsoid, 0.8 mm long and 0.4 mm wide, with 16 chaetigers. Dorsum convex, ventrum flattened (Fig. 9 A, C). Segmentation inconspicuous, tegument with transverse wrinkles (Fig. 9 A���D). Preserved specimen lacking pigmentation. Head. Anterior end bluntly rounded (Fig. 9 A���B). Prostomium with five digitiform appendages, including a pair of short palps in a ventral position, a pair of lateral antennae and a median antenna; lateral antennae similar in size and shape to palps; median antenna, about as long as lateral antennae (Fig. 9 C). Antenniform papillae not observed. A pair of tentacular cirri shorter than lateral antenna. A few scattered papillae present on the head (Fig. 9 C). Tubercles. Dorsal macrotubercles sessile and spherical. First chaetiger with two transversal rows of four and five macrotubercles each. Following chaetigers with 17 longitudinal rows of macrotubercles, arranged in double transversal rows on each segment (with 8 and 9 tubercles each), decreasing in size from dorsal-most to lateral rows (Figs 4 I, 9 A). Additional single spherical papilla above each parapodia (Figs 4 I, 9 A, D). Two large spherical macrotubercles close to the base of each parapodium, forming four longitudinal rows on ventrum (Figs 4 J, 9 A���B, D). Additional small spherical papillae in four longitudinal rows, leaving a gap mid-ventrally without papillae (Figs 4 J, 9 A, D���E). Body epithelium with irregular granules (Fig. 10 D). Parapodia. Parapodia sub-conical, about 1���2 times longer than wide. Chaetigers with digitiform acicular lobe, present from chaetiger 2, projecting longer than ventral cirrus (Fig. 9 D���G, I, 10 C); ventral cirri bottle-shaped (Fig. 9 D, G, I). One spherical papilla on each parapodium on the anterior surface, variable in size (Figs 5 H, 9 G, I, 10 C���D). Chaetae. Compound chaetae present in all chaetigers, arranged in curved transverse rows posterior to acicular lobe, numbering 5���6 per fascicle (Figs 5 H, 9 E���F, I). Shaft with slender distal end with long spinulation on edge (Figs 9 K���L, 10 E���G). Blades varying in shape and size within fascicle, ranging 2���4 times longer than maximum width, with a distal recurved tip, fine spinulation on cutting edge and 1���3 thin spines on outer distal margin (Figs 9 J���L, 10 E���G). Pygidium. Pygidium sub-terminal, with a mid-ventral digitiform anal cirrus (Fig. 9 A). Internal features. Eyes not seen in holotype, but a pair observed in other specimens, in first chaetiger. Muscular pharynx not observed. Reproductive features. Gender of holotype unknown, gametes or ���copulatory organs��� not observed. Females with a porous tubercle-like structure ventral to parapodia of chaetiger 6 and modified ventral cirri present in chaetigers 4���7 (Fig. 9 D���F), with a swollen base with pores scattered over the surface and a distal knob (Figs 4 J, 9 G���H). Few oblong eggs measuring 200 ��m in length were observed in two specimens. Male (NMV F. 132899) with modified ventral cirri present in chaetigers 5���8, with a swollen and porous base and a distal knob, similar in morphology to those found in the females (Fig. 4 L), and sperm packages distributed along the coelom. Variation. Specimens measuring 0.8���3.1 mm long and 0.1���0.6 mm wide, with 11���27 chaetigers. One preserved specimen (NTM W. 10206) showed red dots of pigment over parapodia; pigmentation not conspicuous in other specimens. Prostomial appendages digitiform in relaxed specimens, blunt and wide at basis in specimens where anterior end is contracted. Macrotubercles increasing in number from first to mid-body chaetigers. Transversal rows of tubercles are indistinct in contracted specimens and macrotubercles seem arranged randomly. The number of macrotubercles in each transversal row seems to be dependent on size of specimen, small specimens with 8���10 + 9���12 macrotubercles (Figs 4 K, 10 A���B), and 10���12 + 12���14 in larger specimens (Figs 4 I, 9 A), and the size of tubercles, also seem larger in small specimens (e.g. Figs 4 K, 10 A). A couple of specimens showed atypical tubercles, with a distal swelling (Fig. 10 B), considered herein as an artefact. The number and size of ventral tubercles and papillae show some variation and in some specimens three pairs of longitudinal rows have been observed (Fig. 4 L). Number and morphology of chaetae similar in all specimens examined. Some variation in the size and morphology of chaetae was observed among specimens. Larger individuals seem to bear more slender and similar blades within and across chaetigers (e.g. Fig. 9 J���L) while smaller specimens presented a wider range in sizes of blades and included shorter and wider ones (Fig. 10 G). Nevertheless, in all cases chaetae presented shafts distally provided with long spines and spines also in the distal outer edge of the blades. Remarks. The specimens studied mostly agree with the original description (Hartmann-Schr��der 1979). The original description is not accurate on details regarding prostomial appendages, variability in size and arrangement on epithelial tubercles and chaetal morphology. Nevertheless, the original description is in line with what can be confirmed here from observations in the holotype, and from additional material. This species belongs in Group 3 (sensu Borowski 1994), gathering species with more than four longitudinal rows and two transversal rows of macrotubercles per segment. Sphaerodoropsis fauchaldi is unique among other congeners in having a larger number of longitudinal rows of macrotubercles and large tubercles on the ventral side. Sphaerodoropsis megatuberculata n. sp. have as many longitudinal rows of macrotubercles as observed in smaller specimens of S. fauchaldi, but S. megatuberculata n. sp. has large ellipsoid to cylindrical macrotubercles and lack the characteristic large ventral tubercles. Only two other Sphaerodoropsis species have conclusively been reported to have presence of macrotubercles on the ventral side, S. malayana Augener, 1933, S. solis Reuscher and Fiege, 2011, but only the latter belong to Group 3 (S. malayana has four longitudinal rows of macrotubercles on the dorsum). Sphaerodoropsis solis has up to 13 (6 + 7) longitudinal rows of macrotubercles while S. fauchaldi has up to 26 (12 + 14) longitudinal rows of macrotubercles. Of species currently accepted in Sphaerodoropsis only S. spissum Benham, 1921 possesses a number of macrotubercles within the range described for S. fauchaldi. The original description of S. spissum does not describe enough details to compare necessary characters, and it seems to lack the ventral macrotubercles. It has not been possible to trace type specimens of S. spissum (see comments on S. spissum below). Originally described from the northern part of Western Australia this species was also reported from New South Wales in a later survey (Hartmann-Schr��der 1989). Despite the wide geographic distribution (Fig. 15) representing different environments from the tropical north to the temperate south-east it has not been possible to observe conclusive morphological differences on specimens from Western Australia, Northern Territory, New South Wales and Victoria in this study, confirming earlier records and the observed variability in number of macrotubercles, and other morphological traits, is here considered to be related to size of specimens. Pending more available specimens of different size classes or specimens collected from more localities should reveal if the species is broadly distributed along the East Australian coastline or if the disjunct populations truly represent distinct species. Habitat. In coarse sand, rocks or as epibionts of algae and Bryozoa; from 3 to 45 m. Type locality. Port Hedland, Western Australia (Fig. 15). Distribution Western Australia, Northern Territory, New South Wales and Victoria, Australia (Fig. 15)., Published as part of Capa, Maria & Bakken, Torkild, 2015, Revision of the Australian Sphaerodoridae (Annelida) including the description of four new species, pp. 227-267 in Zootaxa 4000 (2) on pages 247-251, DOI: 10.11646/zootaxa.4000.2.3, http://zenodo.org/record/234762, {"references":["Hartmann-Schroder, G. (1979) Zur Kenntnis des Eulitorals der australischen Kusten unter besonderer Berucksichtigung der Polychaeten und Ostracoden. Teil 2. Die Polychaeten der tropischen Nordwestkuste Australiens (zwischen Derby im Norden und Port Hedland im Suden). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 76, 75 - 218.","Borowski, C. (1994) Three new deep-sea species of Sphaerodoridae (Annelida, Polychaeta) from the eastern tropical South Pacific. Zoologica Scripta, 23, 193 - 203. http: // dx. doi. org / 10.1111 / j. 1463 - 6409.1994. tb 00384. x","Augener, H. (1933) Polychaeten aus den zoologischen Museen von Leiden und Amsterdam. Zoologische Mededeelingen, Leiden, 15, 177 - 260.","Reuscher, M. & Fiege, D. (2011) Sphaerodoridae (Annelida: Polychaeta) from the deep south-west Pacific, with the description of a new species of Sphaerodoropsis. Journal of the Marine Biological Association of the United Kingdom, 91, 439 - 445. http: // dx. doi. org / 10.1017 / S 0025315410000469","Benham, W. B. (1921) Polychaeta. Scientific Reports Australasian Antarctic Expedition 1911 - 1914, Series C, 6, 1 - 128. http: // dx. doi. org / 10.5962 / bhl. title. 31708","Hartmann-Schroder, G. (1989) Zur kenntnis des Eulitorals der australischen Kusten unter besonderer Berucksichtigung der Polychaeten und Ostracoden. Teil 14. Die Polychaeten der antiborealen und subtropisch-tropischen Kuste Sudost- Australiens zwischen Lakes Entrance (Victoria) im Suden und Maclean (New South Wales) im Norden. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 86, 11 - 63."]}

Sphaerodoropsis aurantica n. sp. (Figs 2 C, D, 3) Sphaerodoropsis sp A.��� Helm & Capa, 2015. Type material. Holotype: AM W. 44209, MI QLD 2380, on SEM stub. Paratype: AM W. 44210, MI QLD 2380, posterior end used for DNA sequencing. Other material examined. AM W. 44218, MI QLD 2390, live photo, further used for confocal microscopy, Helm & Capa 2015; AM W. 44220, MI QLD 2387, used for confocal microscopy, Helm & Capa 2015. Diagnosis. Body ellipsoid, with strongly convex dorsum. Nine longitudinal rows of sessile and spherical dorsal macrotubercles, arranged in a single transverse row per segment row and four transverse rows (with up to 38) of spherical papillae per segment. Parapodia with digitiform acicular lobe, shorter ventral cirrus and around 10 spherical papillae. Over 10 compound chaetae per parapodium with thin shafts, long blades (6���8 times longer than its maximum width), with fine and short spinulation along superior edge and a distal recurved tip. Description. Holotype 1.8 mm long after fixation, 0.6 mm maximum width; with 20 chaetigers. Body ellipsoid (Fig. 3 A���B); with convex dorsum and flattened ventrum. Tegument with transverse wrinkles, segmentation inconspicuous (Fig. 3 A���B). Head externally indistinct (Fig. 3 A���C). Anterior end bluntly rounded (Fig. 3 B���C). Prostomium with five appendages, including a pair of palps, in ventral most position, sub-conical and slightly wrinkled; a pair of lateral antennae, similar in shape and size to palps; and a median antenna, shorter (two thirds) and wider than lateral antennae and with a rounded distal end (Fig. 3 B���C). Antenniform papillae cannot be unequivocally recognised (Fig. 3 C). Around 30 digitiform small papillae confined by prostomial appendages and mouth in frontal view (Fig. 3 C). A pair of tentacular cirri, similar in shape and size to lateral antennae and palps, and several scattered papillae similar to prostomial. Macrotubercles, sessile, rounded or provided with an incipient rounded terminal papillae (Fig. 3 B, G���H), arranged in longitudinal rows along dorsum, and single transversal rows per segment. First and following chaetigers with nine macrotubercles, decreasing to eight in posterior chaetigers. Macrotubercles with two different sizes, following pattern in Fig. 2 C; provided with pores arranged on groups (Fig. 3 G���H), some of them with incipient terminal papillae or at least pear-shaped (Fig. 3 H). Spherical papillae over dorsum, arranged in four transverse rows per segment; digitiform in anterior-most chaetigers and spherical in following (Fig. 3 C���D). Ventral surface with similar spherical papillae, arranged in about 5���6 irregular transverse rows, with a total of around 50 papillae per segment, in mid-body (Fig. 3 B). Parapodia sub-conical, increasing in size towards chaetiger 5 and around 1���2 times longer than wide, wrinkled (Fig. 3 C���D). Acicular lobe anterior to chaetal fascicle, projecting distally (Fig. 3 D���E, J). Ventral cirri sub-conical to pear-shaped, shorter than acicular lobe (Fig. 3 D���E, J). Mid-body parapodia with around 10 small spherical papillae, slightly different in size: one or two on dorsal surface, three on anterior surface, three on ventral surface and three on posterior surface (Fig. 2 D). Compound chaetae present in all chaetigers, arranged in a curved transverse fascicle around acicular lobe and numbering 10���22 per parapodium. Shaft with similar width all along, slightly widened distal end with delicate almost inconspicuous spinulation. Blades similar in length within fascicles (6���8 times longer than its maximum width), with fine and short spinulation along superior edge and a distal recurved tip (Fig. 3 J���L). Pygidium terminal, with mid-ventral digitiform anal cirrus and a pair of dorsal anal cirri, similar in shape to macrotubercles (Fig. 3 F). Mouth located ventrally near base of palps (Fig. 3 C). Gut visible by transparency with muscular pharynx occupying about four segments. Eyes and copulatory organs or gametes not seen. Colour pattern. Live specimens white, with a bright orange transverse band on dorsum of chaetigers 12���13. Lateral most and dorsal most macrotubercles of all except for anterior and posterior two chaetigers also partially pigmented (Fig. 3 A). Colour lost in preserved material. Variation. Paratype with 21 chaetigers. Number of epithelial tubercles and papillae matches those described in holotype. Parapodia of mid-body chaetigers with higher number of chaeate and papillae, within the range described in holotype. Pigmentation pattern varied slightly among described specimens and the orange band was more or less evident in some specimens, and within chaetigers 10���13 but the dorsolateral macrotubercles, were in all cases partially bright orange. Copulatory organs or gametes not observed in any specimen. COI Barcode (Paratype, AM W. 44210). AAAATCAAAACAAATGTTGAAATAAAATAGGATCTCCTCCTCCTGCCGGATCAAAAAACCTAGTATTT AGATTACGATCAGTTAATAATATAGTAATTACACCTGCCAATACAGGCAAAGCTAATAATAATAAAATAG CTGTAATCAATACAGATCAAGTAAATAAAGGAATACGCTTAAACTTCATACCCACTACATGATCAAATA TAATAGTAACAATAAAATTAATAGCACCTAAAATAGAAGAAACACCAGCTATATGTAATGAAAAAATAG CTATATCAACAGAAGGCCCCGAATGAGTTATATTACTTGATAAAGGAGGATAAACTGTTCATCCTGTAC CAGCACCTTTCTCTACTAATGTAGATCCCAATAATAATATTAAAGAAGGAGGCAAAAATCAAAACCTTA TATTATTTAATCGAGGAAAAGCTATATCAATAGCACCTAACATTAAAGGAACTAATCAATTACCAAAAC CACCCATTATAACTGGTATTACAAGAAAAAAAATTATTAAAAAAGCATGACCAGTAACAATAGTATTAT ATAATTGATCTCTACCTAATAAACTACCTGGTTGACCTAATTCAGCACGAATCAACAAACTTATAGATGT ACCTAAAAATCCAGATCATATACCAAAAATAAAATACAAAGTACCAATATCTT Remarks. Even though some macrotubercles were observed with distal papillae, this is not a constant attribute of all tubercles or present in all specimens of Sphaerodoropsis aurantica n. sp. examined and may be an artefact due to the collapse of some of these structures. Nevertheless, and as indicated previously (Capa et al. 2015; Capa & Bakken 2015), distinguishing Sphaerephesia and Sphaerodoropsis is confusing at present because there are species within each genus presenting pear-shaped macrotubercles that lack terminal papillae. This species would belong within the Group 2 proposed by Borowski (1994), together with other Sphaerodoropsis species with more than four longitudinal rows of macrotubercles arranged in a single transverse row per segment. There are nine other species in the group (Borowski 1994; Aguirrezabalaga & Cebeiro 2005; Moreira & Parapar 2011), considering that S. minuta (Webster & Benedict, 1887) and S. polypapillata Hartmann-Schr��der & Rosenfeldt, 1988, have recently been synonymised with other genera (Moreira & Parapar 2011; Capa et al. 2015). Species distinguished from S. aurantica n. sp. due to the lower (S. amoreuxi Aguirrezabalaga & Cebeiro, 2005, S. benguellarum (Day, 1963), S. octopapillata (Hartmann-Schr��der, 1965), S. sphaerulifer (Moore, 1909) and S. uzintunensis Kudenov, 1987. Of the remaining species, S. aestuarum Averincev, 1990 is distinguished from S. auranticus n. sp. because it has two transverse rows of additional papillae per segment in addition to the 8���10 macrotubercles and compound chaetae with blades around three times longer than wide; S. balticum (Reimers, 1933) also has two transverse rows of papillae per segment in addition to the 7���9 rows of macrotubercles and short chaetal blades (less than twice as long as wide); S. gudmunduri Moreira & Parapar 2012, lacks dorsal papillae among the nine macrotubercles and has short chaetal blades (around three times longer than wide); and S. katchemakensis Kudenov, 1987 bears two transverse rows of papillae in addition to the 8���9 macrotubercles and chaetae with blades ranging 3���4 times as long as wide (Reimers 1933; Hartmann-Schr��der 1996; Kudenov 1987 a; Moreira & Parapar 2012). Sphaerephesia gesae Moreira & Parapar, 2011 is the only species in that genus with more than four longitudinal rows of macrotubercles (Moreira & Parapar 2011; Alalykina 2015). It can be distinguished from S. aurantica n. sp. by the presence of two transverse rows of macrotubercles per segment, instead of only one found in the new species and the chaetal morphology with short blades (maximum twice as long and wide) in comparison to those described in S. aurantica n. sp. Etymology. The species name refers to the bright orange pigmentation (orange in Latin= auranticus) present in mid body tubercles. Distribution. Species only known from type locality., Published as part of Capa, Mar��a & Rouse, Greg W., 2015, Sphaerodoridae (Annelida) from Lizard Island, Great Barrier Reef, Australia, including the description of two new species and reproductive notes, pp. 168-183 in Zootaxa 4019 (1) on pages 173-176, DOI: 10.11646/zootaxa.4019.1.9, http://zenodo.org/record/232849, {"references":["Helm, C. & Capa, M. (2015) Comparative analyses of morphological characters in Sphaerodoridae and allies (Annelida) revealed by an integrative microscopical approach. Frontiers in Marine Science, 1, 82. http: // dx. doi. org / 10.3389 / fmars. 2014.00082","Borowski, C. (1994) Three new deep-sea species of Sphaerodoridae (Annelida, Polychaeta) from the eastern tropical South Pacific. Zoologica Scripta, 3, 193 - 203. http: // dx. doi. org / 10.1111 / j. 1463 - 6409.1994. tb 00384. x","Aguirrezabalaga, F. & Ceberio, A. (2005) Sphaerodoropsis amoureuxi and S. stellifer, two new species of Sphaerodoridae (Polychaeta) from the Capbreton Canyon (Bay of Biscay, NE Atlantic). Cahiers de Biologie Marine, 46, 9 - 20. http: // dx. doi. org / 10.1080 / 17451000500262066","Webster, H. E. & Benedict, J. E. (1887) The Annelida Chaetopoda, from Eastport, Maine. Annual Report of the United States Commission of Fish and Fisheries, Washington, 1885, 707 - 758.","Hartmann-Schroder, G. & Rosenfeldt, P. (1988) Die Polychaeten der \" Polarstern \" - Reise ANT III / 2 in die Antarktis 1984. Teil 1: Euphrosinidae bis Chaetopteridae. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 85, 25 - 72.","Day, J. H. (1963) The Polychaete fauna of South Africa. Part 8: New species and records from grab samples and dredgings. Bulletin of the British Museum (Natural History), Series Zoology, 10 (7), 383 - 445.","Hartmann-Schroder, G. (1965) Zur Kenntnis des Sublitorals der chilenischen Kuste unter besonderer Berucksichtigung der Polychaeten und Ostracoden. (Mit bemerkungen uber den Einfluss sauerstoffarmer Stromungen auf die Besiedlung von marien Sedimenten.). Die Polychaeten des Sublitorals. Mitteilungen aus dem Hamburgischen zoologischen Museum und Institut, 62, 59 - 305.","Moore, J. P. (1909) The polychaetous annelids dredged by the U. S. S. Albatross of the coast of southern California in 1904. I: Syllidae. Sphaerodoridae. Hesionidae and Phyllodocidae. Proceedings of the Academy of Natural Science of Philadelphia, 61, 321 - 351.","Averincev, V. G. (1990) [The polychaete fauna of the Laptev Sea]. Issledovaniya Fauny Morei, 37, 147 - 186. [in Russian]","Reimers, H. (1933) Morphologie der Polychaetengattung Sphaerodorum. Monographie. Zoologische Jahrbucher, Abteilung fur Systematik, Okologie und Geographie der Tiere, 64, 41 - 110.","Moreira, J. & Parapar, J. (2012) Two new species of Sphaerodoropsis Hartman & Fauchald, 1971 (Polychaeta: Sphaerodoridae) from Iceland (BIOICE programme). Marine Biology Research, 8, 584 - 593. http: // dx. doi. org / 10.1080 / 17451000.2011.638929","Hartmann-Schroder, G. (1996) Annelida, Borstenwurmer, Polychaeta. Die Tierwelt Deutschlands und der angrenzenden Meeresteile. 58. Teil (2. ed.). In: Dahl F. & Schumann H. (Eds.), Gustav Fischer Verlag, Jena, pp. 1 - 648.","Kudenov, J. D. (1987 a) Four species of Sphaerodoridae (Annelida: Polychaeta) including one new genus and three new species from Alaska. Proceedings of the Biological Society of Washington, 100, 917 - 926.","Alalykina, I. L. (2015) Polychaete composition from the abyssal plain adjacent to the Kuril-Kamchatka trench with the description of a new species of Sphaerephesia (Polychaeta: Sphaerodoridae). Deep-Sea Research II, 111, 166 - 174"]}

Genus Sphaerodoropsis Hartman & Fauchald, 1971 Type-species. Sphaerodorum sphaerulifer Moore, 1909 Diagnosis. Body generally short and ellipsoid, some forms slender. Four or more dorsal longitudinal rows of macrotubercles, in one or several transverse rows per segment. Macrotubercles sessile and smooth, without terminal papillae. Microtubercles absent. Papillae over body surface and parapodia. Head appendages short, spherical or digitiform. Parapodia with compound chaetae; hooks absent., Published as part of Capa, Mar��a & Rouse, Greg W., 2015, Sphaerodoridae (Annelida) from Lizard Island, Great Barrier Reef, Australia, including the description of two new species and reproductive notes, pp. 168-183 in Zootaxa 4019 (1) on page 172, DOI: 10.11646/zootaxa.4019.1.9, http://zenodo.org/record/232849, {"references":["Hartman, O. & Fauchald, K. (1971) Deep-water benthic polychaetous annelids off New England to Bermuda and other North Atlantic Areas. Part II. Allan Hancock Monographs in Marine Biology, 6, 1 - 327.","Moore, J. P. (1909) The polychaetous annelids dredged by the U. S. S. Albatross of the coast of southern California in 1904. I: Syllidae. Sphaerodoridae. Hesionidae and Phyllodocidae. Proceedings of the Academy of Natural Science of Philadelphia, 61, 321 - 351."]}

Genus Sphaerodoropsis Hartman and Fauchald, 1971 Type species. Sphaerodorum sphaerulifer Moore, 1909. Diagnosis. Body generally short and ovoid, some forms slender. Four or more longitudinal rows of macrotubercles, in one or several transversal rows per segment. Macrotubercles sessile and smooth, without terminal papillae. Microtubercles absent. Papillae over body surface and parapodia. Head appendages short, spherical or digitiform. Parapodia with compound chaetae; hooks absent., Published as part of Capa, Maria & Bakken, Torkild, 2015, Revision of the Australian Sphaerodoridae (Annelida) including the description of four new species, pp. 227-267 in Zootaxa 4000 (2) on page 244, DOI: 10.11646/zootaxa.4000.2.3, http://zenodo.org/record/234762, {"references":["Hartman, O. & Fauchald, K. (1971) Deep-water benthic polychaetous annelids off New England to Bermuda and other North Atlantic Areas. Part II. Allan Hancock Monographs in Marine Biology, 6, 1 - 327.","Moore, J. P. (1909) The polychaetous annelids dredged by the U. S. S: \" Albatross \" off the coast of southern California in 1904. I. Syllidae, Sphaerodoridae, Hesionidae and Phyllodocidae. Proceedings of the Academy of Natural Sciences of Philadelphia, 61, 321 - 351."]}

Sphaerodoropsis exmouthensis Hartmann-Schr��der, 1981 Figs 1 D���I, 4 G���H, 5 G, 8 Sphaerodoropsis exmouthensis Hartmann-Schr��der, 1981: 44, Figs 94���99; 1984: 31; 1986: 51. Material examined. Holotype ZMH P. 16493: Western Australia, Exmouth, Tantabiggy Creek, in sand on the reef plateau, 11 Oct. 1975. Paratype MZH P. 16494 (1 spec.) same sample. Additional material. ZMH P. 16995 (1 spec. for SEM), Drummonds core, Geraldton, Western Australia, Australia; in fine sand with seagrass, 22 Oct 1975. Diagnosis. Ellipsoid body with strongly convex dorsum. Four longitudinal rows of sessile and spherical (sometimes pear-shaped) dorsal macrotubercles and three transversal rows (total up to 11) of dorsal spherical papillae per segment. Distance between dorsal-most macrotubercles exceeding distance between those and lateral ones. Parapodia with long digitiform acicular lobe, shorter ventral cirrus and a single rounded papilla on anterior distal end. Four or five chaetae per parapodium, with thin shafts slightly enlarged distally and lacking spinulation, and short blades (5���7 times longer than wide), serrated and with smooth distal end. Males with ���copulatory organ��� as conical papillae ventral to ventral cirri between chaetiger 6 and 7. Re-description. Measurements and general morphology. Male, body ellipsoid, measuring 1.3 mm long and 0.42 mm wide, with 19 chaetigers. Tegument with transverse wrinkles, segmentation inconspicuous. Dorsum convex and ventrum flattened. Preserved specimen lacking pigmentation. Head. Anterior end bluntly rounded. Prostomium with five longer appendages, including a pair of digitiform palps, in ventral-most position; a pair of lateral antennae similar in size and shape to palps; and a median antenna, ellipsoid, about one half of the size of lateral antennae (Figs 1 D���E, 8 A���B). Antenniform papillae absent (Figs 1 D��� E, 8 A���B). Up to 10 spherical papillae confined by prostomial appendages and the mouth (Figs 1 D���E, 8 A���B). A pair of tentacular cirri similar in shape and size to median antenna and palps and several scattered papillae similar to prostomial (Fig. 8 A���B). Tubercles. First chaetiger with two macrotubercles, slightly smaller than following, spherical and sessile (Figs 1 D, 8 A). Rest of chaetigers with four macrotubercles each, arranged in four longitudinal rows along dorsum (Figs 1 F, 4 G, 8 A). Distance between mid-dorsal rows is similar or slightly larger than between these and lateral macrotubercles (Figs 1 A, 4 G). Lateral macrotubercles are slightly smaller than dorsal (Figs 1 F, 8 A). Spherical papillae are present over dorsum, arranged in three transversal rows per segment (Figs 4 G, 8 A). Around 6���8 papillae between mid-macrotubercles and around 2���3 between these and the lateral ones in mid-segments, papillae closer to macrotubercles slightly larger than the rest (Figs 4 G, 8 A, D). None to two papillae between lateral macrotubercles and parapodia (Fig. 8 D). Ventral surface with spherical papillae, arranged in 2���3 transversal rows, with a total of 9���13 papillae in mid-body segments; numbers decreasing towards posterior end (Figs 1 G, 4 H), with a group of three near the base of parapodia and a midline group of 5���7 papillae, being the anterior larger. Body epithelium with ellipsoid granules. Parapodia. Parapodia sub-conical, about 1���2 times longer than wide. First chaetiger with a long (as long as parapodia), digitiform acicular lobe projecting distally; ventral cirri shorter and wider (Fig. 8 D), parapodial papillae absent. Second and following chaetigers similar or with longer acicular lobes, and one dorso-anterior spherical papillae (Figs 5 G, 8 C). Chaetae. Compound chaetae present in all chaetigers, arranged in a curved transverse row around acicular lobe, numbering 3���5 per fascicle (Figs 5 G, 8 C���D). Shaft with slightly widened distal end and delicate, almost inconspicuous, spinulation. Blades similar in length along fascicles (5���7 times longer than maximum width), with fine and short spinulation along superior edge and a distal recurved tip (Figs 1 H, 8 E���G). Pygidium. Pygidium terminal, with distal dorsal spherical papillae, a mid-ventral digitiform anal cirrus and a pair of pear-shaped dorsal anal cirri, slightly larger than macrotubercles (Figs 1 I, 8 H). Internal features. Eyes not observed, muscular pharynx inconspicuous. Reproductive features. Holotype, male, with ���copulatory organs��� as conical papillae ventral to ventral cirri between chaetiger 6 and 7 (Figs 1 G, 5 H). Females have not been examined herein but there is a record of a gravid female with 13 chaetigers (Hartmann-Schr��der 1981). Variation. Specimens measure 0.5���1.3 mm long and 0.25���0.42 mm width, in all cases body is about 4���5 times longer than wide. Paratype with eight chaetigers. Median antenna is in the three specimens examined shorter than lateral and no antenniform papillae have been observed in specimens examined. Prostomial papillae confined by antennae and mouth are less than 10. Macrotubercles are, in the specimen studied under SEM, not completely rounded and somehow pear-shaped (Fig. 8 C���D). Number of epithelial papillae, including parapodial with a single papilla in all except first chaetiger, and arrangement seem to be constant. Parapodia do not exceed twice the length of the width. Number of chaetae range between 4���5 per parapodium. Length of blades shows a slight variation in number of chaetae and the relative length of blades. Examined specimens are not transparent and muscular pharynx was not conspicuous. Eyes have not been observed. ���Copulatory organs��� only observed in holotype. Remarks. In the original description there were some details lacking and others that have been interpreted differently herein. The palps and lateral antennae (referred to as outer and inner antennae respectively in original description) were described as being shorter and oval and digitiform to filiform but are considered here to be similar in shape and size. The arrangement of epithelial papillae both on dorsal and ventral body surface seems not random (Fig. 8 A). Parapodia were described with a rounded papilla on superior margin that has here interpreted as anterior; chaetae were considered as smooth but fine dentation is observed under SEM. Pygidial macrotubercles as pear shaped (as drawn in original description, Hartmann-Schr��der 1981). Type loc al ity. Tantabiddy Creek, Exmouth, Western Australia (Fig. 15). Distribution. Western Australia (Exmouth and Geraldton; Fig. 15),?South Australia (Ceduna and Kangaroo Island) (Hartmann-Schr��der 1981, 1984, 1986). South Australian material needs confirmation; they could belong to Sphaerodoropsis wilsoni n. sp. described below. Habitat. Sand near reef plateau or sea-grasses, shallow depths., Published as part of Capa, Maria & Bakken, Torkild, 2015, Revision of the Australian Sphaerodoridae (Annelida) including the description of four new species, pp. 227-267 in Zootaxa 4000 (2) on pages 245-247, DOI: 10.11646/zootaxa.4000.2.3, http://zenodo.org/record/234762, {"references":["Hartmann-Schroder, G. (1981) Zur Kenntnis des Eulitorals der australischen Kusten unter besonderer Berucksichtigung der Polychaeten und Ostracoden. Teil 6. Die Polychaeten der tropisch-subtropischen Westkuste Australiens (zwischen Exmouth im Norden und Cervantes im Suden). Mitteilungen aus den Hamburgischen Zoologischen und Institut, 78, 19 - 96.","Hartmann-Schroder, G. (1984) Zur Kenntnis des Eulitorals der australischen Kusten unter besonderer Berucksichtigung der Polychaeten und Ostracoden. Teil 10. Die Polychaeten der antiborealen Sudkuste Australiens (zwischen Albany im Westen und Ceduna im Osten). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 81, 7 - 62.","Hartmann-Schroder, G. (1986) Zur Kenntnis des Eulitorals der australischen Kusten unter besonderer Berucksichtigung der Polychaeten und Ostracoden. Teil 12. Die Polychaeten der antiborealen Sudkuste Australiens (zwischen Wallaroo im Westen und Port MacDonnell im Osten). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 83, 31 - 70."]}

Sphaerodoropsis longofalcigera n. sp. Fig. 4 O���P, 5 J, 12 Material examined. Holotype: NMV F. 162479 off Pelsart Island, Geraldton, Western Australia, 29 �� 00' 06'' S, 113 �� 46 ' 15 '' E, 409 m, 0 1 Aug 2005. Paratypes: NMV F. 162484 (1 spec.), Abrolhos region, 28 �� 59 ' 15 '' S, 113 �� 45 ' 34 '' E, 388 m, 30 Jul 2005; NMV F. 162483 (1 spec.), Two Rocks region, north of Perth, Western Australia, 31 �� 39 ' 25 '' S, 114 �� 58 ' 31 '' E, 403 m, 0 4 Aug 2005. Comparative material. S. anae Aguado & Rouse, 2006, holotype, MNCN 16.01 / 10817; S. artabrensis Moreira & Parapar, 2007, holotype, MNCN 16.01 / 11043; Sphaerodorum biserialis Berkeley & Berkeley, 1944, holotype, NMNH 32867; S phaerodoropsis corrugata Hartmann & Fauchald, 1971, holotype, LACM-AHF POLY 950; S. discolis Borowski, 1994, paratypes, ZMH P. 21951, ZMH P. 21952; S. elegans Hartmann & Fauchald, 1971, holotype, LACM-AHF POLY 954, paratypes, LACM-AHF POLY 955; S. furca Fauchald, 1974, holotype, LACM- AHF POLY 951; S. laureci Desbruy��res, 1980, holotype, MNHN TYPE 1286; S. longianalpapilla B��ggemann, 2009, paratypes, ZMH P. 25538; S. longipalpa Hartmann & Fauchald, 1971, holotype, LACM-AHF POLY 948; S. longisetis Fauchald, 1972, holotype, LACM-AHF POLY 964; S. longopapillata Desbruy��res, 1980, holotype, MNHN TYPE 1283; S. protuberanca B��ggemann, 2009, holotype, ZMH P. 25557, paratypes, ZMH P. 25556; S. sibuetae Desbruy��res, 1980, holotype, MNHN TYPE 1284; S. triplicata Fauchald, 1974, holotype, LACM-AHF POLY 958, paratypes, LACM-AHF POLY 958; S. vittori Kudenov, 1987 a, holotype, NMNH 102792; Sphaerephesia longiseta Fauchald, 1972, holotype, LACM-AHF POLY 964. Diagnosis. Body cylindrical, slightly tapering posteriorly. Four longitudinal rows of sessile and hemispherical dorsal macrotubercles and four transversal rows of small spherical papillae per segment. Distance between dorsalmost macrotubercles exceeding distance between those and lateral ones. Parapodia with short and wide acicular lobe, thinner ventral cirrus and a single rounded papillae on anterior surface. Around 10 chaetae per parapodium, with thin shafts slightly enlarged distally and lacking spinulation, and blades ranging in length within fascicles (8��� 25 times longer than wide), finely serrated. Description. Measurements and general morphology. Body cylindrical, measuring 1.2 mm long and 0.3 mm wide, with 14 chaetigers. Tegument with some transverse wrinkles, segmentation inconspicuous (Fig. 12 A). Preserved specimen lacking pigmentation. Head. Anterior end bluntly rounded (Fig. 12 A���B). Prostomium with seven appendages, including a pair of digitiform palps, in ventral-most position; a pair of lateral antennae similar in size and shape to palps; and a rounded median antennae, about one half of the size of lateral antennae (Fig. 12 B). Antenniform papillae as long as median antenna but thinner (Fig. 12 B). A pair of tentacular cirri similar in shape and size to median antenna and palps (Fig. 12 B). Several small and hemispherical scattered papillae cover the head. Tubercles. First chaetiger with two macrotubercles, slightly smaller than following, hemispherical. Rest of chaetigers with four macrotubercles each, similar in shape and size, arranged in four longitudinal rows along dorsum; distance between mid-dorsal rows slightly larger than between these and lateral macrotubercles (Fig. 4 O). Spherical papillae are present over dorsum, arranged in four transversal rows per segment, total number difficult to assess. Ventral surface with spherical papillae, at least one ventral to each parapodium, but total number not possible to ascertain (Fig. 4 P). Parapodia. Parapodia sub-conical, about 2���3 times longer than wide (Fig. 12 C���E), with a wide and short acicular lobe and ventral cirri similar in length, but thinner; ventral cirri decrease length towards posterior chaetigers. One spherical parapodial papilla on anterior surface of parapodia (Figs 5 J, 12 D). Chaetae. Compound chaetae present in all chaetigers, arranged in a curved transverse row around acicular lobe, numbering around 10 per fascicle (Figs 5 J, 12 B���E). Shaft narrow with slightly widened distal end and inconspicuous spinulation (under compound microscope). Blades, thin and straight, of a wide range of lengths within same fascicle, ranging from eight to more than 25 times longer than wide (Fig. 12 C���E). Longer blades in mid fascicle, and shorter in dorsal and ventral positions. Pygidium. Pygidium terminal, with distal dorsal pear-shaped papillae and mid-ventral digitiform anal cirrus, slightly larger than posterior macrotubercles. Internal features. Eyes not observed. Muscular pharynx occupying chaetigers 2���7 (Fig. 12 A). Reproductive features. Holotype, female with about 10 eggs measuring 150 ��m, occupying the coelom, behind the muscular pharynx. Enlarged ventral cirri on chaetigers 4 and 5, may indicate the presence of ���copulatory organs���, but this should be confirmed. Variation. The three examined specimens are small, measuring between 0.8 and 1.2 mm long, 0.1 and 0.3 mm wide, and having around 14 chaetigers, gametes have only been observed in the holotype. Shape and relative size of head appendages similar in all specimens, but in one paratype antenniform papillae not conspicuous. No specimens were observed under SEM therefore the number and arrangement of the small epithelial papillae has not been possible to ascertain, but all specimens seem to bear dorsal papillae arranged in four transversal rows and at least one ventral papilla, near the base of parapodia, as described for holotype. The most obvious feature in this species is the maximum length of blades, reaching in all specimens up to 25 times its width. Remarks. Sphaerodoropsis longofalcigera n. sp. bears dorsal macrotubercles arranged in four longitudinal rows, in a single transversal row per segment, and therefore resembles other species in the artificial Group 1, proposed by Borowski (1994). Most of these species have falcigers with long blades (e.g. Aguado & Rouse 2006). But they are particularly long and thin in S. corrugata Hartman & Fauchald, 1971, S. discolis Borowski, 1994, S. elegans Hartman & Fauchald, 1971, S. longianalpapilla B��ggemann, 2009, S. longipalpa Hartman & Fauchald, 1971, S. triplicata Fauchald, 1974, together with the new species since they are up to 15 times longer than wide or longer (Table 1). The new species is the one with longest blades reaching in some chaetigers up to 25 times the length of the maximum width. The new species resembles Sphaerephesia longiseta Fauchald, 1972 in this attribute, the sphaerodorid with longest falcigers described to date measuring 20���30 times their maximum width. Nevertheless S. longiseta is characterised, as its congeners, by the presence of terminal papilla on macrotubercles (conspicuous in lateral rows in the holotype of this species). Sphaerodoropsis longofalcigera n. sp. shares with S. laureci Desbruy��res, 1980, S. protuberanca, S. sibuetae Desbruy��res, 1980 and S. triplicata the shape of dorsal macrotubercles, being hemispherical (not always described as such in original descriptions), while they are spherical or pear-shaped in the other species. Of these species, only S. protuberanca has similarly low number of parapodial papilla, more numerous in the other species (Fauchald 1974; Desbruy��res 1980). After the revision of type material some attributes not referred to in original descriptions have been compared here (Table 1). Several inconsistencies in the interpretation of some morphological traits with respect to the original descriptions have also been encountered, including shape of macrotubercles and number of parapodial papillae (Table 1), and other characters that will be dealt with in a further study (e.g. none of the specimens examined presented postchaetal lobes, unlike indicated in some descriptions (Fauchald 1974; B��ggemann 2009). Etymology. The name of the species is attributed to the long blade falcigers. Distribution. Central Western Australia. Habitat. Sediments around 400 m depth., Published as part of Capa, Maria & Bakken, Torkild, 2015, Revision of the Australian Sphaerodoridae (Annelida) including the description of four new species, pp. 227-267 in Zootaxa 4000 (2) on pages 254-256, DOI: 10.11646/zootaxa.4000.2.3, http://zenodo.org/record/234762, {"references":["Aguado, M. T. & Rouse, G. W. (2006) First record of Sphaerodoridae (Phyllodocida: Annelida) from hydrothermal vents. Zootaxa, 1383, 1 - 21.","Moreira, J. & Parapar, J. (2007) Sphaerodoridae (Annelida: Polychaeta) from the DIVA-Artabria I project (2002 cruise) with description of a new species from the Artabro Gulf (NW Iberian Peninsula). Cahiers de Biologie Marine, 48, 373 - 379.","Berkeley, E. & Berkeley, C. (1944) Polychaeta from the western Canadian arctic region. Canadian Journal of Research, Section D, 22, 1 - 5. http: // dx. doi. org / 10.1139 / cjr 44 d- 001","Hartman, O. & Fauchald, K. (1971) Deep-water benthic polychaetous annelids off New England to Bermuda and other North Atlantic Areas. Part II. Allan Hancock Monographs in Marine Biology, 6, 1 - 327.","Borowski, C. (1994) Three new deep-sea species of Sphaerodoridae (Annelida, Polychaeta) from the eastern tropical South Pacific. Zoologica Scripta, 23, 193 - 203. http: // dx. doi. org / 10.1111 / j. 1463 - 6409.1994. tb 00384. x","Fauchald, K. (1974) Sphaerodoridae (Polychaeta: Errantia) from world wide areas. Journal of Natural History, 8, 257 - 289. http: // dx. doi. org / 10.1080 / 00222937400770241","Desbruyeres, D. (1980) Sphaerodoridae (Annelides Polychetes) profonds du Nord-Est Atlantique. Bulletin du Museum d'Histoire Naturelle, 1, 109 - 128. [Paris]","Boggemann, M. (2009) Polychaetes (Annelida) of the abyssal SE Atlantic. Organisms Diversity & Evolution, 9, 251 - 428.","Fauchald, K. (1972) Benthic polychaetous annelids from deep water off Western Mexico and adjacent areas in the Eastern Pacific Ocean. Allan Hancock Monographs in Marine Biology, 7, 1 - 575.","Kudenov, J. D. (1987 a) Five New Species of Sphaerodoridae (Annelida: Polychaeta) from the Gulf of Mexico. Proceedings of the Biological Society of Washington, 100, 927 - 935."]}

Genus Sphaerodoropsis Hartmann & Fauchald, 1971 Sphaerodoropsis baltica (Reimers, 1933) DISTRIBUTION: CA, SA. LITERATURE RECORDS: Katzmann 1973 a, 1983; Požar-Domac 1983, 1994; Castelli et al. 2008. OTHER REPORTED NAMES: Sphaerodoridium balticum (Reimers, 1933). * (E) Sphaerodoropsis longiparapodium (Katzmann, 1973) DISTRIBUTION: CA. LITERATURE RECORDS: Katzmann 1973 a; 1973 c, 1983; Amoureux 1983 b; Požar-Domac 1994; Castelli et al. 2008. OTHER REPORTED NAMES: Sphaerodoridium longiparapodium Katzmann, 1973. Sphaerodoropsis minuta (Webster & Benedict, 1887) DISTRIBUTION: NA, CA. LITERATURE RECORDS: Zavodnik 1967 b; Katzmann 1973 a, 1983; Požar-Domac 1994; Castelli et al. 2008. OTHER REPORTED NAMES: Sphaerodoridium minutum (Webster & Benedict, 1887); Sphaerodorum minutum (Webster & Benedict, 1887). Sphaerodoropsis philippi (Fauvel, 1911) DISTRIBUTION: CA. LITERATURE RECORDS: Katzmann 1973 a, 1983; Požar-Domac 1994; Castelli et al. 2008. OTHER REPORTED NAMES: Sphaerodoridium philippi (Fauvel, 1911). Sphaerodoropsis sphaerulifer (Moore, 1909) DISTRIBUTION: CA. LITERATURE RECORDS: Cantone & Di Pietro 2002; Castelli et al. 2008., Published as part of Mikac, Barbara, 2015, A sea of worms: polychaete checklist of the Adriatic Sea, pp. 1-172 in Zootaxa 3943 (1) on pages 115-116, DOI: 10.11646/zootaxa.3943.1.1, http://zenodo.org/record/244663, {"references":["Katzmann, W. (1973 a) Contributo alla conoscenza dei policheti del Mare Adriatico (Medio Adriatico - Fondi mobili tra 10 e 230 metri di profondita). Quaderni del Laboratorio di Technologia della Pesca, 1 (5), 143 - 155.","Katzmann, W. (1983) Bemerkungen zur Systematik, Okologie und Tiergeographie der mitteladriatischen Weichbodenpolychaeten. Annalen des Naturhistorichen Museums in Wien, 84 / B, 87 - 122.","Pozar-Domac, A. (1983) Polychaeta u bentoskim biocenozama juznog Jadrana. Studia Marina, 13 - 14, 292 - 311.","Pozar-Domac, A. (1994) Index of the Adriatic Sea Polychaetes (Annelida, Polychaeta). Natura Croatica, 3, (Supplement 1), 1 - 23.","Castelli, A., Bianchi, C. N., Cantone, G., Cinar, M. E., Gambi, M. C., Giangrande, A., Iraci Sareri, D., Lanera, P., Licciano, M., Musco, L. & Sanfilippo, R. (2008) Annelida Polychaeta. In: Relini, G. (Ed), Checklist della flora e della fauna dei mari italiani (Parte I). Biologia Marina Mediterranea, 15 (Supplement 1), pp. 327 - 377.","Katzmann, W. (1973 c) Zwei neue Sphaerodoridae (Polychaeta / Meiofauna) aus der Adria. Annalen des Naturhistorichen Museums in Wien, 77, 283 - 286.","Amoureux, L. (1983 b) Les Annelides Polychetes de la Mer Adriatique. Thalassia Jugoslavica, 19, 7 - 13.","Zavodnik, D. (1967 b) Dinamika litoralnega fitala na zahodnoistrski obali. Razprave, Slovenska Akademija Znanosti in Umetnosti, 10, 5 - 71.","Cantone, G. & Di Pietro, N. (2002) Policheti bentonici della Fossa di Pomo (Medio Adriatico). Biologia Marina Mediterranea, 9 (1), 494 - 500."]}

Sphaerodoropsis anae n. sp. is described from sediments near active hydrothermal vents along the northern part of the Pacific Antarctic ridge, adjacent to the Easter Microplate. Two distinct features principally characterize Sphaerodoropsis anae n. sp., the presence of a well-developed proventricle, quite similar to the proventricle found in Syllidae, and bi-dentate compound chaetae with spinulation. It is also characterized by the presence of four macrotubercles per transverse row, with the lateral ones pear-shaped and the median macrotubercles spherical and smaller. Types of other Sphaerodoropsis species were examined and Sphaerodoropsis biserialis (Berkeley & Berkeley, 1944) also has compound chaetae with spinulation. This feature was not previously described in this species. Some comments about the current systematics of Sphaerodoropsis and Sphaerodoridae are made, as well as a discussion of the proventricle.

A new species of sphaerodorid (Polychaeta: Sphaerodoridae), Sphaerodoropsisgarciaalvarezi sp. nov., is described from specimens collected on sandy bottoms off the Galician coast (Spain, north-east Atlantic). This species is characterized by having two pairs of digitiform lateral antennae, 13 dorsal macrotubercles per segment in mid-body setigers arranged in two transverse rows, five dorsal microtubercles per segment arranged in five longitudinal rows, six ventral papillae per segment arranged in six longitudinal rows, digitiform presetal lobes and ventral cirri, and composite setae with spinulation on blade and distal end of shaft. Complementary observations to original descriptions are also provided for closely related species Sphaerodoropsis bisphaeroserialis and Sphaerodoropsisarctowskyensis upon examination of type series.

Two new species of Sphaerodoropsis Hartman & Fauchald, 1971 (Polychaeta: Sphaerodoridae), collected during the BIOICE programme on sedimentary bottoms off Iceland, are described. Sphaerodoropsis gudmunduri sp. nov. is a shelf species (1000 m) and may be distinguished mostly by having up to 13 dorsal macrotubercles arranged in two transverse rows (6–7 macrotubercles, respectively) defining a zig-zag pattern (‘group 3’) and 7 dorsal papillae per chaetiger, up to 8–10 ventral papillae per chaetiger arranged in a non-random pattern and parapodia which bear one digitiform prechaetal lobe, one antero-lateral papilla and compound unidentate chaetae with blades with thin spinulation along their cutting edge. Both species show sexual dimorphism characterized by different arrangements of modified ventral cirri and/or special ventral structures in some mid-body chaetigers; a brief discussion about the presence of these structures on sphaerodorids and their possible importance on the systematics of the family is provided.

The examination of polychaete collections obtained during the Spanish Bentart 2006expedition to the Bellingshausen Sea (Antarctica) revealed the presence of several sphaerodorid species. In this work, species belonging to the genera Sphaerodorum Örsted, 1843, Ephesiella Chamberlin, 1919, Clavodorum Hartman and Fauchald, 1971 and Sphaerephesia Fauchald, 1972 are reported including two new species belonging to Sphaerodorum and Sphaerephesia, respectively. A specimen identified as Ephesiella sp. might also represent a new species but, due to its poor state of preservation, a formal description is not possible yet. Furthermore, Sphaerodoropsis polypapillata Hartmann-Schröder and Rosenfeldt, 1988 is transferred to the genus Clavodorum Hartman and Fauchald, 1971 after examination of the type series and specimens obtained from the Bellingshausen Sea. Comisión Interministerial de Ciencia y Tecnología; REN 2001-1074/ANT Comisión Interministerial de Ciencia y Tecnología; CGL2004-01856

Sphaerodorids are scarce at Lizard Island archipelago and other localities in the Great Barrier Reef, Australia. Intensive collections at a variety of habitats within the Lizard Island archipelago over the last four decades have resulted in a total of just 11 specimens. Nevertheless, they represent two new species and a new record for Lizard Island. Sphaerodoropsis aurantica n. sp. is characterised by nine longitudinal rows of sessile and spherical dorsal macrotubercles, arranged in a single transverse row per segment; parapodia with around 10 spherical papillae; and compound chaetae with thin shafts and long blades. Sphaerodoropsis plurituberculata n. sp. is characterised by more than 12 more or less clearly arranged longitudinal rows of sessile spherical dorsal tubercles (variable in size), in four transverse rows per segment; parapodia lacking papillae; and semi-compound chaetae with distally enlarged shaft and short blades. Ephesiella australiensis is reported for the first time in Lizard Island. Laboratory observations of live specimens of Sphaerodoropsis plurituberculata n. sp., revealed the use of spermatophores by males. These were found attached externally to the body surface of both sexes, indicating pseudo-copulation.

[EN] A revision of the complete sphaerodorid (Sphaerodoridae, Annelida) collections housed in the three major Australian museums (The Australian Museum, Museum and Art Gallery of the Northern Territory and Museum Victoria) has been performed. Specimens of three of the four species described to date from Australian waters, Ephesiella australiensis, Sphaerodoropsis exmouthensis and Sphaerodoropsis fauchaldi, have been re-encountered, resulting in changes to their previously reported distribution range. Four additional species are herein described as new: Sphaerephesia hutchingsae n. sp., Sphaerodoropsis longofalcigera n. sp., Sphaerodoropsis megatuberculata n. sp. and Sphaerodoropsis wilsoni n. sp. Moreover, Sphaerodoropsis multipapillata heteropapillata is elevated to the rank of species. A formal description of other specimens, most likely belonging to undescribed species, is not possible due to insufficient material, but information about some of their morphological features is provided. Descriptions, iconography, geographical and ecological information of all species part of this revision is provided together with a key for identification to all Australian species. An evaluation of some of the traditional generic taxonomic features is made, considering the variation observed within the Australian species., [ES] Se ha llevado a cabo una revisión de las colecciones completas de esferodóridos (Sphaerodoridae, Annelida) de las tres mayores instituciones australianas (The Australian Museum, Museum and Art Gallery of the Northern Territory and Museum Victoria). Se han encontrado ejemplares de tres de las cuatro especies descritas hasta ahora en aguas australianas, Ephesiella australiensis, Sphaerodoropsis exmouthensis y Sphaerodoropsis fauchaldi, resultando en cambios su el rango de distribución conocido. Otras cuatro especies adicionales se describen aquí como nuevas: Sphaerephesia hutchingsaen. sp., Sphaerodoropsis longofalcigera n. sp., Sphaerodoropsis megatuberculata n. sp. y Sphaerodoropsis wilsoni n. sp. Además, Sphaerodoropsis multipapillata heteropapillata se eleva a rango de especie. Se redescriben Ephesiella australiensis, Sphaerodoropsis exmouthensis y Sphaerodoropsis fauchaldi. La descripción formal de otros ejemplares, que probablemente pertenecen a especies no descritas, no ha sido posible debido al escaso material disponible, pero se ha incluido información de algunas de sus características morfológicas. Se incluyen descripciones detalladas, iconografía, y datos de distribución y ecología de todas las especies identificadas como parte de la presente revisión, junto con una clave de identificación de todas las especies australianas. Se evalúan algunos de los caracteres tradicionalmente empleados en la clasificación, considerando la variación observada en las especies australianas., were reviewed thanks to the European Commission Taxonomic Initiative SYNTHESYS (ES-TAF-2839 and FR-TAF-2644).

Sphaerodoropsis biserialis (Berkeley and Berkeley, 1944) (Figure 5) Sphaerodorum biserialis Berkeley and Berkeley, 1944: 3, figs. 1���3. Sphaerodoridium biseralis Hartman, 1968: 601. Imajima, 1969: 154 ���155, figs. 3 a���d. Sphaerodoropsis biserialis Fauchald, 1974: 272, fig. 3.17. Material examined. 1 Paratype USNM 32862. Western Canadian Arctic region. Dease Strait, 69 ��N, 106 �� 25 ���W. Description. Paratype 3 mm long, with 24 chaetigers. Body shape circular in section, ventrally flattened. Prostomium with two lateral slender antennae and one median conical and short. Eyes not present. Long papillae on anterior margin of prostomium. Segment 1 cirri digitiform, similar in length to lateral antennae. Papillae covering completely dorsum and ventral side of the body distributed in several irregular transversal rows per segment. Four sessile and pear-shaped macrotubercles on the dorsum of each segment. First chaetiger with two only macrotubercles, subsequent chaetigers with four. Conical parapodia with wrinkled surface. Anterior parapodial lobes digitiform and slender, 1 / 3 of parapodia length. Prechaetal lobes and ventral cirri present; dorsal cirri and postchaetal lobes absent. Ventral cirri conical, slightly longer than parapodia but not exceeding length of prechaetal lobes. Several papillae on each face of parapodia, 3 located distally over dorsal edge of parapodia. Compound falcigers, apparently divided in two different groups, division difficult to ascertain under light microscope; 15���25 chaetae with clear dorsoventral gradation in length (36 ��m dorsally, 15.5 ��m ventrally in midbody parapodia) (Fig. 5 A). Hooked blades unidentate (under light microscope), with thick and curved distal tooth, short spinulation on blade edge (Fig. 5 A). One straight acicula per parapodium. Pygidium small, rounded with two spherical anal cirri, similar in shape to macrotubercles. Cylindrical proventricle visible as dark structure, visible through three segments, muscle cell-rows not possible to distinguish. Remarks. The compound chaetae of S. biserialis were described by Berkeley & Berkeley (1944) as without spinulation. After studying them under high magnification, spinulation is present as short spines on each blade's edge. While similar overall to S. anae n. sp., there are clear differences between the two species as outlined in the Remarks section above., Published as part of Aguado, M. Teresa & Rouse, Greg W., 2006, First record of Sphaerodoridae (Phyllodocida: Annelida) from hydrothermal vents, pp. 1-21 in Zootaxa 1383 on pages 10-11, DOI: 10.5281/zenodo.175041, {"references":["Berkeley, E. & Berkeley, C. (1944) Polychaeta from the Western Canadian Arctic region. Canadian Journal of Research, 22 (1), 1 - 5.","Hartman, O. (1968) Atlas of the Errantia Polychaetous Annelids from California. Allan Hancock Foundation. Los Angeles. 828 pp.","Imajima, M. (1969) Three species of the family Sphaerodoridae (Polychaetous Annelids) from Japan. Bulletin of the Natural Science Museum, Tokyo, 12 (1), 151 - 156.","Fauchald, K. (1974) Sphaerodoridae (Polychaeta: Errantia) from world-wide areas. Journal of Natural History, 8, 257 - 289."]}

Sphaerodoropsis Hartman & Fauchald, 1971 Generic diagnosis (modified from Borowski 1994). Four or more rows of dorsal and sessile macrotubercles without terminal papillae. Anterior end with a median antennae and a pair of lateral antennae. A pair of ventral palps, similar to antennae is present. A pair of papillae similar in length to antennae and palps may also be present. Chaetae compound. Type species Sphaerodoropsis sphaerulifer (Moore, 1909). Remarks: Borowski (1994) made no differentiation between palps and antennae in sphaerodorids and indeed they are very similar. However, Rouse & Fauchald (1997) and Pleijel (2001) distinguished them to facilitate comparison with other Phyllodocida. Borowski (1994) stated that Sphaerodoropsis could have an additional pair of antennae but this would make them unique among Phyllodocida so it seems more reasonable to interpret them as elongate papillae (see Discussion). The interpretation of the prostomium, peristomium and anterior segments in the description below follows Pleijel (2001)., Published as part of Aguado, M. Teresa & Rouse, Greg W., 2006, First record of Sphaerodoridae (Phyllodocida: Annelida) from hydrothermal vents, pp. 1-21 in Zootaxa 1383 on page 3, DOI: 10.5281/zenodo.175041, {"references":["Hartman, O. & Fauchald, K. (1971) Deep-water benthic polychaetous annelids off New England to Bermuda and other North Atlantic Areas. Part II. Allan Hancock Monographs in Marine Biology, 6, 1 - 327.","Borowski, C. (1994) Three new deep-sea species of Sphaerodoridae (Annelida, Polychaeta) from the eastern tropical South Pacific. Zoologica Scripta, 3, 193 - 203.","Moore, J. P. (1909). The polychaetous annelids dredged by the U. S. S. Albatross of the coast of southern California in 1904. I: Syllidae. Sphaerodoridae. Hesionidae and Phyllodocidae. Proceedings of the Academy of Natural Science of Philadelphia, 61, 321 - 351.","Pleijel, F. (2001) Sphaerodoridae Malmgren, 1867. In: Rouse, G. W. & Pleijel, F. (Eds.), Polychaetes. Oxford University Press, pp. 136 - 138."]}

Sphaerodoropsis anae n. sp. (Figures 1–4) Material examined. Holotype (MNCN 16.01 / 10817); 4 paratypes: MNCN 16.01 / 10818 (1 spec.), SAM E 3634 (2 spec.), E 3635 (1 spec.). Holotype MNCN 16.01 / 10818 and paratype MNCN 16.01 / 10818 collected by DSV Alvin Dive 4088: 37 ° 47.563 S, 110 ° 54.963 W depth 2216 m. Paratypes SAM E 3634 and SAM E 3635 collected by DSV Alvin Dive 4092: 31 ° 51.789 S, 112 ° 02.534W depth 2334 m, and DSV Alvin Dive 4093 31 ° 51.869 S, 112 ° 02.638W, depth 2235 m, respectively. Other material examined. Sphaerodoropsis discolis Borowski, 1994. Holotype SMF 4487 and paratypes SMF 4489–4502. Sphaerodoropsis biserialis (Berkeley & Berkeley, 1944). 1 Paratype USNM 32862. Diagnosis. Sphaerodoropsis with distinct proventricle; four macrotubercles per transverse row; dorsum covered by papillae; 4 papillae on dorsal edge of parapodia and several on each face; presence of prechaetal lobe; chaetal fascicles divided in two groups and bidentate compound chaetae with long spinulation. Description. Holotype (MNCN 16.01 / 10817) complete, 4.5 mm long, 0.5 mm wide, with 22 chaetigers, adult specimen, female. Paratype (MNCN 16.01 / 10818) complete 5 mm long, 0.7 mm wide, with 24 chaetigers, male. Body shape, excluding parapodia, circular in section, ventrally flattened; body width fairly constant with tapering end (Figs. 1 A, 2 A). Colour white to pale in ethanol preserved specimens, without any distinguishable colour pattern. White to cream in live specimens (Figs. 1 A–C). Anterior end rounded and broadly conical (Fig. 4 A, B). Prostomium and first segments fused. Median antenna conical, slender and distally blunt. One pair of lateral antennae, both digitiform and longer than median antenna. Palps ventrally located conical, longer and wider than antennae (Fig. 4 B). Eyes absent. Long papillae present on anterior margin of prostomium, all digitiform and slightly blunt on distal part, shorter and thinner than median antenna (Fig. 2 B, 4 B). One papilla at base of each lateral antenna slightly longer than those on anterior margin of prostomium. Segment 1 achaetous with one pair of digitiform cirri, similar in length to lateral antennae. Following segments annulated, with 4 rings per segment (Fig. 3 A). Body papillae rounded, shorter than those on prostomium. Papillae cover dorsal and ventral sides of the body; organized on segmental annulae in four irregular transversal rows per segment, (Figs. 2 A–C, 4 C). Dorsal macrotubercles sessile, first chaetiger with only two macrotubercles, spherical (Figs. 2 A, B). Three macrotubercles (two on one side) (Fig. 4 A, B) present on Paratype SAM E 3635. Remainder chaetigers with four macrotubercles in a transverse row (Figs. 1 B, C, 2 A, 3 B, C, 4 A). Lateralmost macrotubercles pear-shaped slightly tapered on distal part, with orange inclusions (Figs. 3 B, C); distal tip in some invaginated (Fig. 2 A). Median macrotubercles spherical, smaller than lateral ones, containing granular material (Figs. 3 B, C). Parapodia with wrinkled surface, increasing in length posteriorly along body. Last pair directed posteriorly (Fig. 2 A). Anterior parapodial lobes conical and slender, 1 / 3 of the parapodia length (Fig. 4 D). Prechaetal lobes and ventral cirri present; dorsal cirri and postchaetal lobes absent. Ventral cirri digitiform, slightly longer than parapodia, but not exceeding prechaetal lobes (Figs. 3 B, C). Four papillae over dorsal edge of parapodia, one pair on either side of chaetae (Fig. 4 D, E). Several papillae on each face of parapodium (Figs. 3 B, C). Compound chaetae in two groups, one dorsal with 2–4 chaetae; second more ventral with 8–20 chaetae per fascicle in midbody parapodia (Fig. 4 D, E). One straight acicula per parapodium. Compound chaetae all similar, with dorsoventral gradation in length (38 µm long dorsally, 29 µm long ventrally in midbody parapodia). Blades long and slender, distally unidentate via light microscope (Fig. 3 D), but bidentate under SEM, with thin and curved distal tooth and small proximal tooth and thin spinulation on blade edge (Figs. 4 F–H). Pygidium small, rounded with two spherical anal cirri, similar in shape to lateral macrotubercles, and one conical anal cirrus (Fig. 2 A). Two pairs of slightly brown pigmented pharyngeal glands extending through first chaetiger (Figs. 2 A, B). Eversible pharynx, smooth distally (Paratypes MNCN 16.01 / 10818, SAM E 3634) (Figs. 1 C, 2 D). Cylindrical proventricle well developed and visible through three segments, about 20, dark and continuous muscle cell-rows; muscle cells all similar in size (Fig. 2 A). Holotype carrying numerous white ovoid oocytes with obvious nuclei (Figs. 1 A, B). Remarks. Borowski (1994) distinguished four different groups of Sphaerodoropsis species. Group 1 was identified by having four longitudinal rows of macrotubercles (except for first chaetiger in some species where there are two), and one transverse row per chaetiger. Group 2 includes species with more than four longitudinal rows of macrotubercles, and one transverse row per segment. In Group 3, species also present more than four longitudinal rows of macrotubercles, but two transverse rows per segment. Finally, Group 4 comprises species with macrotubercles randomly scattered over the dorsum, approximately in three to four transverse rows per segment. Sphaerodoropsis anae n. sp., clearly matches the features characterizing Group 1, and is compared with all 20 species hitherto assigned to this group in Table 1. Bakken (2002) found two additional species of Sphaerodoropsis belonging to Group 1, but they were not named given the scarcity of specimens available, and these species are not included in Table 1. It is clear that S. anae n. sp., is most similar to S. biserialis ( Berkeley & Berkeley, 1944). Both species share several characters such as the shape of antennae and macrotubercles and similar distribution of papillae. Additionally, drawings of chaetae made in the original description are very similar to the chaetae of S. anae. After study of one paratype of S. biserialis (see below), we conclude however that each species has different kinds of blades. Those of S. biserialis are unidentate (under light microscope) with thick hooked distal tooth and spinulation. Meanwhile, although blades of S. anae n. sp., appear unidentate (under light microscope), they are clearly bidentate under SEM (Figs 4 F–H). Also, compared with S. biserialis, the distal tooth is curved but thin and the spinulation is also thin, being quickly distorted when exposed to electron bombardment (see Fig. 4 G). We include the drawings of chaetae of S. anae n. sp., in Fig. 3 as they are seen under light microscope, to facilitate comparison with other Sphaerodoropsis in absence of SEM pictures. Sphaerodoropsis anae n. sp., differs from S. discolis Borowski, 1994, another similar species, in having differences in shape and size of median and lateral macrotubercles; having a longer median antenna, several papillae on parapodia and the blades of compound chaetae are distally curved. Sphaerodoropsis vittori Kudenov, 1987 also presents some similarities since it has slender chaetae and several papillae on each face of parapodium, yet this species has four macrotubercles on first chaetiger and the blades of compound chaetae are not distally curved. Sphaerodoropsis triplicata Fauchald, 1974 presents hooked blades and only possesses two or three papillae over dorsal tip of parapodia. Sphaerodoropsis exmouthensis Hartmann-Schröder, 1981 has annulated segments, but there are only two rings per segment while in S. anae n. sp., there are four and the antennae, macrotubercles and chaetal shape are also different. Differences in shape of lateral and median macrotubercles of S. longiparapodium Katzmann, 1973 are similar to those of S. anae n. sp., and both species show several papillae over the parapodia. However, there is only a single large papilla over the dorsal tip of each parapodium of S. longiparapodium and the blades of compound chaetae are not distally curved as they are in S. anae n. sp. Sphaerodoropsis philippi (Fauvel, 1911), although having several papillae on each parapodium, has chaetae that are not distally curved. Finally, although body size is not normally considered as a diagnostic character, it is quite remarkable that specimens of S. anae n. sp., are longer than most of the described species of the genus. They are about 4–5 mm long while the average of the holotypes of the species of the genus is approximately 2 mm. Etymology. This species is dedicated to Ana Navarro, a very good friend of the senior author, whose affection and company were always invaluable.

Euritmia hamulisetosa gen. et sp. n. is characterized by many rows of sessile macrotubercles without terminal papillae; all anterior appendages are short and setae simple. Three others species of Sphaerodoridae collected from the Gibraltar Strait region are Ephesiella abyssorum, Sphaerodoridium claparedeii and Sphaerodoropsis minutum. Sphaerodoropsis capense (Day, 1963) is transferred to the new genus Euritmia.