Search

Intracellular vesicle fusion is driven by the soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) and their cofactors, including Sec1/Munc18 (SM), α-SNAP, and NSF. α-SNAP and NSF play multiple layers of regulatory roles in the SNARE assembly, disassembling the cis-SNARE complex and the prefusion SNARE complex. How SM proteins coupled with NSF and α-SNAP regulate SNARE-dependent membrane fusion remains incompletely understood. Munc18c, an SM protein involved in the exocytosis of the glucose transporter GLUT4, binds and activates target (t-) SNAREs to accelerate the fusion reaction through a SNARE-like peptide (SLP). Here, using an in vitro reconstituted system, we discovered that α-SNAP blocks the GLUT4 SNAREs-mediated membrane fusion. Munc18c interacts with t-SNAREs to displace α-SNAP, which overcomes the fusion inhibition. Furthermore, Munc18c shields the trans-SNARE complex from NSF/α-SNAP-mediated disassembly and accelerates SNARE-dependent fusion kinetics in the presence of NSF and α-SNAP. The SLP in domain 3a is indispensable in Munc18c-assisted resistance to NSF and α-SNAP. Together, our findings demonstrate that Munc18c protects the prefusion SNARE complex from α-SNAP and NSF, promoting SNARE-dependent membrane fusion through its SLP., Competing Interests: Conflict of interest The authors declare that they have no conflicts of interest with the contents of this article., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

Plant-parasitic nematodes are one of the most economically impactful pests in agriculture resulting in billions of dollars in realized annual losses worldwide. Soybean cyst nematode (SCN) is the number one biotic constraint on soybean production making it a priority for the discovery, validation and functional characterization of native plant resistance genes and genetic modes of action that can be deployed to improve soybean yield across the globe. Here, we present the discovery and functional characterization of a soybean resistance gene, GmSNAP02. We use unique bi-parental populations to fine-map the precise genomic location, and a combination of whole genome resequencing and gene fragment PCR amplifications to identify and confirm causal haplotypes. Lastly, we validate our candidate gene using CRISPR-Cas9 genome editing and observe a gain of resistance in edited plants. This demonstrates that the GmSNAP02 gene confers a unique mode of resistance to SCN through loss-of-function mutations that implicate GmSNAP02 as a nematode virulence target. We highlight the immediate impact of utilizing GmSNAP02 as a genome-editing-amenable target to diversify nematode resistance in commercially available cultivars., (© 2023. The Author(s).)

In the cerebellum, hippocampus, and prefrontal cortex of mature male Wistar rats with trained spatial navigational skill in the Morris water maze, the transcriptional activity the NAPA gene that regulates the transport and secretion of synaptic vesicles, release of neurotransmitters, and protein degradation was determined by real-time PCR. Animals subjected to forced swimming in a time-matched regime (active control) and naïve rats were used as the comparison groups. Suppression of NAPA gene activity was found in the hippocampus and cerebellum of the active control group, while navigation skill training led to a significant increase in gene expression in all brain structures under study. The findings suggest the existence of specific mechanisms regulating NAPA gene activity during the formation of spatial memory and adaptive behavior under stress conditions., (© 2023. Springer Science+Business Media, LLC, part of Springer Nature.)

The AAA + NSF complex is responsible for SNARE complex disassembly both before and after membrane fusion. Loss of NSF function results in pronounced developmental and degenerative defects. In a genetic screen for sensory deficits in zebrafish, we identified a mutation in nsf, I209N, that impairs hearing and balance in a dosage-dependent manner without accompanying defects in motility, myelination, and innervation. In vitro experiments demonstrate that while the I209N NSF protein recognizes SNARE complexes, the effects on disassembly are dependent upon the type of SNARE complex and I209N concentration. Higher levels of I209N protein produce a modest decrease in binary (syntaxin-SNAP-25) SNARE complex disassembly and residual ternary (syntaxin-1A-SNAP-25-synaptobrevin-2) disassembly, whereas at lower concentrations binary disassembly activity is strongly reduced and ternary disassembly activity is absent. Our study suggests that the differential effect on disassembly of SNARE complexes leads to selective effects on NSF-mediated membrane trafficking and auditory/vestibular function., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2023 The Authors. Published by Elsevier Inc. All rights reserved.)

The rhg1-a GmSNAP18 (an α-SNAP ) and Rhg4 GmSHMT08 are two major cloned genes conferring soybean cyst nematode resistance in Peking-type soybeans, but the application of α-SNAPs and SHMTs in cyst nematode management remains elusive. In this study, GmSNAP18 and GmSHMT08 , together with their orthologs in Arabidopsis, AtSNAP2 (an α-SNAP ) and AtSHMT4 , were individually transformed into Arabidopsis Col-0 to generate the transgenic lines, and the growth of transgenic plants, beet cyst nematode (BCN) infection phenotypes, and AtSNAP2 , AtSHMT4 , and AtPR1 expression patterns were analyzed using Arabidopsis-BCN compatible interaction system, in addition with protein-protein interaction assay. Pulldown and BiFC assays revealed that GmSNAP18 and GmSHMT08 interacted with AtSHMT4 and AtSNAP2, respectively. Plant root growth was not impacted by overexpression of GmSNAP18 and AtSNAP2 . However, overexpression of GmSHMT08 and AtSHMT4 both increased plant height, additionally, overexpression of GmSHMT08 decreased rosette leaf size. Overexpression of GmSNAP18 and GmSHMT08 both suppressed AtPR1 expression and significantly enhanced BCN susceptibility, while overexpression of AtSNAP2 and AtSHMT4 both substantially boosted AtPR1 expression and remarkably enhanced BCN resistance, in transgenic Arabidopsis. Overexpression of GmSNAP18 reduced, while overexpression of AtSNAP2 unaltered AtSHMT4 expression. Overexpression of GmSHMT08 and AtSHMT4 both suppressed AtSNAP2 expression in transgenic Arabidopsis. Thus, different expression patterns of AtPR1 and AtSHMT4 are likely associated with opposite BCN infection phenotypes of Arabidopsis between overexpressing GmSNAP18 and AtSNAP2 , and between overexpressing GmSHMT08 and AtSHMT4 ; and boosted AtPR1 expression are required for enhanced BCN resistance in Arabidopsis. All these results establish a basis for extension of α-SNAPs and SHMTs in cyst nematode management.

This study pursued the hypothesis that wild plant germplasm accessions carrying alleles of interest can be identified using available single nucleotide polymorphism (SNP) genotypes for particular alleles of other (unlinked) genes that contribute to the trait of interest. The soybean cyst nematode (SCN, Heterodera glycines [HG]) resistance locus Rhg1 is widely used in farmed soybean [Glycine max (L.) Merr.]. The two known resistance-conferring haplotypes, rhg1-a and rhg1-b, typically contain three or seven to 10 tandemly duplicated Rhg1 segments, respectively. Each Rhg1 repeat carries four genes, including Glyma.18G022500, which encodes unusual isoforms of the vesicle-trafficking chaperone α-SNAP. Using SoySNP50K data for NSF RAN07 allele presence, we discovered a new Rhg1 haplotype, rhg1-ds, in six accessions of wild soybean, Glycine soja Siebold & Zucc. (0.5% of the ∼1,100 G. soja accessions in the USDA collection). The α-SNAP encoded by rhg1-ds is unique at an important site of amino acid variation and shares with the rhg1-a and rhg1-b α-SNAP proteins the traits of cytotoxicity and altered N-ethylmaleimide sensitive factor (NSF) protein interaction. Copy number assays indicate three repeats of rhg1-ds. G. soja PI 507613 and PI 507623 exhibit resistance to HG type 2.5.7 SCN populations, in part because of contributions from other loci. In a segregating F 2 population, rhg1-b and rhg1-ds made statistically indistinguishable contributions to resistance to a partially virulent HG type 2.5.7 SCN population. Hence, the unusual multigene copy number variation Rhg1 haplotype was present but rare in ancestral G. soja and was present in accessions that offer multiple traits for SCN resistance breeding. The accessions were initially identified for study based on an unlinked SNP., (© 2021 The Authors. The Plant Genome published by Wiley Periodicals LLC on behalf of Crop Science Society of America.)

Soybean cyst nematode (SCN) is the most economically damaging pathogen of soybean and host resistance is a core management strategy. The SCN resistance quantitative trait locus cqSCN-006 , introgressed from the wild relative Glycine soja , provides intermediate resistance against nematode populations, including those with increased virulence on the heavily used rhg1-b resistance locus. cqSCN-006 was previously fine-mapped to a genome interval on chromosome 15. The present study determined that Glyma.15G191200 at cqSCN-006 , encoding a γ-SNAP, contributes to SCN resistance. CRISPR/Cas9-mediated disruption of the cqSCN-006 allele reduced SCN resistance in transgenic roots. There are no encoded amino acid polymorphisms between resistant and susceptible alleles. However, other cqSCN-006 -specific DNA polymorphisms in the Glyma.15G191200 promoter and gene body were identified, and we observed differing induction of γ-SNAP protein abundance at SCN infection sites between resistant and susceptible roots. We identified alternative RNA splice forms transcribed from the Glyma.15G191200 γ-SNAP gene and observed differential expression of the splice forms 2 days after SCN infection. Heterologous overexpression of γ-SNAPs in plant leaves caused moderate necrosis, suggesting that careful regulation of this protein is required for cellular homeostasis. Apparently, certain G. soja evolved quantitative SCN resistance through altered regulation of γ-SNAP. Previous work has demonstrated SCN resistance impacts of the soybean α-SNAP proteins encoded by Glyma.18G022500 ( Rhg1 ) and Glyma.11G234500 . The present study shows that a different type of SNAP protein can also impact SCN resistance. Little is known about γ-SNAPs in any system, but the present work suggests a role for γ-SNAPs during susceptible responses to cyst nematodes.[Formula: see text] Copyright © 2021 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Yeast vacuolar membrane fusion has been reconstituted with R, Qa, Qb, and Qc-family SNAREs, Sec17/αSNAP, Sec18/NSF, and the hexameric HOPS complex. HOPS tethers membranes and catalyzes SNARE assembly into RQaQbQc trans -complexes which zipper through their SNARE domains to promote fusion. Previously, we demonstrated that Sec17 and Sec18 can bypass the requirement of complete zippering for fusion (Song et al., 2021), but it has been unclear whether this activity of Sec17 and Sec18 is directly coupled to HOPS. HOPS can be replaced for fusion by a synthetic tether when the three Q-SNAREs are pre-assembled. We now report that fusion intermediates with arrested SNARE zippering, formed with a synthetic tether but without HOPS, support Sec17/Sec18-triggered fusion. This zippering-bypass fusion is thus a direct result of Sec17 and Sec18 interactions: with each other, with the platform of partially zippered SNAREs, and with the apposed tethered membranes. As these fusion elements are shared among all exocytic and endocytic traffic, Sec17 and Sec18 may have a general role in directly promoting fusion., Competing Interests: HS, WW No competing interests declared, (© 2021, Song and Wickner.)

In species that regenerate the injured spinal cord, the ependymal region is a source of new cells and a prominent coordinator of regeneration. In mammals, cells at the ependymal region proliferate in normal conditions and react after injury, but in humans, the central canal is lost in the majority of individuals from early childhood. It is replaced by a structure that does not proliferate after damage and is formed by large accumulations of ependymal cells, strong astrogliosis and perivascular pseudo-rosettes. We inform here of two additional mammals that lose the central canal during their lifetime: the Naked Mole-Rat (NMR, Heterocephalus glaber ) and the mutant hyh ( hydrocephalus with hop gait ) mice. The morphological study of their spinal cords shows that the tissue substituting the central canal is not similar to that found in humans. In both NMR and hyh mice, the central canal is replaced by tissue reminiscent of normal lamina X and may include small groups of ependymal cells in the midline, partially resembling specific domains of the former canal. However, no features of the adult human ependymal remnant are found, suggesting that this structure is a specific human trait. In order to shed some more light on the mechanism of human central canal closure, we provide new data suggesting that canal patency is lost by delamination of the ependymal epithelium, in a process that includes apical polarity loss and the expression of signaling mediators involved in epithelial to mesenchymal transitions.

Adult T-cell leukemia/lymphoma (ATLL) originates from human T-cell leukemia virus type 1 (HTLV-1) infection due to the activation of the nuclear factor-κB (NF-κB) signaling pathway to maintain proliferation and survival. An important mechanism of the activated NF-κB signaling pathway in ATLL is the activation of the macroautophagy (herafter referred to as autophagy in the remainder of this manuscript)-lysosomal degradation of p47 (NSFL1C), a negative regulator of the NF-κB pathway. Therefore, we considered the use of chloroquine (CQ) or hydroxychloroquine (HCQ) (CQ/HCQ) as an autophagy inhibitor to treat ATLL; these drugs were originally approved by the FDA as antimalarial drugs and have recently been used to treat autoimmune diseases, such as systemic lupus erythematosus (SLE). In this paper, we determined the therapeutic efficacy of CQ/HCQ, as NF-κB inhibitors, in ATLL mediated by blockade of p47 degradation. Administration of CQ/HCQ to ATLL cell lines and primary ATLL cells induced cell growth inhibition in a dose-dependent manner, and the majority of cells underwent apoptosis after CQ administration. As to the molecular mechanism, autophagy was inhibited in CQ-treated ATLL cells, and activation of the NF-κB pathway was suppressed with the restoration of the p47 level. When the antitumor effect of CQ/HCQ was examined using immunodeficient mice transplanted with ATLL cell lines, CQ/HCQ significantly suppressed tumor growth and improved the survival rate in the ATLL xenograft mouse model. Importantly, HCQ selectively induced ATLL cell death in the ATLL xenograft mouse model at the dose used to treat SLE. Taken together, our results suggest that the inhibition of autophagy by CQ/HCQ may become a novel and effective strategy for the treatment of ATLL., Competing Interests: The authors have declared that no competing interests exist.

Background: Hereditary hemorrhagic telangiectasia (HHT) is a disease characterized by arteriovenous malformations in the skin and mucous membranes. We enrolled a large pedigree comprising 32 living members, and screened for mutations responsible for HHT., Methods: We performed whole-exome sequencing to identify novel mutations in the pedigree after excluding three previously reported HHT-related genes using Sanger sequencing. We then performed in silico functional analysis of candidate mutations that were obtained using a variant filtering strategy to identify mutations responsible for HHT., Results: After screening the HHT-related genes, activin A receptor-like type 1 (ACVRL1), endoglin (ENG), and SMAD family member 4 (SMAD4), we did not detect any co-segregated mutations in this pedigree. Whole-exome sequencing analysis of 7 members and Sanger sequencing analysis of 16 additional members identified a mutation (c.784A > G) in the NSF attachment protein gamma (NAPG) gene that co-segregated with the disease. Functional prediction showed that the mutation was deleterious and might change the conformational stability of the NAPG protein., Conclusions: NAPG c.784A > G may potentially lead to HHT. These results expand the current understanding of the genetic contributions to HHT pathogenesis.

Fueled by ATP hydrolysis in N-ethylmaleimide sensitive factor (NSF), the 20S complex disassembles rigid SNARE (soluble NSF attachment protein receptor) complexes in single unraveling step. This global disassembly distinguishes NSF from other molecular motors that make incremental and processive motions, but the molecular underpinnings of its remarkable energy efficiency remain largely unknown. Using multiple single-molecule methods, we found remarkable cooperativity in mechanical connection between NSF and the SNARE complex, which prevents dysfunctional 20S complexes that consume ATP without productive disassembly. We also constructed ATP hydrolysis cycle of the 20S complex, in which NSF largely shows randomness in ATP binding but switches to perfect ATP hydrolysis synchronization to induce global SNARE disassembly, minimizing ATP hydrolysis by non-20S complex-forming NSF molecules. These two mechanisms work in concert to concentrate ATP consumption into functional 20S complexes, suggesting evolutionary adaptations by the 20S complex to the energetically expensive mechanical task of SNARE complex disassembly.

Membrane fusion requires R-, Qa-, Qb-, and Qc-family SNAREs that zipper into RQaQbQc coiled coils, driven by the sequestration of apolar amino acids. Zippering has been thought to provide all the force driving fusion. Sec17/αSNAP can form an oligomeric assembly with SNAREs with the Sec17 C-terminus bound to Sec18/NSF, the central region bound to SNAREs, and a crucial apolar loop near the N-terminus poised to insert into membranes. We now report that Sec17 and Sec18 can drive robust fusion without requiring zippering completion. Zippering-driven fusion is blocked by deleting the C-terminal quarter of any Q-SNARE domain or by replacing the apolar amino acids of the Qa-SNARE that face the center of the 4-SNARE coiled coils with polar residues. These blocks, singly or combined, are bypassed by Sec17 and Sec18, and SNARE-dependent fusion is restored without help from completing zippering., Competing Interests: HS, TT, AO, WW No competing interests declared, AB Reviewing editor, eLife, (© 2021, Song et al.)

The development of male and female gametophytes is a pre-requisite for successful reproduction of angiosperms. Factors mediating vesicular trafficking are among the key regulators controlling gametophytic development. Fusion between vesicles and target membranes requires the assembly of a fusogenic soluble N-ethylmaleimide sensitive factor attachment protein receptors (SNAREs) complex, whose disassembly in turn ensures the recycle of individual SNARE components. The disassembly of post-fusion SNARE complexes is controlled by the AAA+ ATPase N-ethylmaleimide-sensitive factor (Sec18/NSF) and soluble NSF attachment protein (Sec17/α-SNAP) in yeast and metazoans. Although non-canonical α-SNAPs have been functionally characterized in soybeans, the biological function of canonical α-SNAPs has yet to be demonstrated in plants. We report here that the canonical α-SNAP in Arabidopsis is essential for male and female gametophytic development. Functional loss of the canonical α-SNAP in Arabidopsis results in gametophytic lethality by arresting the first mitosis during gametogenesis. We further show that Arabidopsis α-SNAP encodes two isoforms due to alternative splicing. Both isoforms interact with the Arabidopsis homolog of NSF whereas have distinct subcellular localizations. The presence of similar alternative splicing of human α-SNAP indicates that functional distinction of two α-SNAP isoforms is evolutionarily conserved., Competing Interests: The authors declare no conflict of interests.

The expression of synaptic vesicle exocytosis-regulator SNARE complex component genes (snap25, stx1 and vamp2) was examined in the olfactory nervous system during seaward and homeward migration by pink salmon (Oncorhynchus gorbuscha). The expression levels of snares in the olfactory organ were higher in seaward fry than in feeding and homeward adults, reflecting the development of the olfactory nervous system. The expression of snap25a, b and stx1a was upregulated or stable in the adult olfactory bulb and telencephalon. This upregulated expression suggested alterations in olfactory neuronal plasticity that may be related to the discrimination of natal rivers. The expression of stx1b was downregulated in the adult olfactory bulb, but remained stable in the adult telencephalon. The expression of vamp2 was initially strong in seaward fry, but was downregulated in adults in both the olfactory bulb and telencephalon. Pink salmon has the lowest diversity of maturation age, the largest population, and the most evolutional position in Pacific salmon (genus Oncorhynchus). The expression of snares in the olfactory center of pink salmon reflected the timing of sexual maturation and homeward migration. The present results and our previous studies indicate that snares show distinct expression patterns between two salmon species that depend on physiological and ecological features of migration., (© 2020 Fisheries Society of the British Isles.)

After sperm-oocyte fusion, cortical granules (CGs) located in oocyte cortex undergo exocytosis and their content is released into the perivitelline space to avoid polyspermy. Thus, cortical granule exocytosis (CGE) is a key process for fertilization success. We have demonstrated that alpha-SNAP -and its functional partner NSF- mediate fusion of CGs with the plasma membrane in mouse oocytes. Here, we examined at cellular and ultrastructural level oocytes from hyh (hydrocephalus with hop gait) mice, which present a missense mutation in the Napa gene that results in the substitution of methionine for isoleucine at position 105 (M105I) of alpha-SNAP. Mutated alpha-SNAP was mislocalized in hyh oocytes while NSF expression increased during oocyte maturation. Staining of CGs showed that 9.8% of hyh oocytes had abnormal localization of CGs and oval shape. Functional tests showed that CGE was impaired in hyh oocytes. Interestingly, in vitro fertilization assays showed a decreased fertilization rate for hyh oocytes. Furthermore, fertilized hyh oocytes presented an increased polyspermy rate compared to wild type ones. At ultrastructural level, hyh oocytes showed small mitochondria and a striking accumulation and secretion of degradative structures. Our findings demonstrate the negative effects of alpha-SNAP M105 mutation on oocyte biology and further confirm the relevance of alpha-SNAP in female fertility.

The homeostasis of most organelles requires membrane fusion mediated by s oluble N -ethylmaleimide-sensitive factor (NSF) a ttachment protein re ceptors (SNAREs). SNAREs undergo cycles of activation and deactivation as membranes move through the fusion cycle. At the top of the cycle, inactive cis -SNARE complexes on a single membrane are activated, or primed, by the hexameric ATPase associated with the diverse cellular activities (AAA+) protein, N -ethylmaleimide-sensitive factor (NSF/Sec18), and its co-chaperone α-SNAP/Sec17. Sec18-mediated ATP hydrolysis drives the mechanical disassembly of SNAREs into individual coils, permitting a new cycle of fusion. Previously, we found that Sec18 monomers are sequestered away from SNAREs by binding phosphatidic acid (PA). Sec18 is released from the membrane when PA is hydrolyzed to diacylglycerol by the PA phosphatase Pah1. Although PA can inhibit SNARE priming, it binds other proteins and thus cannot be used as a specific tool to further probe Sec18 activity. Here, we report the discovery of a small-molecule compound, we call IPA (inhibitor of priming activity), that binds Sec18 with high affinity and blocks SNARE activation. We observed that IPA blocks SNARE priming and competes for PA binding to Sec18. Molecular dynamics simulations revealed that IPA induces a more rigid NSF/Sec18 conformation, which potentially disables the flexibility required for Sec18 to bind to PA or to activate SNAREs. We also show that IPA more potently and specifically inhibits NSF/Sec18 activity than does N- ethylmaleimide, requiring the administration of only low micromolar concentrations of IPA, demonstrating that this compound could help to further elucidate SNARE-priming dynamics., (© 2019 Sparks et al.)

Munc18-1 and Munc13-1 orchestrate assembly of the SNARE complex formed by syntaxin-1, SNAP-25 and synaptobrevin, allowing exquisite regulation of neurotransmitter release. Non-regulated neurotransmitter release might be prevented by αSNAP, which inhibits exocytosis and SNARE-dependent liposome fusion. However, distinct mechanisms of inhibition by αSNAP were suggested, and it is unknown how such inhibition is overcome. Using liposome fusion assays, FRET and NMR spectroscopy, here we provide a comprehensive view of the mechanisms underlying the inhibitory functions of αSNAP, showing that αSNAP potently inhibits liposome fusion by: binding to syntaxin-1, hindering Munc18-1 binding; binding to syntaxin-1-SNAP-25 heterodimers, precluding SNARE complex formation; and binding to trans-SNARE complexes, preventing fusion. Importantly, inhibition by αSNAP is avoided only when Munc18-1 binds first to syntaxin-1, leading to Munc18-1-Munc13-1-dependent liposome fusion. We propose that at least some of the inhibitory activities of αSNAP ensure that neurotransmitter release occurs through the highly-regulated Munc18-1-Munc13-1 pathway at the active zone.

R-SNAREs (soluble N -ethylmaleimide-sensitive factor receptor), Q-SNAREs, and Sec1/Munc18 (SM)-family proteins are essential for membrane fusion in exocytic and endocytic trafficking. The yeast vacuolar tethering/SM complex HOPS (homotypic fusion and vacuole protein sorting) increases the fusion of membranes bearing R-SNARE to those with 3Q-SNAREs far more than it enhances their trans -SNARE pairings. We now report that the fusion of these proteoliposomes is also supported by GST-PX or GST-FYVE, recombinant dimeric proteins which tether by binding the phosphoinositides in both membranes. GST-PX is purely a tether, as it supports fusion without SNARE recognition. GST-PX tethering supports the assembly of new, active SNARE complexes rather than enhancing the function of the fusion-inactive SNARE complexes which had spontaneously formed in the absence of a tether. When SNAREs are more disassembled, as by Sec17, Sec18, and ATP (adenosine triphosphate), HOPS is required, and GST-PX does not suffice. We propose a working model where tethering orients SNARE domains for parallel, active assembly., Competing Interests: Conflict of interest statement: W.W. and J.R. are coauthors on a 2017 Perspective article.

Background: The differently-diverged parasitic protist Giardia lamblia is known to have minimal machinery for vesicular transport. Yet, it has three paralogues of SNAP, a crucial component that together with NSF brings about disassembly of the cis-SNARE complex formed following vesicle fusion to target membranes. Given that most opisthokont hosts of this gut parasite express only one α-SNAP, this study was undertaken to determine whether these giardial SNAP proteins have undergone functional divergence., Results: All three SNAP paralogues are expressed in trophozoites, encysting trophozoites and cysts. Even though one of them clusters with γ-SNAP sequences in a phylogenetic tree, functional complementation analysis in yeast indicates that all the three proteins are functionally orthologous to α-SNAP. Localization studies showed a mostly non-overlapping distribution of these α-SNAPs in trophozoites, encysting cells and cysts. In addition, two of the paralogues exhibit substantial subcellular redistribution during encystation, which was also seen following exposure to oxidative stress. However, the expression of the three genes remained unchanged during this redistribution process. There is also a difference in the affinity of each of these α-SNAP paralogues for GlNSF., Conclusions: None of the genes encoding the three α-SNAPs are pseudogenes and the encoded proteins are likely to discharge non-redundant functions in the different morphological states of G. lamblia. Based on the difference in the interaction of individual α-SNAPs with GlNSF and their non-overlapping pattern of subcellular redistribution during encystation and under stress conditions, it may be concluded that the three giardial α-SNAP paralogues have undergone functional divergence. Presence of one of the giardial α-SNAPs at the PDRs of flagella, where neither GlNSF nor any of the SNAREs localize, indicates that this α-SNAP discharges a SNARE-independent role in this gut pathogen.

N-ethylmaleimide sensitive factor (NSF) and α-soluble NSF attachment protein (α-SNAP) are essential eukaryotic housekeeping proteins that cooperatively function to sustain vesicular trafficking. The "resistance to Heterodera glycines 1" ( Rhg1 ) locus of soybean ( Glycine max ) confers resistance to soybean cyst nematode, a highly damaging soybean pest. Rhg1 loci encode repeat copies of atypical α-SNAP proteins that are defective in promoting NSF function and are cytotoxic in certain contexts. Here, we discovered an unusual NSF allele ( Rhg1 -associated NSF on chromosome 07; NSF RAN07 ) in Rhg1 + germplasm. NSF RAN07 protein modeling to mammalian NSF/α-SNAP complex structures indicated that at least three of the five NSF RAN07 polymorphisms reside adjacent to the α-SNAP binding interface. NSF RAN07 exhibited stronger in vitro binding with Rhg1 resistance-type α-SNAPs. NSF RAN07 coexpression in planta was more protective against Rhg1 α-SNAP cytotoxicity, relative to WT NSF Ch07 Investigation of a previously reported segregation distortion between chromosome 18 Rhg1 and a chromosome 07 interval now known to contain the Glyma.07G195900 NSF gene revealed 100% coinheritance of the NSF RAN07 allele with disease resistance Rhg1 alleles, across 855 soybean accessions and in all examined Rhg1 + progeny from biparental crosses. Additionally, we show that some Rhg1 -mediated resistance is associated with depletion of WT α-SNAP abundance via selective loss of WT α-SNAP loci. Hence atypical coevolution of the soybean SNARE-recycling machinery has balanced the acquisition of an otherwise disruptive housekeeping protein, enabling a valuable disease resistance trait. Our findings further indicate that successful engineering of Rhg1 -related resistance in plants will require a compatible NSF partner for the resistance-conferring α-SNAP., Competing Interests: Conflict of interest statement: A patent application covering the presently described work has been filed by the Wisconsin Alumni Research Foundation.

Autophagy, a unique intracellular membrane-trafficking pathway, is initiated by the formation of an isolation membrane (phagophore) that engulfs cytoplasmic constituents, leading to generation of the autophagosome, a double-membrane vesicle, which is targeted to the lysosome. The outer autophagosomal membrane consequently fuses with the lysosomal membrane. Multiple membrane-fusion events mediated by SNARE molecules have been postulated to promote autophagy. αSNAP, the adaptor molecule for the SNARE-priming enzyme N -ethylmaleimide-sensitive factor ( NSF ) is known to be crucial for intracellular membrane fusion processes, but its role in autophagy remains unclear. Here we demonstrated that knockdown of αSNAP leads to inhibition of autophagy, manifested by an accumulation of sealed autophagosomes located in close proximity to lysosomes but not fused with them. Under these conditions, moreover, association of both Atg9 and the autophagy-related SNARE protein syntaxin17 with the autophagosome remained unaffected. Finally, our results suggested that under starvation conditions, the levels of αSNAP, although low, are nevertheless sufficient to partially promote the SNARE priming required for autophagy. Taken together, these findings indicate that while autophagosomal-lysosomal membrane fusion is sensitive to inhibition of SNARE priming, the initial stages of autophagosome biogenesis and autophagosome expansion remain resistant to its loss., Competing Interests: The authors declare no conflict of interest., (Copyright © 2017 the Author(s). Published by PNAS.)

The balance between ovarian folliculogenesis and follicular atresia is critical for female fertility and is strictly regulated by a complex network of neuroendocrine and intra-ovarian signals. Despite the numerous functions executed by granulosa cells (GCs) in ovarian physiology, the role of multifunctional proteins able to simultaneously coordinate/modulate several cellular pathways is unclear. Soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (α-SNAP) is a multifunctional protein that participates in SNARE-mediated membrane fusion events. In addition, it regulates cell-to-cell adhesion, AMPK signaling, autophagy and apoptosis in different cell types. In this study we examined the expression pattern of α-SNAP in ovarian tissue and the consequences of α-SNAP (M105I) mutation (hyh mutation) in folliculogenesis and female fertility. Our results showed that α-SNAP protein is highly expressed in GCs and its expression is modulated by gonadotropin stimuli. On the other hand, α-SNAP-mutant mice show a reduction in α-SNAP protein levels. Moreover, increased apoptosis of GCs and follicular atresia, reduced ovulation rate, and a dramatic decline in fertility is observed in α-SNAP-mutant females. In conclusion, α-SNAP plays a critical role in the balance between follicular development and atresia. Consequently, a reduction in its expression/function (M105I mutation) causes early depletion of ovarian follicles and female subfertility.

The cellular machinery required for the fusion of constitutive secretory vesicles with the plasma membrane in metazoans remains poorly defined. To address this problem we have developed a powerful, quantitative assay for measuring secretion and used it in combination with combinatorial gene depletion studies in Drosophila cells. This has allowed us to identify at least three SNARE complexes mediating Golgi to PM transport (STX1, SNAP24/29 and Syb; STX1, SNAP24/29 and YKT6; STX4, SNAP24 and Syb). RNAi mediated depletion of YKT6 and VAMP3 in mammalian cells also blocks constitutive secretion suggesting that YKT6 has an evolutionarily conserved role in this process. The unexpected role of YKT6 in plasma membrane fusion may in part explain why RNAi and gene disruption studies have failed to produce the expected phenotypes in higher eukaryotes.

Proteins with Tetratricopeptide-repeat (TPR) domains are encoded by large gene families and distributed in all plant lineages. In this study, the Soluble NSF-Attachment Protein (SNAP) subfamily of TPR containing proteins is characterized. In soybean, five members constitute the SNAP gene family: GmSNAP18, GmSNAP11, GmSNAP14, GmSNAP02, and GmSNAP09. Recently, GmSNAP18 has been reported to mediate resistance to soybean cyst nematode (SCN). Using a population of recombinant inbred lines from resistant and susceptible parents, the divergence of the SNAP gene family is analysed over time. Phylogenetic analysis of SNAP genes from 22 diverse plant species showed that SNAPs were distributed in six monophyletic clades corresponding to the major plant lineages. Conservation of the four TPR motifs in all species, including ancestral lineages, supports the hypothesis that SNAPs were duplicated and derived from a common ancestor and unique gene still present in chlorophytic algae. Syntenic analysis of regions harbouring GmSNAP genes in soybean reveals that this family expanded from segmental and tandem duplications following a tetraploidization event. qRT-PCR analysis of GmSNAPs indicates a co-regulation following SCN infection. Finally, genetic analysis demonstrates that GmSNAP11 contributes to an additive resistance to SCN. Thus, GmSNAP11 is identified as a novel minor gene conferring resistance to SCN.

Congenital heart disease (CHD) is among the most prevalent and complex congenital anatomic malformations in newborns. Interactions of cardiac progenitor with a broad range of cellular regulatory factors play key roles in the formation of mammalian heart and pathogenesis of CHD. STX18 is a soluble N-ethylmaleimide-sensitive factor attachment protein receptor, which is involved in numeral cellular activities such as organelle assembly and the cell cycle. The aim of this work was to find evidence on whether STX18 variations might be associated with CHD in Chinese Han populations. We evaluated SNPs rs2044, rs33952588, rs61740788, rs12504020 and rs12644497, which are located within the exon or intron sequences of the STX18 gene, for 310 Chinese Han CHD patients and 400 non-CHD controls. Using SPSS software (version 19.0) and the online software OEGE, we conducted statistical analyses and Hardy-Weinberg equilibrium test, respectively. Among the five SNPs identified in the STX18 gene, rs33952588 and rs61740788 had very low genetic heterozygosity. In contrast, the genetic heterozygosity of the remaining three variations rs12504020 and rs12644497 near the 5'UTR and rs2044 within 3'UTR of the STX18 gene was considerably high. Analysis of associations of these genetic variations with the risk of CHD showed that rs12644497 (P value=0.017<0.05) was associated with the risk of CHD, specifically VSD and ASD, whereas rs12504020 (P value=0.560>0.05) and rs2044 (P value=0.972>0.05) were not. The SNP rs12644497 in the STX18 gene was associated with CHD in Chinese Han populations., (Copyright © 2016 Elsevier B.V. All rights reserved.)

α-SNAP [soluble NSF (N-ethylmaleimide-sensitive factor) attachment protein] and NSF proteins are conserved across eukaryotes and sustain cellular vesicle trafficking by mediating disassembly and reuse of SNARE protein complexes, which facilitate fusion of vesicles to target membranes. However, certain haplotypes of the Rhg1 (resistance to Heterodera glycines 1) locus of soybean possess multiple repeat copies of an α-SNAP gene (Glyma.18G022500) that encodes atypical amino acids at a highly conserved functional site. These Rhg1 loci mediate resistance to soybean cyst nematode (SCN; H. glycines), the most economically damaging pathogen of soybeans worldwide. Rhg1 is widely used in agriculture, but the mechanisms of Rhg1 disease resistance have remained unclear. In the present study, we found that the resistance-type Rhg1 α-SNAP is defective in interaction with NSF. Elevated in planta expression of resistance-type Rhg1 α-SNAPs depleted the abundance of SNARE-recycling 20S complexes, disrupted vesicle trafficking, induced elevated abundance of NSF, and caused cytotoxicity. Soybean, due to ancient genome duplication events, carries other loci that encode canonical (wild-type) α-SNAPs. Expression of these α-SNAPs counteracted the cytotoxicity of resistance-type Rhg1 α-SNAPs. For successful growth and reproduction, SCN dramatically reprograms a set of plant root cells and must sustain this sedentary feeding site for 2-4 weeks. Immunoblots and electron microscopy immunolocalization revealed that resistance-type α-SNAPs specifically hyperaccumulate relative to wild-type α-SNAPs at the nematode feeding site, promoting the demise of this biotrophic interface. The paradigm of disease resistance through a dysfunctional variant of an essential gene may be applicable to other plant-pathogen interactions., Competing Interests: The authors declare no conflict of interest.

Neurotransmission is achieved by soluble NSF attachment protein receptor (SNARE)-driven fusion of readily releasable vesicles that are docked and primed at the presynaptic plasma membrane. After neurotransmission, the readily releasable pool of vesicles must be refilled in less than 100 ms for subsequent release. Here we show that the initial association of SNARE complexes, SNAREpins, is far too slow to support this rapid refilling owing to an inherently high activation energy barrier. Our data suggest that acceleration of this process, i.e., lowering of the barrier, is physiologically necessary and can be achieved by molecular factors. Furthermore, under zero force, a low second energy barrier transiently traps SNAREpins in a half-zippered state similar to the partial assembly that engages calcium-sensitive regulatory machinery. This result suggests that the barrier must be actively raised in vivo to generate a sufficient pause in the zippering process for the regulators to set in place. We show that the heights of the activation energy barriers can be selectively changed by molecular factors. Thus, it is possible to modify, both in vitro and in vivo, the lifespan of each metastable state. This controllability provides a simple model in which vesicle docking/priming, an intrinsically slow process, can be substantially accelerated. It also explains how the machinery that regulates vesicle fusion can be set in place while SNAREpins are trapped in a half-zippered state., Competing Interests: The authors declare no conflict of interest.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

Cortical granule exocytosis (CGE), also known as cortical reaction, is a calcium- regulated secretion that represents a membrane fusion process during meiotic cell division of oocytes. The molecular mechanism of membrane fusion during CGE is still poorly understood and is thought to be mediated by the SNARE pathway; nevertheless, it is unkown if SNAP (acronym for soluble NSF attachment protein) and NSF (acronym for N-ethilmaleimide sensitive factor), two key proteins in the SNARE pathway, mediate CGE in any oocyte model. In this paper, we documented the gene expression of α-SNAP, γ-SNAP and NSF in mouse oocytes. Western blot analysis showed that the expression of these proteins maintains a similar level during oocyte maturation and early activation. Their localization was mainly observed at the cortical region of metaphase II oocytes, which is enriched in cortical granules. To evaluate the function of these proteins in CGE we set up a functional assay based on the quantification of cortical granules metaphase II oocytes activated parthenogenetically with strontium. Endogenous α-SNAP and NSF proteins were perturbed by microinjection of recombinant proteins or antibodies prior to CGE activation. The microinjection of wild type α-SNAP and the negative mutant of α-SNAP L294A in metaphase II oocytes inhibited CGE stimulated by strontium. NEM, an irreversibly inhibitor of NSF, and the microinjection of the negative mutant NSF D1EQ inhibited cortical reaction. The microinjection of anti-α-SNAP and anti-NSF antibodies was able to abolish CGE in activated metaphase II oocytes. The microinjection of anti-γ SNAP antibody had no effect on CGE. Our findings indicate, for the first time in any oocyte model, that α-SNAP, γ-SNAP, and NSF are expressed in mouse oocytes. We demonstrate that α-SNAP and NSF have an active role in CGE and propose a working model.

Soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) that reside in the target membranes and transport vesicles assemble into specific SNARE complexes to drive membrane fusion. N-ethylmaleimide-sensitive factor (NSF) and its attachment protein, α-SNAP (encoded by NAPA), catalyze disassembly of the SNARE complexes in the secretory and endocytic pathways to recycle them for the next round of fusion events. γ-SNAP (encoded by NAPG) is a SNAP isoform, but its function in SNARE-mediated membrane trafficking remains unknown. Here, we show that γ-SNAP regulates the endosomal trafficking of epidermal growth factor (EGF) receptor (EGFR) and transferrin. Immunoprecipitation and mass spectrometry analyses revealed that γ-SNAP interacts with a limited range of SNAREs, including endosomal ones. γ-SNAP, as well as α-SNAP, mediated the disassembly of endosomal syntaxin-7-containing SNARE complexes. Overexpression and small interfering (si)RNA-mediated depletion of γ-SNAP changed the morphologies and intracellular distributions of endosomes. Moreover, the depletion partially suppressed the exit of EGFR and transferrin from EEA1-positive early endosomes to delay their degradation and uptake. Taken together, our findings suggest that γ-SNAP is a unique SNAP that functions in a limited range of organelles - including endosomes - and their trafficking pathways., (© 2015. Published by The Company of Biologists Ltd.)

Intracellular vesicular transport is shown to be dysfunctional in pulmonary arterial hypertension (PAH). However, the expression of intracellular vesicular transport proteins in PAH remains unclear. To elucidate the possible role of these proteins in the development of PAH, the changes in the expressions of N-ethyl-maleimide-sensitive factor (NSF), α-soluble NSF attachment protein (α-SNAP), synaptosome-associated membrane protein 23 (SNAP23), type 2 bone morphogenetic receptor (BMPR2), caveolin-1 (cav-1), and endothelial nitric oxide synthase (eNOS) were examined in lung tissues of monocrotaline (MCT)-treated rats by real-time polymerase chain reaction and western blot analysis. In addition, caspase-3, also examined by western blot analysis, was used as an indicator of apoptosis. Our data showed that during the development of PAH, the expressions of NSF, α-SNAP, and SNAP23 were significantly increased before pulmonary arterial pressure started to increase and then significantly decreased after PAH was established. The expressions of BMPR2 and eNOS were similar to those of NSF, α-SNAP, and SNAP23; however, the expression of cav-1 was down-regulated after MCT treatment. Caspase-3 expression was increased after exposure to MCT. In conclusion, the expressions of NSF, α-SNAP, and SNPA23 changed greatly during the onset of PAH, which was accompanied by abnormal expressions of BMPR2, cav-1, and eNOS, as well as an increase in apoptosis. Thus, changes in NSF, α-SNAP, and SNAP23 expressions appear to be mechanistically associated with the development of PAH in MCT-treated rats., (© The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.)

Experiments show the membrane fusion genes α soluble NSF attachment protein (α-SNAP) and syntaxin 31 (Gm-SYP38) contribute to the ability of Glycine max to defend itself from infection by the plant parasitic nematode Heterodera glycines. Accompanying their expression is the transcriptional activation of the defense genes ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1) and NONEXPRESSOR OF PR1 (NPR1) that function in salicylic acid (SA) signaling. These results implicate the added involvement of the antiapoptotic, environmental response gene LESION SIMULATING DISEASE1 (LSD1) in defense. Roots engineered to overexpress the G. max defense genes Gm-α-SNAP, SYP38, EDS1, NPR1, BOTRYTIS INDUCED KINASE1 (BIK1) and xyloglucan endotransglycosylase/hydrolase (XTH) in the susceptible genotype G. max[Williams 82/PI 518671] have induced Gm-LSD1 (Gm-LSD1-2) transcriptional activity. In reciprocal experiments, roots engineered to overexpress Gm-LSD1-2 in the susceptible genotype G. max[Williams 82/PI 518671] have induced levels of SYP38, EDS1, NPR1, BIK1 and XTH, but not α-SNAP prior to infection. In tests examining the role of Gm-LSD1-2 in defense, its overexpression results in ∼52 to 68% reduction in nematode parasitism. In contrast, RNA interference (RNAi) of Gm-LSD1-2 in the resistant genotype G. max[Peking/PI 548402] results in an 3.24-10.42 fold increased ability of H. glycines to parasitize. The results identify that Gm-LSD1-2 functions in the defense response of G. max to H. glycines parasitism. It is proposed that LSD1, as an antiapoptotic protein, may establish an environment whereby the protected, living plant cell could secrete materials in the vicinity of the parasitizing nematode to disarm it. After the targeted incapacitation of the nematode the parasitized cell succumbs to its targeted demise as the infected root region is becoming fortified.

Integrin-based adhesion to the extracellular matrix (ECM) plays critical roles in controlling differentiation, survival, and motility of epithelial cells. Cells attach to the ECM via dynamic structures called focal adhesions (FA). FA undergo constant remodeling mediated by vesicle trafficking and fusion. A soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein α (αSNAP) is an essential mediator of membrane fusion; however, its roles in regulating ECM adhesion and cell motility remain unexplored. In this study, we found that siRNA-mediated knockdown of αSNAP induced detachment of intestinal epithelial cells, whereas overexpression of αSNAP increased ECM adhesion and inhibited cell invasion. Loss of αSNAP impaired Golgi-dependent glycosylation and trafficking of β1 integrin and decreased phosphorylation of focal adhesion kinase (FAK) and paxillin resulting in FA disassembly. These effects of αSNAP depletion on ECM adhesion were independent of apoptosis and NSF. In agreement with our previous reports that Golgi fragmentation mediates cellular effects of αSNAP knockdown, we found that either pharmacologic or genetic disruption of the Golgi recapitulated all the effects of αSNAP depletion on ECM adhesion. Furthermore, our data implicates β1 integrin, FAK, and paxillin in mediating the observed pro-adhesive effects of αSNAP. These results reveal novel roles for αSNAP in regulating ECM adhesion and motility of epithelial cells.

Vesicle trafficking in eukaryotic cells is facilitated by SNARE-mediated membrane fusion. The ATPase NSF (N-ethylmaleimide-sensitive factor) and the adaptor protein α-SNAP (soluble NSF attachment protein) disassemble all SNARE complexes formed throughout different pathways, but the effect of SNARE sequence and domain variation on the poorly understood disassembly mechanism is unknown. By measuring SNARE-stimulated ATP hydrolysis rates, Michaelis-Menten constants for disassembly, and SNAP-SNARE binding constants for four different ternary SNARE complexes and one binary complex, we found a conserved mechanism, not influenced by N-terminal SNARE domains. α-SNAP and the ternary SNARE complex form a 1:1 complex as revealed by multiangle light scattering. We propose a model of NSF-mediated disassembly in which the reaction is initiated by a 1:1 interaction between α-SNAP and the ternary SNARE complex, followed by NSF binding. Subsequent additional α-SNAP binding events may occur as part of a processive disassembly mechanism.

Intracellular vesicular transport is important for photoreceptor function and maintenance. However, the mechanism underlying photoreceptor degeneration in response to vesicular transport defects is unknown. Here, we report that photoreceptors undergo apoptosis in a zebrafish β-soluble N-ethylmaleimide-sensitive factor attachment protein (β-SNAP) mutant. β-SNAP cooperates with N-ethylmaleimide-sensitive factor to recycle the SNAP receptor (SNARE), a key component of the membrane fusion machinery, by disassembling the cis-SNARE complex generated in the vesicular fusion process. We found that photoreceptor apoptosis in the β-SNAP mutant was dependent on the BH3-only protein BNip1. BNip1 functions as a component of the syntaxin-18 SNARE complex and regulates retrograde transport from the Golgi to the endoplasmic reticulum. Failure to disassemble the syntaxin-18 cis-SNARE complex caused BNip1-dependent apoptosis. These data suggest that the syntaxin-18 cis-SNARE complex functions as an alarm factor that monitors vesicular fusion competence and that BNip1 transforms vesicular fusion defects into photoreceptor apoptosis., (Copyright © 2013 Elsevier Inc. All rights reserved.)

Autophagy is a catabolic process that sequesters intracellular proteins and organelles within membrane vesicles called autophagosomes with their subsequent delivery to lyzosomes for degradation. This process involves multiple fusions of autophagosomal membranes with different vesicular compartments; however, the role of vesicle fusion in autophagosomal biogenesis remains poorly understood. This study addresses the role of a key vesicle fusion regulator, soluble N-ethylmaleimide-sensitive factor attachment protein α (αSNAP), in autophagy. Small interfering RNA-mediated downregulation of αSNAP expression in cultured epithelial cells stimulated the autophagic flux, which was manifested by increased conjugation of microtubule-associated protein light chain 3 (LC3-II) and accumulation of LC3-positive autophagosomes. This enhanced autophagy developed via a non-canonical mechanism that did not require beclin1-p150-dependent nucleation, but involved Atg5 and Atg7-mediated elongation of autophagosomal membranes. Induction of autophagy in αSNAP-depleted cells was accompanied by decreased mTOR signaling but appeared to be independent of αSNAP-binding partners, N-ethylmaleimide-sensitive factor and BNIP1. Loss of αSNAP caused fragmentation of the Golgi and downregulation of the Golgi-specific GTP exchange factors, GBF1, BIG1 and BIG2. Pharmacological disruption of the Golgi and genetic inhibition of GBF1 recreated the effects of αSNAP depletion on the autophagic flux. Our study revealed a novel role for αSNAP as a negative regulator of autophagy that acts by enhancing mTOR signaling and regulating the integrity of the Golgi complex.

The rhg1-b allele of soybean is widely used for resistance against soybean cyst nematode (SCN), the most economically damaging pathogen of soybeans in the United States. Gene silencing showed that genes in a 31-kilobase segment at rhg1-b, encoding an amino acid transporter, an α-SNAP protein, and a WI12 (wound-inducible domain) protein, each contribute to resistance. There is one copy of the 31-kilobase segment per haploid genome in susceptible varieties, but 10 tandem copies are present in an rhg1-b haplotype. Overexpression of the individual genes in roots was ineffective, but overexpression of the genes together conferred enhanced SCN resistance. Hence, SCN resistance mediated by the soybean quantitative trait locus Rhg1 is conferred by copy number variation that increases the expression of a set of dissimilar genes in a repeated multigene segment.

Transcriptional mapping experiments of the major soybean cyst nematode resistance locus, rhg1, identified expression of the vesicular transport machinery component, α soluble NSF attachment protein (α-SNAP), occurring during defense. Sequencing the α-SNAP coding regions from the resistant genotypes G. max ([Peking/PI 548402]) and G. max ([PI 437654]) revealed they are identical, but differ from the susceptible G. max ([Williams 82/PI 518671]) by the presence of several single nucleotide polymorphisms. Using G. max ([Williams 82/PI 518671]) as a reference, a G → T(2,822) transversion in the genomic DNA sequence at a functional splice site of the α-SNAP([Peking/PI 548402]) allele produced an additional 17 nucleotides of mRNA sequence that contains an in-frame stop codon caused by a downstream G → A(2,832) transition. The G. max ([Peking/PI 548402]) genotype has cell wall appositions (CWAs), structures identified as forming as part of a defense response by the activity of the vesicular transport machinery. In contrast, the 17 nt α-SNAP([Peking/PI 548402]) mRNA motif is not found in G. max ([PI 88788]) that exhibits defense to H. glycines, but lack CWAs. The α-SNAP([PI 88788]) promoter contains sequence elements that are nearly identical to the α-SNAP([Peking/PI 548402]) allele, but differs from the G. max ([Williams 82/PI 518671]) ortholog. Overexpressing the α-SNAP([Peking/PI 548402]) allele in the susceptible G. max ([Williams 82/PI 518671]) genotype suppressed H. glycines infection. The experiments indicate a role for the vesicular transport machinery during infection of soybean by the soybean cyst nematode. However, increased GmEREBP1, PR1, PR2, PR5 gene activity but suppressed PR3 expression accompanied the overexpression of the α-SNAP([Peking/PI 548402]) allele prior to infection.

Intracellular trafficking represents a key mechanism that regulates cell fate by participating in either prodeath or prosurvival signaling. Soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein α (αSNAP) is a well known component of vesicle trafficking machinery that mediates intermembrane fusion. αSNAP increases cell resistance to cytotoxic stimuli, although mechanisms of its prosurvival function are poorly understood. In this study, we found that either siRNA-mediated knockdown of αSNAP or expression of its dominant negative mutant induced epithelial cell apoptosis. Apoptosis was not caused by activation of the major prodeath regulators Bax and p53 and was independent of a key αSNAP binding partner, NSF. Instead, death of αSNAP-depleted cells was accompanied by down-regulation of the antiapoptotic Bcl-2 protein; it was mimicked by inhibition and attenuated by overexpression of Bcl-2. Knockdown of αSNAP resulted in impairment of Golgi to endoplasmic reticulum (ER) trafficking and fragmentation of the Golgi. Moreover, pharmacological disruption of ER-Golgi transport by brefeldin A and eeyarestatin 1 or siRNA-mediated depletion of an ER/Golgi-associated p97 ATPase recapitulated the effects of αSNAP inhibition by decreasing Bcl-2 level and triggering apoptosis. These results reveal a novel role for αSNAP in promoting epithelial cell survival by unique mechanisms involving regulation of Bcl-2 expression and Golgi biogenesis.

Tight junctions (TJs) and adherens junctions (AJs) are key determinants of the structure and permeability of epithelial barriers. Although exocytic delivery to the cell surface is crucial for junctional assembly, little is known about the mechanisms controlling TJ and AJ exocytosis. This study was aimed at investigating whether a key mediator of exocytosis, soluble N-ethylmaleimide sensitive factor (NSF) attachment protein alpha (αSNAP), regulates epithelial junctions. αSNAP was enriched at apical junctions in SK-CO15 and T84 colonic epithelial cells and in normal human intestinal mucosa. siRNA-mediated knockdown of αSNAP inhibited AJ/TJ assembly and establishment of the paracellular barrier in SK-CO15 cells, which was accompanied by a significant down-regulation of p120-catenin and E-cadherin expression. A selective depletion of p120 catenin effectively disrupted AJ and TJ structure and compromised the epithelial barrier. However, overexpression of p120 catenin did not rescue the defects of junctional structure and permeability caused by αSNAP knockdown thereby suggesting the involvement of additional mechanisms. Such mechanisms did not depend on NSF functions or induction of cell death, but were associated with disruption of the Golgi complex and down-regulation of a Golgi-associated guanidine nucleotide exchange factor, GBF1. These findings suggest novel roles for αSNAP in promoting the formation of epithelial AJs and TJs by controlling Golgi-dependent expression and trafficking of junctional proteins.

The persistent or excess activation of NF-κB causes various inflammatory and autoimmune diseases, but the molecular mechanisms that negatively regulate NF-κB activation are not fully understood. Here we show that p47, an essential factor for Golgi membrane fusion, associates with the NEMO subunit of the IκB kinase (IKK) complex upon TNF-α or IL-1 stimulation, and inhibits IKK activation. p47 binds to Lys63-linked and linear polyubiquitin chains, which are conjugated to NEMO upon such stimulation. The binding of p47 to polyubiquitinated NEMO triggers the lysosomal degradation of NEMO, thereby inhibiting IKK activation. The silencing of p47 results in enhanced TNF-α- or IL-1-induced IKK activation, and an increased expression of genes encoding inflammatory mediators. Taken together, our results suggest that p47 is critical for negatively regulating stimulation-induced IKK activation in a manner that is mechanistically distinct from the previously characterized negative regulators, such as A20 and CYLD.

The endoplasmic reticulum-localized non-receptor protein-tyrosine phosphatase 1B (PTP1B) is associated with oncogenic, metabolic, and cytokine-related signaling and functionally targets multiple receptor tyrosine kinases (RTKs) for dephosphorylation. Loss of PTP1B activity leads to enhanced ligand-dependent biological activity of the Met RTK among others. Here, we demonstrate that knockdown of PTP1B or expression of a PTP1B trapping aspartic acid-to-alanine substitution (D/A) mutant delayed ligand-induced degradation of the Met and EGF RTKs. Loss of PTP1B function abrogated trafficking of Met and EGF receptor to Rab5- and phosphatidylinositol 3-phosphate (Pl3P)-positive early endosomes and subsequent trafficking through the degradative pathway. Under these conditions, internalization of the Met and EGF receptors was unaltered, suggesting a block at the level of early endosome formation. We show that the N-ethylmaleimide-sensitive factor (NSF), an essential component of the vesicle fusion machinery, was hyperphosphorylated in PTP1B knockdown or PTP1B D/A-expressing cells and was a target for PTP1B. NSF knockdown phenocopied PTP1B knockdown, demonstrating a mechanism through which PTP1B regulates endocytic trafficking. Finally, we show that PTP1B dephosphorylated NSF and that this interaction was required for physiological RTK trafficking and appropriate attenuation of downstream signaling.

Expression of the oncogenic latent membrane protein 1 (LMP1) of Epstein-Barr virus is involved in the pathogenesis of nasopharyngeal carcinoma (NPC) and lymphoma. In previous studies, we found that expression of LMP1 was sufficient to transform BALB/c-3T3 cells. In contrast, other studies have shown that LMP1 induces apoptosis in a NF-κB-dependent manner and also inhibits the growth of tumors in mice, thereby indicating that LMP1 may produce various biological effects depending on the biological and cellular context. Still, the mechanism underlying the pro-apoptotic activity of LMP1 remains unclear. In the present study, we found that LMP1 inhibits the expression of NAPA, an endoplasmic reticulum SNARE protein that possesses anti-apoptotic properties against the DNA-damaging drug cisplatin. Accordingly, LMP1-transformed BALB/c-3T3 cells were sensitized to cisplatin-induced apoptosis, whereas no sensitization effect was noted following treatment with the mitotic spindle-damaging drugs vincristine and taxol. Knockdown of LMP1 with antisense oligonucleotides restored NAPA protein level and rendered the cells resistant to cisplatin. Similarly, overexpression of NAPA reduced the effect of LMP1 and induced resistance to cisplatin. LMP1 was shown to upregulate the NF-κB subunit p50, leading to formation of p50 homodimers on the NAPA promoter. These findings suggest that the viral protein LMP1 may sensitize cancer cells to cisplatin chemotherapy by downregulating NAPA and by enhancing the formation of p50 homodimers which in turn inhibit the expression of NF-κB regulated anti-apoptotic genes. These findings provide an explanatory mechanism for the pro-apoptotic activity of LMP1 as well as new therapeutic targets to control tumor growth., (Copyright © 2011 Elsevier Inc. All rights reserved.)

We found earlier that NAPA represents an anti-apoptotic protein that promotes resistance to cisplatin in cancer cells by inducing the degradation of the tumor suppressor p53. In the present study, we investigated the cellular mechanism underlying the degradation of p53 by NAPA. Knockdown of NAPA using short-hairpin RNA was shown to induce p53 accumulation and to sensitize HEK293 cells to cisplatin. On the other hand, this sensitization effect was not found in H1299 lung carcinoma cells which lack p53. Expression of exogenous p53 in H1299 cells was increased following knockdown of NAPA and these cells showed increased sensitivity to cisplatin-induced apoptosis. Notably, knockdown of NAPA induced the ubiquitination and degradation of the E3 ubiquitin ligase synoviolin and the accumulation of p53 in unstressed HEK293 cells. Conversely, NAPA overexpression decreased the ubiquitination and degradation of synoviolin, and reduced p53 protein level. Knockdown of NAPA disrupted the interaction between synoviolin and proteins that form the endoplasmic reticulum-associated degradation (ERAD) complex and in turn decreased the ability of this complex to ubiquitinate p53. In addition, knockdown of NAPA induced the activation of the MAPK kinases ERK, JNK and p38, but only inhibition of ERK reduced synoviolin ubiquitination and p53 accumulation. These results indicate that NAPA promotes resistance to cisplatin through synoviolin and the ERAD complex which together induce the degradation of p53 and thus prevent apoptosis. Based on these findings, we propose that the combination of cisplatin and knockdown of NAPA represents a novel and attractive strategy to eradicate p53-sensitive cancer cells., (Copyright © 2011 Elsevier Inc. All rights reserved.)

Retrograde vesicular transport from the Golgi to the ER requires the Dsl1 tethering complex, which consists of the three subunits Dsl1, Dsl3, and Tip20. It forms a stable complex with the SNAREs Ufe1, Use1, and Sec20 to mediate fusion of COPI vesicles with the endoplasmic reticulum. Here, we analyze molecular interactions between five SNAREs of the ER (Ufe1, Use1, Sec20, Sec22, and Ykt6) and the Dsl1 complex in vitro and in vivo. Of the two R-SNAREs, Sec22 is preferred over Ykt6 in the Dsl-SNARE complex. The NSF homolog Sec18 can displace Ykt6 but not Sec22, suggesting a regulatory function for Ykt6. In addition, our data also reveal that subunits of the Dsl1 complex (Dsl1, Dsl3, and Tip20), as well as the SNAREs Ufe1 and Sec20, are ER-resident proteins that do not seem to move into COPII vesicles. Our data support a model, in which a tethering complex is stabilized at the organelle membrane by binding to SNAREs, recognizes the incoming vesicle via its coat and then promotes its SNARE-mediated fusion.

As core components of the neurotransmitter release apparatus, SNAREs, NSF and SNAPs mediate fusion of neurotransmitter-filled synaptic vesicles within specialized regions of the presynaptic plasma membrane known as active zones (AZs). The present study combines genetic approaches in Drosophila with biochemical and live-imaging methods to provide new insights into the in vivo behavior and interactions of NSF and SNAP in neurotransmitter release. This work employs a temperature-sensitive (TS) paralytic NSF mutant, comatose, to show that disruption of NSF function results in activity-dependent redistribution of NSF and SNAP to periactive zone (PAZ) regions of the presynaptic plasma membrane and accumulation of protein complexes containing SNAREs, NSF and SNAP. Fluorescence Resonance Energy Transfer (FRET) and Fluorescence Recovery After Photobleaching (FRAP) studies in comatose revealed that NSF and SNAP exhibit activity-dependent binding to each other within living presynaptic terminals as well as distinctive interactions and mobilities. These observations extend current models describing the spatial organization of NSF, SNAP and SNARE proteins in synaptic vesicle trafficking., (Copyright © 2011 Elsevier Inc. All rights reserved.)

p47, a p97-binding protein, functions in Golgi membrane fusion together with p97 and VCIP135, another p97-binding protein. We have succeeded in creating p47 with a point mutation, F253S, which lacks p97-binding affinity. p47 mapping experiments revealed that p47 had two p97-binding regions and the F253S mutation occurred in the first p97-binding site. p47(F253S) could not form a complex with p97 and did not caused any cisternal regrowth in an in vitro Golgi reassembly assay. In addition, mutation corresponding to the p47 F253S mutation in p37 and ufd1 also abolished their binding ability to p97., (Copyright © 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.)

Cisplatin is a widely used anti-cancer drug which targets DNA in replicating cells. In the present study, we found that NAPA--a protein found in the endoplasmic reticulum (ER) and implicated in protein trafficking--protects cells against cisplatin. Accordingly, knockdown of NAPA using lentivirus-encoded shRNA (shNAPA) induced ER stress similar to cisplatin treatment in HEK293 cells. A low dose of cisplatin also elicited a mild ER stress response associated with the accumulation of the protective proteins BiP and NAPA. Remarkably, knockdown of NAPA induced apoptosis and enhanced cisplatin-induced cytotoxicity/apoptosis, thereby sensitizing cancer cells to cisplatin. On the other hand, overexpression of NAPA increased resistance to cisplatin by reducing cisplatin-induced ER stress and apoptosis. The modulatory effects of shNAPA required the tumor suppressor p53 since the effects of NAPA knockdown were reduced by the p53 inhibitor PFT-alpha and in H1299 cells which are p53-null. A partial reversal of cisplatin resistance was also observed in cisplatin-resistant HeLa cells following knockdown of NAPA. Our results also indicated that calpain is required for ER-mediated apoptosis. Importantly, combined cisplatin/shNAPA treatment suppressed tumor growth in vivo in xenograph experiments performed in nude mice. Taken together, these observations suggest that NAPA represents a target of cisplatin, and that knockdown of NAPA may improve cisplatin-based cancer therapy.