Search

Taking food safety culture into account is a promising way to improve food safety performance in the food industry. Food safety culture (FS-culture) research is expanding from an organisational perspective to include characteristics of the internal and external company environment. In this study, the prevailing food safety culture in 17 food companies from four countries on three continents (Africa, Asia and Europe) was assessed in view of food safety governance and national values. The internal environment characteristics, i.e. food safety vision, food safety program and food production system vulnerability, were also assessed. Statistical analysis revealed little variation in FS-culture scores between the companies within the same country. Overall the FS- culture for Greek and Zambian companies was scored proactive, while for Chinese and Tanzanian companies an active score was achieved. Both the internal and external company environment seemed to influence the pre- vailing FS-culture. Cluster analysis showed that Tanzanian and Zambian companies exhibited similarities in the implementation of food safety programs, and in their national values and food safety governance as compared to Greece and China. Food safety governance was reflected in the food safety programs and supportiveness of the organisation to food safety and hygiene. All cultural dimensions were correlated with risk perceptions, with masculinity and long-term orientation also significantly correlated with the enabling conditions and attitude. Understanding how national values and food safety governance approaches differently influence food safety culture is expected to enable formulation of best approaches tailored for companies operating in countries with different company environments, to improve food safety performance.

Water quality is an important aspect in human health, as the majority of infectious diseases that cause morbidity and mortality in population are water related. The present study was undertaken to assess the quality of water in Kingolwira, Morogoro Rural District, Tanzania. Water was collected from different sites in the village and analysed for a period of six months. Physical, chemical and microbiological qualities of water were examined. The pH of the water ranged from 7.02 to 7.20 and the water temperature ranged from 25.7&#176C to 27.0&#176C. The total dissolved solids of the water samples ranged from 110 to 510 ppm. The water contained considerable levels of lead and copper ranging from 0.034 to 0.090 ppm and 0.022 to 0.030 ppm, respectively. Total water hardness ranged from 19.60 to 228.10 ppm as calcium carbonate. The total viable counts and faecal coliform counts ranged from 2.75x103 to 5.4 x 103 c.f.u/ml and 0.93 x102 to 2.1x102 counts/100ml, respectively. Overall, water supplies in the village were judged as of poor quality. Water is usually used for domestic purposes including cooking, drinking, washing and preparation of infant foods without any treatment. In conclusion therefore, water in Kingolwira village is of poor quality and needs to be treated before consumption. Theres is also a need for the rural population to be educated on hazards of using untreated water. In general, sanitary facilities in rural areas in Tanzania need to be improved in order to avoid health hazards. Keywords: water, quality, health, Tanzania Tanzania Health Research Bulletin Vol. 9 (1) 2007: pp. 56-60

International audience; EFECAB (Epidémiologie et Fardeau Économique de la Cysticercosis au Burkina) was initiated in 2006 with a grant funded through the Brain Disorders in the developing world - Research Across the lifespan program of the National Institutes of Health in the United States (R21NS055353) followed by a more substantial grant in 2010 (R01NS064901). The pilot grant showed that human and porcine cysticercosis were not only present in Burkina Faso, but more prevalent in two of three pilot villages. A cluster randomized controlled trial was subsequently conducted to estimate the effectiveness of a community-based educational intervention to reduce the frequency of cysticercosis in 60 villages located in 3 provinces where pigs were raised. The intervention was developed using an implementation research method which resulted in offering the Participatory Hygiene And Sanitation Transformation - Self-esteem Associative strengths Resourcefulness Action planning Responsibility approach, adapted for cysticercosis, and the viewing of a 52-minutes comedy movie explaining the disease and ways to prevent it to the 30 intervention villages. In each village, 60 of 80 participants accepted to provide a blood sample on three occasions over a three year period. Blood samples were analysed with the B158/B60 AgELISA test to detect active cysticercosis. Data were analysed using Bayesian hierarchical log-binomial models adjusting for the clustering of cysticercosis by village, the change in cysticercosis prevalence prior to randomization and the fact that the intervention was offered at the village level. The intervention reduced the prevalence and cumulative incidence of active cysticercosis in 2 provinces, but had no or little impact in the 3rd province. Answers to other research questions regarding factors associated with cysticercosis, measurement of epilepsy and headaches in resource-poor settings, and the cross-reaction of the AgELISA test with T. hydatigena in pigs will be summarized.

International audience; Building inclusive businesses with small-scale producers in the agro-food sector presents challenges, most notably in terms of governance and sustainability. These issues were explored through a Danone Egypt Ecosystem Project that sought to promote a replicable business model of milk collection centers to secure a dairy plant's sourcing while contributing to the socio-economic development of smallholders. Quality management was used to link a value chain approach and a localised agri-food system approach. The study showed that an inclusive business relying on non-inclusive coordination had limited efficiency. Decreasing power asymmetries and distances between partners seems central to ensuring sustainability.

Made available in DSpace on 2022-05-01T10:19:00Z (GMT). No. of bitstreams: 0 Previous issue date: 2021-12-01 Background: Arthropod-borne pathogens and their vectors are present throughout Africa. They have been well-studied in livestock of sub-Saharan Africa, but poorly in companion animals. Given the socio-economic importance of companion animals, the African Small Companion Animal Network (AFSCAN), as part of the WSAVA Foundation, initiated a standardized multi-country surveillance study. Methods: Macro-geographic variation in ectoparasite (ticks and fleas) and pathogen communities in dogs was assessed through molecular screening of approximately 100 infested dogs in each of six countries (Ghana, Kenya, Nigeria, Tanzania, Uganda and Namibia), both in rural and urban settings. The most important intrinsic and extrinsic risk factors within the subpopulation of infested dogs were evaluated. Results: Despite the large macro-geographic variation in the dogs screened, there was no consistent difference between East and West Africa in terms of the diversity and numbers of ticks. The highest and lowest numbers of ticks were found in Nigeria and Namibia, respectively. Most often, there was a higher diversity of ticks in rural habitats than in urban habitats, although the highest diversity was observed in an urban Uganda setting. With the exception of Namibia, more fleas were collected in rural areas. We identified tick species (including Haemaphysalis spinulosa) as well as zoonotic pathogens (Coxiella burnetti, Trypanosoma spp.) that are not classically associated with companion animals. Rhipicephalus sanguineus was the most abundant tick, with a preference for urban areas. Exophilic ticks, such as Haemaphysalis spp., were more often found in rural areas. Several multi-host ticks occurred in urban areas. For R. sanguineus, housing conditions and additional pets were relevant factors in terms of infestation, while for a rural tick species (Haemaphysalis elliptica), free-roaming dogs were more often infested. Tick occurrence was associated to the use of endoparasiticide, but not to the use of ectoparasiticide. The most prevalent tick-borne pathogen was Hepatozoon canis followed by Ehrlichia canis. High levels of co-parasitism were observed in all countries and habitats. Conclusions: As dogs share a common environment with people, they have the potential to extend the network of pathogen transmission to humans. Our study will help epidemiologists to provide recommendations for surveillance and prevention of pathogens in dogs and humans. Graphical abstract: [Figure not available: see fulltext.]. Eco-Epidemiology Group Department of Biomedical Sciences Institute of Tropical Medicine Interuniversity Institute for Biostatistics and Statistical Bioinformatics Hasselt University Department of Ecology and Evolutionary Biology Princeton University School of Veterinary and Life Sciences Murdoch University Bayer Animal Health Elanco Animal Health Inc. Clinvet LLC ClinVet International (Pty) Ltd. Clinomics School of Veterinary Medicine College of Basic and Applied Sciences (CBAS) University of Ghana Department of Veterinary Pathology Microbiology and Parasitology University of Nairobi Department of Veterinary Parasitology and Entomology College of Veterinary Medicine Federal University of Agriculture Sokoine University of Agriculture Research Center for Tropical Diseases and Vector Control College of Veterinary Medicine Animal Resources and Biosecurity Makerere University School of Veterinary Medicine University of Namibia, Neudamm São Paulo State University University of Pretoria Clinglobal São Paulo State University

International audience; AbstractOBJECTIVES:The objective of this study was to assess knowledge, beliefs, attitudes, and practices regarding epilepsy and neurocysticercosis in the rural areas of Burkina Faso.MATERIALS:The interviews were designed to assess general perception of epilepsy, cultural beliefs and practices regarding epilepsy and people with epilepsy (PWE), and knowledge about the link between human epilepsy and porcine cysticercosis. This qualitative study used in-depth interviews with different categories of community members, including PWE, healthcare providers (HCPs), and traditional healers in three villages in rural Burkina Faso.RESULTS:All respondents showed a good knowledge of epilepsy symptoms but very little knowledge on causes of the disease. In this community, epilepsy was often associated with witchcraft (commonly termed "black magic"). People with epilepsy were marginalized and denied certain rights such as school education and marriage. They also relied mainly on traditional medicine with a prominent role played by traditional healers. While medical personnel knew that controlling seizures would depend on the cause, the traditional healers reported to be able to cure all kinds of epilepsy as long as the patient adhered to taboos. The main "treatments" prescribed by traditional healers were to stay away from fire and refrain from pork consumption. Pork fat was believed to reduce the effectiveness of the traditional medicine.CONCLUSION:For effective monitoring and management of epilepsy in Burkina Faso, there is a need to promote better knowledge of the disease in the community, including HCPs, and traditional healers.

Made available in DSpace on 2021-06-25T11:16:28Z (GMT). No. of bitstreams: 0 Previous issue date: 2021-01-01 Agence Nationale Des Parcs Nationaux Centre for International Forestry Research Departamento Administrativo de Ciencia, Tecnología e Innovación (COLCIENCIAS) David and Lucile Packard Foundation European Space Agency Leverhulme Trust Gordon and Betty Moore Foundation Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) Fundação de Amparo à Pesquisa do Estado de Goiás European Research Council Belgian Federal Science Policy Office Vlaamse Interuniversitaire Raad Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) National Science Foundation Natural Environment Research Council Royal Society National Geographic Society Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Tropical forests are the most diverse and productive ecosystems on Earth. While better understanding of these forests is critical for our collective future, until quite recently efforts to measure and monitor them have been largely disconnected. Networking is essential to discover the answers to questions that transcend borders and the horizons of funding agencies. Here we show how a global community is responding to the challenges of tropical ecosystem research with diverse teams measuring forests tree-by-tree in thousands of long-term plots. We review the major scientific discoveries of this work and show how this process is changing tropical forest science. Our core approach involves linking long-term grassroots initiatives with standardized protocols and data management to generate robust scaled-up results. By connecting tropical researchers and elevating their status, our Social Research Network model recognises the key role of the data originator in scientific discovery. Conceived in 1999 with RAINFOR (South America), our permanent plot networks have been adapted to Africa (AfriTRON) and Southeast Asia (T-FORCES) and widely emulated worldwide. Now these multiple initiatives are integrated via ForestPlots.net cyber-infrastructure, linking colleagues from 54 countries across 24 plot networks. Collectively these are transforming understanding of tropical forests and their biospheric role. Together we have discovered how, where and why forest carbon and biodiversity are responding to climate change, and how they feedback on it. This long-term pan-tropical collaboration has revealed a large long-term carbon sink and its trends, as well as making clear which drivers are most important, which forest processes are affected, where they are changing, what the lags are, and the likely future responses of tropical forests as the climate continues to change. By leveraging a remarkably old technology, plot networks are sparking a very modern revolution in tropical forest science. In the future, humanity can benefit greatly by nurturing the grassroots communities now collectively capable of generating unique, long-term understanding of Earth's most precious forests. Resumen: Los bosques tropicales son los ecosistemas más diversos y productivos del mundo y entender su funcionamiento es crítico para nuestro futuro colectivo. Sin embargo, hasta hace muy poco, los esfuerzos para medirlos y monitorearlos han estado muy desconectados. El trabajo en redes es esencial para descubrir las respuestas a preguntas que trascienden las fronteras y los plazos de las agencias de financiamiento. Aquí mostramos cómo una comunidad global está respondiendo a los desafíos de la investigación en ecosistemas tropicales a través de diversos equipos realizando mediciones árbol por árbol en miles de parcelas permanentes de largo plazo. Revisamos los descubrimientos más importantes de este trabajo y discutimos cómo este proceso está cambiando la ciencia relacionada a los bosques tropicales. El enfoque central de nuestro esfuerzo implica la conexión de iniciativas locales de largo plazo con protocolos estandarizados y manejo de datos para producir resultados que se puedan trasladar a múltiples escalas. Conectando investigadores tropicales, elevando su posición y estatus, nuestro modelo de Red Social de Investigación reconoce el rol fundamental que tienen, para el descubrimiento científico, quienes generan o producen los datos. Concebida en 1999 con RAINFOR (Suramérica), nuestras redes de parcelas permanentes han sido adaptadas en África (AfriTRON) y el sureste asiático (T-FORCES) y ampliamente replicadas en el mundo. Actualmente todas estas iniciativas están integradas a través de la ciber-infraestructura de ForestPlots.net, conectando colegas de 54 países en 24 redes diferentes de parcelas. Colectivamente, estas redes están transformando nuestro conocimiento sobre los bosques tropicales y el rol de éstos en la biósfera. Juntos hemos descubierto cómo, dónde y porqué el carbono y la biodiversidad de los bosques tropicales está respondiendo al cambio climático y cómo se retroalimentan. Esta colaboración pan-tropical de largo plazo ha expuesto un gran sumidero de carbono y sus tendencias, mostrando claramente cuáles son los factores más importantes, qué procesos se ven afectados, dónde ocurren los cambios, los tiempos de reacción y las probables respuestas futuras mientras el clima continúa cambiando. Apalancando lo que realmente es una tecnología antigua, las redes de parcelas están generando una verdadera y moderna revolución en la ciencia tropical. En el futuro, la humanidad puede beneficiarse enormemente si se nutren y cultivan comunidades de investigadores de base, actualmente con la capacidad de generar información única y de largo plazo para entender los que probablemente son los bosques más preciados de la tierra. Resumo: Florestas tropicais são os ecossistemas mais diversos e produtivos da Terra. Embora uma boa compreensão destas florestas seja crucial para o nosso futuro coletivo, até muito recentemente os esforços de medições e monitoramento foram amplamente desconexos. É essencial formarmos redes para obtermos respostas que transcendem fronteiras e horizontes de agências financiadoras. Neste estudo nós mostramos como uma comunidade global está respondendo aos desafios da pesquisa de ecossistemas tropicais, com equipes diversas medindo florestas, árvore por árvore, em milhares de parcelas monitoradas à longo prazo. Nós revisamos as maiores descobertas científicas deste trabalho, e mostramos também como este processo está mudando a ciência de florestas tropicais. Nossa abordagem principal envolve unir iniciativas de base a protocolos padronizados e gerenciamento de dados a fim de gerar resultados robustos em escalas ampliadas. Ao conectar pesquisadores tropicais e elevar seus status, nosso modelo de Rede de Pesquisa Social reconhece o papel-chave do produtor dos dados na descoberta científica. Concebida em 1999 com o RAINFOR (América do Sul), nossa rede de parcelas permanentes foi adaptada para África (AfriTRON) e Sudeste asiático (T-FORCES), e tem sido extensamente reproduzida em todo o mundo. Agora estas múltiplas iniciativas estão integradas através de uma infraestrutura cibernética do ForestPlots.net, conectando colegas de 54 países de 24 redes de parcelas. Estas iniciativas estão transformando coletivamente o entendimento das florestas tropicais e seus papéis na biosfera. Juntos nós descobrimos como, onde e por que o carbono e a biodiversidade da floresta estão respondendo às mudanças climáticas, e seus efeitos de retroalimentação. Esta duradoura colaboração pantropical revelou um grande sumidouro de carbono persistente e suas tendências, assim como tem evidenciado quais direcionadores são mais importantes, quais processos florestais são mais afetados, onde eles estão mudando, seus atrasos no tempo de resposta, e as prováveis respostas das florestas tropicais conforme o clima continua a mudar. Dessa forma, aproveitando uma notável tecnologia antiga, redes de parcelas acendem faíscas de uma moderna revolução na ciência das florestas tropicais. No futuro a humanidade pode se beneficiar incentivando estas comunidades basais que agora são coletivamente capazes de gerar conhecimentos únicos e duradouros sobre as florestas mais preciosas da Terra. Résume: Les forêts tropicales sont les écosystèmes les plus diversifiés et les plus productifs de la planète. Si une meilleure compréhension de ces forêts est essentielle pour notre avenir collectif, jusqu'à tout récemment, les efforts déployés pour les mesurer et les surveiller ont été largement déconnectés. La mise en réseau est essentielle pour découvrir les réponses à des questions qui dépassent les frontières et les horizons des organismes de financement. Nous montrons ici comment une communauté mondiale relève les défis de la recherche sur les écosystèmes tropicaux avec diverses équipes qui mesurent les forêts arbre après arbre dans de milliers de parcelles permanentes. Nous passons en revue les principales découvertes scientifiques de ces travaux et montrons comment ce processus modifie la science des forêts tropicales. Notre approche principale consiste à relier les initiatives de base à long terme à des protocoles standardisés et une gestion de données afin de générer des résultats solides à grande échelle. En reliant les chercheurs tropicaux et en élevant leur statut, notre modèle de réseau de recherche sociale reconnaît le rôle clé de l'auteur des données dans la découverte scientifique. Conçus en 1999 avec RAINFOR (Amérique du Sud), nos réseaux de parcelles permanentes ont été adaptés à l'Afrique (AfriTRON) et à l'Asie du Sud-Est (T-FORCES) et largement imités dans le monde entier. Ces multiples initiatives sont désormais intégrées via l'infrastructure ForestPlots.net, qui relie des collègues de 54 pays à travers 24 réseaux de parcelles. Ensemble, elles transforment la compréhension des forêts tropicales et de leur rôle biosphérique. Ensemble, nous avons découvert comment, où et pourquoi le carbone forestier et la biodiversité réagissent au changement climatique, et comment ils y réagissent. Cette collaboration pan-tropicale à long terme a révélé un important puits de carbone à long terme et ses tendances, tout en mettant en évidence les facteurs les plus importants, les processus forestiers qui sont affectés, les endroits où ils changent, les décalages et les réactions futures probables des forêts tropicales à mesure que le climat continue de changer. En tirant parti d'une technologie remarquablement ancienne, les réseaux de parcelles déclenchent une révolution très moderne dans la science des forêts tropicales. À l'avenir, l'humanité pourra grandement bénéficier du soutien des communautés de base qui sont maintenant collectivement capables de générer une compréhension unique et à long terme des forêts les plus précieuses de la Terre. Abstrak: Hutan tropika adalah di antara ekosistem yang paling produktif dan mempunyai kepelbagaian biodiversiti yang tinggi di seluruh dunia. Walaupun pemahaman mengenai hutan tropika amat penting untuk masa depan kita, usaha-usaha untuk mengkaji dan mengawas hutah-hutan tersebut baru sekarang menjadi lebih diperhubungkan. Perangkaian adalah sangat penting untuk mencari jawapan kepada soalan-soalan yang menjangkaui sempadan dan batasan agensi pendanaan. Di sini kami menunjukkan bagaimana sebuah komuniti global bertindak balas terhadap cabaran penyelidikan ekosistem tropika melalui penglibatan pelbagai kumpulan yang mengukur hutan secara pokok demi pokok dalam beribu-ribu plot jangka panjang. Kami meninjau semula penemuan saintifik utama daripada kerja ini dan menunjukkan bagaimana proses ini sedang mengubah bidang sains hutan tropika. Teras pendekatan kami memberi tumpuan terhadap penghubungan inisiatif akar umbi jangka panjang dengan protokol standar serta pengurusan data untuk mendapatkan hasil skala besar yang kukuh. Dengan menghubungkan penyelidik-penyelidik tropika dan meningkatkan status mereka, model Rangkaian Penyelidikan Sosial kami mengiktiraf kepentingan peranan pengasas data dalam penemuan saintifik. Bermula dengan pengasasan RAINFOR (Amerika Selatan) pada tahun 1999, rangkaian-rangkaian plot kekal kami kemudian disesuaikan untuk Afrika (AfriTRON) dan Asia Tenggara (T-FORCES) dan selanjutnya telah banyak dicontohi di seluruh dunia. Kini, inisiatif-inisiatif tersebut disepadukan melalui infrastruktur siber ForestPlots.net yang menghubungkan rakan sekerja dari 54 negara di 24 buah rangkaian plot. Secara kolektif, rangkaian ini sedang mengubah pemahaman tentang hutan tropika dan peranannya dalam biosfera. Kami telah bekerjasama untuk menemukan bagaimana, di mana dan mengapa karbon serta biodiversiti hutan bertindak balas terhadap perubahan iklim dan juga bagaimana mereka saling bermaklum balas. Kolaborasi pan-tropika jangka panjang ini telah mendedahkan sebuah sinki karbon jangka panjang serta arah alirannya dan juga menjelaskan pemandu-pemandu perubahan yang terpenting, di mana dan bagaimana proses hutan terjejas, masa susul yang ada dan kemungkinan tindakbalas hutan tropika pada perubahan iklim secara berterusan di masa depan. Dengan memanfaatkan pendekatan lama, rangkaian plot sedang menyalakan revolusi yang amat moden dalam sains hutan tropika. Pada masa akan datang, manusia sejagat akan banyak mendapat manfaat jika memupuk komuniti-komuniti akar umbi yang kini berkemampuan secara kolektif menghasilkan pemahaman unik dan jangka panjang mengenai hutan-hutan yang paling berharga di dunia. Instituto de Ecología Regional (IER) Universidad Nacional de Tucumán (UNT) Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) Facultad de Ciencias Agrarias Universidad Nacional de Jujuy James Cook University (JCU) CSIRO (Commonwealth Scientific and Industrial Research Organisation) School of Land & Food University of Tasmania CSIRO Tropical Forest Research Centre Independent Researcher Environmental Protection Agency (EPA) Centre for Tropical Environmental and Sustainability Science (TESS) College of Marine and Environmental Sciences James Cook University Centre for Tropical Environmental and Sustainability Science College of Science and Engineering James Cook University University of the Sunshine Coast University of York Flamingo Land Ltd. Sommersbergseestrasse Ghent University CAVElab Ghent University Royal Museum for Central Africa - Service of Wood Biology Isotope Bioscience Laboratory-ISOFYS Ghent University Gembloux Agro-Bio Tech Université de Liege Landscape Ecology and Vegetal Production Systems Unit CAVElab Computational & Applied Vegetation Ecology Ghent University Tropical Forestry Forest Resources Management Gembloux Agro-Bio Tech University of Liege Université Libre de Bruxelles (ULB) Evolutionary Biology and Ecology Royal Museum for Central Africa Royal Museum for Central Africa Ghent University Department of Environment Ghent University Service Evolution Biologique et Ecologie Belize Foundation for Research and Environmental Education IBIF Museo de Historia Natural Noel Kempff Mercado Universidad Autonoma Gabriel Rene Moreno PROMAB Museo Noel Kempff Consultor Independiente Jardin Botanico Municipal de Santa Cruz Museo de Historia Natural Noel Kempff Mercado Forest Management in Bolivia Universidad Autónoma del Beni Riberalta Museo de Historia Natural Noel Kempff Herbario del Sur de Bolivia Universidad Autónoma del Beni Conservation International Instituto de Biodiversidade e Floresta Universidade Federal do Oeste do Pará Universidade Federal de Pernambuco Universidade do Estado de Mato Grosso Universidade do Estado de Mato Grosso (UNEMAT) Projeto TEAM – Manaus Universidade Federal de Juiz de Fora (UFJF) Universidade Federal do Rio de Janeiro Instituto Nacional de Pesquisas da Amazônia Projeto Dinâmica Biológica de Fragmentos Florestais Departamento de Genética Ecologia e Evolução Universidade Federal de Minas Gerais Universidade Estadual de Campinas Laboratório de Ecologia de Comunidades e Funcionamento de Ecossistemas-ECoFERP Departamento de Biologia Faculdade de Filosofia Ciências e Letras USP National Institute for Space Research (INPE) Universidade Federal de Roraima (UFRR) UNESP - São Paulo State University Carbonozero Consultoria Ambiental Departamento de Biologia Universidade Federal do Amazonas (UFAM) Centro de Energia Nuclear na Agricultura Universidade de São Paulo UERR - Campus Rorainópolis Universidade Federal do Acre Instituto Agronômico de Campinas Universidade Federal do Rio Grande do Sul Embrapa Universidade Estadual do Norte Fluminense (UENF) Universidade Federal da Bahia (UFBA) Instituto de Biologia Universidade Estadual de Campinas Universidade Federal do Piauí (UFPI) Botany and Plant Ecology Laboratory Federal University of Acre INPA- Instituto Nacional de Pesquisas da Amazônia UERR - Campus Boa Vista Universidade Federal do Ceará Universidade Federal de Campina Grande Universidade Federal do Para Núcleo de Estudos e Pesquisas Ambientais Universidade Estadual de Campinas Instituto Federal de Educação Ciência e Tecnologia do Acre Instituto de Pesquisas Jardim Botânico do Rio de Janeiro Universidade Federal do Oeste do Pará UEFS Depto. de Ciências Biológicas Universidade Federal do Agreste de Pernambuco (UFAPE) Universidade Estadual de Montes Claros FFCLRP-USP/Br UNEMAT Universidade Federal de Jataí Universidade Federal do Pará Instituto de Ciências Biológicas Universidade de Campinas Universidade Federal de Lavras (UFLA) Museu Goeldi Embrapa Amazônia Oriental Instituto Nacional de Pesquisas da Amazônia UFMG - Universidade Federal de Minas Gerais Fundação Universidade Fedral de Rondônia - UNIR INPA- Instituto Nacional de Pesquisas Amazônicas Instituto Nacional de Pesquisas da Amazônia - Coordenação de Pesquisas em Silvicultura Tropical Jardim Botânico do Rio de Janeiro National Institute for Research in Amazonia Universidade Federal de Roraima (UFRR/PRONAT) Universidade Estadual de Campinas/UNICAMP Instituto Nacional de Pesquisas da Amazônia/CPBO Universidade Federal de Santa Catarina (UFSC) INCAPER- Instituto Capixaba de Pesquisa Assistência Técnica e Extensão Rural INPE- Instituto Nacional de Pesquisas Espaciais Universidade de São Paulo Instituto de Biociências Universidade Estadual Paulista Semiarid National Institute (INSA) Universidade de Brasília Departamento de Engenharia Florestal IBAM - Instituto Bem Ambiental Universidade do Estado de Mato Grosso Campus de Nova Xavantina University in Campinas Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF) LMF Instituto Nacional de Pesquisas da Amazônia Universidade Federal do Vale do São Francisco USP - University of São Paulo Instituto Federal do Espírito Santo (IFES) INPA - Instituto Nacional de Pesquisas da Amazônia Grupo MAUA Universidade Federal de Mato Grosso Instituto de Ciências Naturais Humanas e Sociais Instituto Nacional da Mata Atlântica RAINFOR-PPBIO Universidade Federal Rural da Amazônia - UFRA/CAPES Universidade Federal do Amazonas (UFAM) INPA/Max-Planck Project EMBRAPA- Empresa Brasileira de Pesquisa Agropecuária (Amazônia Oriental) Serviço Florestal Brasileiro Museu Universitário Universidade Federal do Acre Universidade Federal Rural de Pernambuco PUCPR - Pontifícia Universidade Católica do Paraná Museu Paraense Emilio Goeldi Universiti Brunei Darussalam Environmental and Life Sciences Faculty of Science Universiti Brunei Darussalam Institute for Biodiversity and Environmental Research Universiti Brunei Darussalam Plant Systematic and Ecology Laboratory Department of Biology Higher Teachers’ Training College University of Yaounde I Faculty of Science Department of Botany and Plant Physiology University of Buea Faculty of Science Department of Plant Science University of Buea National Herbarium Plant Systematics and Ecology Laboratory Higher Teachers’ Training College University of Yaoundé I Department of Plant Biology Faculty of Sciences University of Yaounde 1 Bioversity International Faculty of Forestry University of Toronto Ministère des Eaux Forêts Chasse et Pêche (MEFCP) Universidad Católica de la Santísima Concepción Universidad de La Serena Research Institute of Tropical Forestry Chinese Academy of Forestry Kunming Institute of Botany Chinese Academy of Sciences Beijing Forestry University Universidad Nacional Abierta y a Distancia Red COL-TREE Corporación COL-TREE Nuevo Estándar Biotropical NEBIOT SAS Universidad del Tolima Asociación GAICA Universidad de Nariño – Red BST-Col Parques Nacionales Naturales Territorial Caribe – Red BST-Col Universidad del Atlantico – Red BST-Col Departamento de Ciencias Forestales Universidad Nacional de Colombia - Sede Medellín Socioecosistemas y Clima Sostenible Fundacion con Vida Parques Nacionales Naturales de Colombia – Red BST-Col Instituto de Investigación de Recursos Biológicos Alexander von Humboldt – Red BST-Col UNAL Instituto de Investigación Recursos Biologicos Alexander von Humboldt – Red BST-Col Fundación Jardín Botánico de Medellín Herbario “Joaquín Antonio Uribe” (JAUM) – Red BST-Col Universidad Nacional de Colombia sede Amazonia Coltree Facultad del Medio Ambiente y Recursos Naturales Universidad Distrital Francisco José de Caldas – Red BST-Col Universidad de Tolima Fundación Orinoquia Biodiversa – Red BST-Col Departamento de Biología Facultad de Ciencias Naturales Universidad Icesi – Red BST-Col Instituto de Ciencias Naturales Universidad Nacional de Colombia Universidad de los Llanos Servicios Ecoysistemicos y Cambio Climatico (SECC) Fundación Con Vida & Corporación COL-TREE Universidad del Rosario Fundacion Ecosistemas Secos de Colombia – Red BST-Col Universidad de los Andes - ANDES herbarium Institute of Botany Czech Academy of Sciences Palacky University Czech University of Life Sciences Mendel University World Wide Fund for Nature Wildlife Conservation Society-DR Congo Lukuru Wildlife Research Foundation Université de Kisangani Faculté des Sciences Laboratoire d'écologie et aménagement forestier Université de Kisangani Université de Kisangani Faculté des Sciences Agronomiques République Démocratique du Congo Ministère de l'Environnement et Développement Durable Aarhus University University of Copenhagen Escuela Politécnica Nacional del Ecuador Herbario Alfredo Paredes (QAP) Universidad Central del Ecuador Universidad Técnica Particular de Loja Grupo de Investigación en Biodiversidad Medio Ambiente y Salud-BIOMAS Universidad de las Américas, Campus Queri Keller Science Action Center The Field Museum, 1400 South Lake Shore Dr. Universidad Estatal Amazónica Facultad de Ingeniería Ambiental Universidad Tecnica del Norte Herbario Nacional del Ecuador Grupo de Ecosistemas Tropicales y Cambio Global Universidad Regional Amazónica ikiam Colegio de Ciencias Biológicas y Ambientales COCIBA & Extensión Galápagos Universidad San Francisco de Quito-USFQ Herbario de Botánica Económica del Ecuador QUSF Universidad San Francisco de Quito USFQ Galapagos Science Center USFQ UNC Chapel Hill University of North Carolina-UNC Chapel Hill University of Florida FindingSpecies Mekelle University Environment Climate Change and Coffee Forest Forum (ECCCFF) University of Turku Centre de coopération International en Recherche Agronomique pour le Développement (CIRAD) CNRS ONF INRAE Centre National de la Recherche Scientifique AMAP Univ Montpellier IRD CNRS CIRAD INRA Forêts et Sociétés (F&S) Centre de coopération International en Recherche Agronomique pour le Développement (CIRAD) Departement Hommes Natures Societes Museum national d'histoire naturelle INRA Cirad UMR Ecologie des Forêts de Guyane (AgroparisTech CNRS INRAE Université des Antilles Université de la Guyane) Ministry of Forests Seas Environment and Climate Rougier-Gabon Agence Nationale des Parcs Nationaux Gabon Commission of Central African Forests (COMIFAC) Agence Nationale des Parcs Nationaux Ministère des Forêts des Eaux de la Mer de l'Environnement Chargé du Plan Climat des Objectifs de Développement Durable et du Plan d'Affectation des Terres Institut de Recherche en Ecologie Tropicale (CENAREST) Gabon/Agence Nationale des Parcs Nationaux Georg-August-University Göttingen University of Freiburg Institute of Botany University of Hohenheim Max Planck Institute for Chemistry Forestry Research Institute of Ghana (FORIG) Mensuration Unit Forestry Commission of Ghana Center for International Forestry Research Iwokrama International Centre for Rainforest Conservation and Development Guyana Forestry Commission Utrecht University Centre for Sustainable Technologies Indian Institute of Science Centre for International Forestry Research (CIFOR) Herbarium Borgoriense Indonesian Institute of Sciences (LIPI) Indonesian Institute of Science Forest Research and Development Agency (FORDA) Balitek-KSDA Samboja University of Florence and MUSE - Museo delle Scienze Cirad Hokkaido University Graduate School of Agriculture Kyoto University Forestry Development Authority of the Government of Liberia (FDA) University of Liberia Sungai Wain Protection Forest South East Asia Rainforest Research Partnership Danum Valley Field Centre Malaysian Palm Oil Board Sabah Forestry Department Forest Research Centre Universiti Malaysia Sabah Sabah Forestry Department Sarawak Forestry Corporation Eduardo Mondlane University Herbarium UNAN-Leon Universidad Nacional Autónoma de Nicaragua University of Abeokuta Natural History Museum of Norway University of Oslo Norwegian University of Life Sciences Universidad Nacional de la Amazonía Peruana (UNAP) Universidad Nacional de Jaén Jardin Botanico de Missouri Andes to Amazon Biodiversity Program Universidad Nacional de San Agustín de Arequipa Facultad de Ciencias Biológicas Universidad Nacional de la Amazonía Peruana Kené - Instituto de Estudios Forestales y Ambientales Instituto de Investigaciones de la Amazonia Peruana (IIAP) Universidad Nacional Jorge Basadre de Grohmann (UNJBG) Universidad Nacional de San Antonio Abad del Cusco Centro de Conservación Investigación y Manejo CIMA Pontificia Universidad Católica del Perú Asociacion Bosques Perú Université Officielle de Bukavu Université Marien N'Gouabi Wildlife Conservation Society Ecole Nationale Supérieure d'Agronomie et de Foresterie Université Marien Ngouabi Univeriste Marien Ngouabi The Gola Rainforest National Park Department of Geography National University of Singapore Departamento de Biología y Geología Física y Química inorgánica Universidad Rey Juan Carlos Real Jardín Botánico – CSIC Departamento de Biología Área de Botánica Universidad Autónoma de Madrid Museo Nacional de Ciencias Naturales (MNCN-CSIC) Centre for Agricultural Research in Suriname (CELOS) Stockholm Environment Institute Department of Plant Ecology and Evolution Uppsala University Southern Swedish Forest Research Centre InfoFlora Conservatoire et Jardin Botanique Geneve National Chung Hsing University Sokoine University of Agriculture Naturalis Biodiversity Center Wageningen University Forest Ecology and Forest Management Group Tropenbos International Institute for Biodiversity and Ecosystem Dynamics University of Amsterdam Bureau Waardenburg BV Van Hall Larenstein University of Applied Sciences Van der Hout Forestry Consulting Utrecht University, Domplein 29 Wageningen University Plant Ecology and Nature Conservation Group Data for Sustainability Department of Zoology Entomology & Fisheries Sciences Makerere University The Institute of Tropical Forest Conservation (ITFC) Mbarara University of Science and Technology (MUST) George Washington University Makerere University Department of Forestry Biodiversity and Tourism Makerere University University of Stirling University of Kent School of Geography University of Leeds UK Centre of Ecology & Hydrology Lancaster University University of Oxford The Landscapes and Livelihoods Group (TLLG) Overseas Development Institute Manchester Metropolitan University University of Aberdeen University of Exeter School of GeoSciences University of Edinburgh University of Cambridge Department of Environment and Geography University of York Department of Geography University College London Imperial College School of Geography Earth & Environmental Sciences Birmingham Institute of Forest Research University of Birmingham University of Plymouth Geography College of Life and Environmental Sciences University of Exeter Lancaster Environment Centre Lancaster University University of Edinburgh School of Biology University of Leeds Royal Botanic Garden Edinburgh CENAREST & ANPN & Stirling University University of Bristol School of Biological Sciences Department of Plant Sciences University of Cambridge Living with Lake Centre Laurentian University Royal Botanic Gardens Kew The Royal Society for the Protection of Birds centre for Conservation Science Environmental Change Institute School of Geography and the Environment University of Oxford UK Centre for Ecology & Hydrology School of Geography and the Environment University of Oxford The Royal Botanic Gardens Department of Geography and Environmental Science University of Dundee School of Biological Sciences University of Southampton University of East Anglia Stirling University School of Earth and Environment University of Leeds Department of Plant & Soil Science School of Biological Sciences University of Aberdeen, Cruickshank Building Institute for Transport Studies University of Leeds UK Research & Innovation University of Nottingham University of Bangor Center for Tropical Research Institute of the Environment and Sustainability University of California Center for Tropical Conservation Nicholas School of the Environment Duke University Ecology and Evolutionary Biology University of Michigan Saint Louis Zoo Department of Organismic and Evolutionary Biology Harvard University Center for Global Discovery and Conservation Science Arizona State University Wildlife Conservation Society – Programme Congo Woods Hole Research Center The University of Michigan Herbarium Nicholas School of the Environment National Park Service University of California ForestGEO Smithsonian Tropical Research Institute University of Texas at Austin Smithsonian Institute Washington University in Saint Louis Center for Conservation and Sustainable Development at the Missouri Botanical Garden Smithsonian Tropical Research Institute Smithsonian Institution Forest Global Earth Observatory (ForestGEO) Forest Global Earth Observatory (ForestGEO) Smithsonian Tropical Research Institute George Mason University Missouri Botanical Garden Broward County Parks and Recreation Nova Southeastern University Science and Education The Field Museum Department of Biology Boston University Wake Forest University Department of Geographical Sciences University of Maryland San Diego Zoo Institute for Conservation Research Biology Department Washington State University Yale School of Forestry & Environmental Studies Columbia University Department of Environmental Science Policy and Management University of California Berkeley School of Earth Sciences and Environmental Sustainability Northern Arizona University Department of Geography and the Environment University of Texas at Austin UNELLEZ-Guanare Programa de Ciencias del Agro y el Mar Herbario Universitario (PORT) Ci Progress GreenLife Universidad Nacional Experimental de Guayana Instituto Venezolano de Investigaciones Científicas (IVIC) Universidad de los Andes Viet Nature Conservation Centre CIRAD School of Life Sciences University of Lincoln UNESP - São Paulo State University Instituto de Biociências Universidade Estadual Paulista Gordon and Betty Moore Foundation: 1656 FAPESP: 2012/51509-8 FAPESP: 2012/51872-5 Fundação de Amparo à Pesquisa do Estado de Goiás: 2017/10267000329 European Research Council: 291585 Gordon and Betty Moore Foundation: 5349 European Research Council: 758873 Belgian Federal Science Policy Office: BR/132/A1/AFRIFORD Belgian Federal Science Policy Office: BR/143/A3/HERBAXYLAREDD Vlaamse Interuniversitaire Raad: CD2018TEA459A103 CNPq: CNPq/PPBio/457602/2012-0 National Science Foundation: DEB 1754647 Natural Environment Research Council: E/M0022021/1 Royal Society: ICA/R1/180100 Natural Environment Research Council: NE/D005590/1 European Research Council: NE/F005806/1 Natural Environment Research Council: NE/F005806/1 FAPESP: NE/K016431/1 Natural Environment Research Council: NE/N004655/1 FAPESP: NE/N012542/1 Royal Society: NE/P008755/1 FAPESP: NE/S011811/1 National Geographic Society: NE/T01279X/1 CNPq: PELD/441244/2016-5 Belgian Federal Science Policy Office: SD/AR/01A/COBIMFO

International audience; Weeds are major biotic constraints to rice production worldwide. Compared to other sub-regions, weed communities of rice are not well described for East Africa and there is limited information on environmental factors affecting the distribution of species. This study aimed to address these knowledge gaps. Seasonally flooded rice production fields of 31 sites in Rwanda, Tanzania, Kenya and Uganda, across three altitude classes (Low: 1,000 m), were surveyed for weed species using quadrats. Data analyses involved multivariate approaches, non-parametric Kruskal–Wallis tests and logistic regressions, followed by calculation of ranked species abundance and Shannon Wiener Index diversity analyses. A total of 286 weed species, belonging to 59 families, were recorded with 42 species not previously reported as lowland rice weed in the sub-region. Twenty-four species were identified as abundant across altitudes. Weed species diversity was higher at medium altitudes compared to high and low altitudes. Significant patterns of floristic distinction between altitudinal classes were observed, with 80% of dissimilarity. The high altitude was dominated by Echinochloa colona, Leptochloa squarrosa and Sphaeranthus suaveolens, the medium altitude was dominated by Crassula granvikii, Pycreus lanceolatus and Ageratum conyzoides while the low altitude was dominated by E. colona, Cyperus difformis and Cyperus esculentus. The weed species composition of seasonally flooded rice fields in East Africa is diverse. Identification of a limited group of (24) commonly abundant weed species as well as the articulation of altitude-specific weed species groups will facilitate the development of better tailored weed control programmes.

Peste des petits ruminants (PPR) is a viral disease of goats and sheep that occurs in Africa, the Middle East and Asia with a severe impact on livelihoods and livestock trade. Many wild artiodactyls are susceptible to PPR virus (PPRV) infection, and some outbreaks have threatened endangered wild populations. The role of wild species in PPRV epidemiology is unclear, which is a knowledge gap for the Global Strategy for the Control and Eradication of PPR. These studies aimed to investigate PPRV infection in wild artiodactyls in the Greater Serengeti and Amboseli ecosystems of Kenya and Tanzania. Out of 132 animals purposively sampled in 2015–2016, 19.7% were PPRV seropositive by ID Screen PPR competition enzyme-linked immunosorbent assay (cELISA, IDvet, France) from the following species: African buffalo, wildebeest, topi, kongoni, Grant’s gazelle, impala, Thomson’s gazelle, warthog and gerenuk, while waterbuck and lesser kudu were seronegative. In 2018–2019, a cross-sectional survey of randomly selected African buffalo and Grant’s gazelle herds was conducted. The weighted estimate of PPRV seroprevalence was 12.0% out of 191 African buffalo and 1.1% out of 139 Grant’s gazelles. All ocular and nasal swabs and faeces were negative by PPRV real-time reverse transcription-polymerase chain reaction (RT-qPCR). Investigations of a PPR-like disease in sheep and goats confirmed PPRV circulation in the area by rapid detection test and/or RT-qPCR. These results demonstrated serological evidence of PPRV infection in wild artiodactyl species at the wildlife–livestock interface in this ecosystem where PPRV is endemic in domestic small ruminants. Exposure to PPRV could be via spillover from infected small ruminants or from transmission between wild animals, while the relatively low seroprevalence suggests that sustained transmission is unlikely. Further studies of other major wild artiodactyls in this ecosystem are required, such as impala, Thomson’s gazelle and wildebeest.

International audience; Brucellosis is endemic in Tanzania. A cross-sectional study was conducted at 17 cattle farms in agro-pastoral areas in Tanzania to identify risk factors associated with the within-farm prevalence of bovine brucellosis and to quantitatively assess the infection dynamics through disease modelling. Cattle blood sampling and interviews with farmers using a structured questionnaire were conducted. A total of 673 serum samples were screened using the Rose-Bengal plate test (RBPT), and sero-positivity of RBPT-positive samples was confirmed using a competitive enzyme-linked immunosorbent assay. Zero-inflated binomial regression was performed for univariable and multivariable risk factor analyses of within-farm prevalence. Several susceptible-infectious (SI) models were compared based on deviance information criteria, and age-dependent force of infection (FOI) was measured using age-specific prevalence data for the 10 infection-positive farms. Using the diagnoses of cows on the 17 farms, the basic reproduction number, R0, was also calculated. The farm-level prevalence and animal-level adjusted prevalence were 58.8 % (10/17, 95 % confidence interval: 33.5–80.6 %) and 7.0 % (28/673, 95 % credible interval: 5.7–8.4 %), respectively. The risk factor for high within-farm prevalence was introduction of cattle from other herds. A mathematical model with constant FOI showed the annual probability of infection as 1.4 % (95 % credible interval: 1.0 %–2.0 %). The R0 was 1.07. The constant FOI could have been due to the predominant mode of infection being transmission of Brucella from contaminated aborted materials during grazing. Direct purchase of infected cattle could facilitate efficient transmission between susceptible animals through abortion.

Study region: Coastal areas of Kenya (Kilifi County), Tanzania (Kilwa district) and Comoros (Ngazidja island), East Africa. Study focus: Research aimed to understand the physical and societal drivers of groundwater accessibility and identify critical aspects of groundwater access and knowledge gaps that require further monitoring and research. Interdisciplinary societal, environmental and hydrogeological investigations were consistently undertaken in the three areas considered as exemplars of the diversity of the coastal fringes of the wider region. This paper focuses on the hydrogeological outcomes of the research, framed within the principal socio-environmental issues identified. New hydrological insights: Results confirm the fundamental importance of coastal groundwater resources for the development of the region and the urgent need to match groundwater development with demographic and economic growth. Hydrogeological knowledge is fragmented, groundwater lacks a long-term monitoring infrastructure and information transfer from stakeholders to users is limited. Current trends in demography, climate, sea-level and land-use are further threatening freshwater availability. Despite possessing high-productivity aquifers, water quality from wells and boreholes is generally impacted by saltwater intrusion. Shallow large-diameter wells, following the traditional model of these areas, consistently prove to be less saline and more durable than deeper small-diameter boreholes. However, promoting the use of large numbers of shallow wells poses a significant challenge for governance, requiring coherent management of the resource at local and national scales and the engagement of local communities. Keywords: Groundwater, Coastal aquifer, Eastern Africa, Environmental change, Governance, Community engagement

The common bean (Phaseolus vulgaris L.) is an important legume crop grown widely around the world due to its high nutritional values. In developing countries of Africa and Latin America (e.g. Tanzania and Nicaragua) bean crop is linked to food security and income generation especially in poorest groups made up of small farmers. Disease problems, pests, unimproved seeds, inappropriate agricultural management and environmental conditions are often the main constraints in bean crop production. In Nicaragua and Tanzania, the unavailability of certified seed of local bean varieties causes significant losses in yield and quality. Other limitation present in Nicaragua and Tanzania concerning bean diseases is that seed-borne fungi and viruses has gained little attention. Thus, for better understanding in seed-borne fungi and viruses associated with beans we investigated seed-borne fungi in an important new local bean variety. Sampling from four seed storehouses and six seed lots of cv. INTA Rojo was done in the main bean production areas in Nicaragua. In addition, to detect viruses infecting bean plants, we surveyed seedborne viruses in landraces and new common bean varieties introduced to Nicaragua (Central America) as well as improved varieties grown in Tanzania (eastern Africa). The main results for seedborne fungi included 87 pathogenic isolates from eight genera: Fusarium spp. (F. chlamydosporum, F. equiseti, F. incarnatum), Lasiodiplodia theobromae, Macrophomina phaseolina, Corynespora cassiicola, Colletotrichum capsici, Colletotrichum gloeosporioides, Diaporthe sp. (Phomopsis), Aspergillus flavus, and Penicillium citrinum. Subsequently, results based on germination in seed lots of common bean (‘INTA Rojo’) from four bean production areas in Nicaragua showed that germination was constantly less than 40% and could be as low as 16%, indicating disastrous yield losses for producers. Four different species-specific primer pairs to detect F. equiseti, F. chlamydosporum, F. incarnatum, C. capsici, C. gloesporiodes and C. cassiicola were developed in this study based on sequence alignment of the internal transcribed spacer sequences (ITS1 and ITS2) from different fungi. They were tested in pure cultures of fungi and used successfully in detection of fungal pathogens from infected plants. These specific primers are able to give the basis to be used in seed health inspection (seeds and plants) for further research of the epidemiology, ecology, and control of the pathogenic fungi of common beans in the field. The presence of Phaseolus vulgaris endornavirus 1 (PvEV-1) and PvEV-2 was detected in Nicaraguan and Tanzanian bean varieties. Likewise, Cowpea mild mosaic virus was detected in one region of Tanzania. There is apparently indication that the new Nicaragua bean varieties are carrying virus resistance genes because no seedborne viruses were found in them. In Tanzania improved protection against pathogenic seed-borne viruses is developed by resistance breeding. These findings are the first report showing that several pathogenic seed-borne fungi occur in Nicaraguan beans. Previously, little information has been available on pathogenic fungi such as F. equiseti, F. incarnatum, L. theobromae, C. cassiicola, and Diaporthe spp in Nicaraguan common beans. This study has contributed in taking first steps to improve the pathological and genetic components in the national seed production system in Nicaragua and Tanzania by providing new knowledge concerning seed-borne pathogens associated with common bean. Tarhapapu (Phaseolus vulgaris L.) on tärkeä palkokakasvi, jota viljellään laajalti ympäri maailmaa korkean ravintoarvonsa vuoksi. Afrikan ja Latinalaisen Amerikan kehitysmaissa (esim. Tansaniassa ja Nicaraguassa) pavuntuotanto on tärkeää ruokaturvan ja tulonmuodostuksen näkökulmasta etenkin köyhimmissä väestöryhmissä, jotka koostuvat pienviljelijöistä. Kasvitautiongelmat, tuholaiset, terveiden siementen puute, viljelymenetelmien kehittymättömyys ja ympäristöolot ovat usein keskeisinä rajoituksina pavuntuotannolle. Nicaraguassa ja Tansaniassa paikallisten papulajikkeiden sertifioitujen siementen puute aiheuttaa merkittäviä sadon määrän ja laadun menetyksiä. Nicaraguassa ja Tansaniassa viljelyä rajoittaa se, että siemenpavuissa leviävät sienet ja virukset ovat jääneet vähälle huomiolle. Tässä tutkimuksessa tunnistettiin ja eristettiin pavunsiementen sieniä tärkeässä, uudessa papulajikkeessa INTA Rojo. Näytteenotto tehtiin neljästä siemenvarastosta ja kuudesta siemenerästä Nicaraguan papujen päätuotantoalueilla. Viruksia tutkittiin myös maatiaispapulajikkeista ja äskettäin viljelyyn otetuista uusista papulajikkeista Nicaraguassa ja Tansaniassa. Siemenpavuista eristetyistä sienistä 87 sienikantaa aiheutti taudinoireita pavuissa. Ne kuuluivat kahdeksaan sukuun: Fusarium spp. (F. chlamydosporum, F. equiseti, F. incarnatum), Lasiodiplodia theobromae, Macrophomina phaseolina, Corynespora cassiicola, Colletotrichum capsici, Colletotrichum gloeosporioides, Diaporthe sp. (Phomopsis), Aspergillus flavus, ja Penicillium citrinum. Nicaraguassa neljältä viljelyalueelta tutkittujen papujen (INTA Rojo) itävyys oli huono, 16-40%, mikä viittaa sienten merkittävään satotasoa vähentävään vaikutukseen, kun tervettä siementä ei ole saatavilla. Tässä tutkimuksessa kehitettiin neljä erilaista lajispesifistä alukeparia sienten F. equiseti, F. chlamydosporum, F. incarnatum, C. capsici, C. gloesporiodes ja C. cassiicola havaitsemiseksi PCR-menetelmällä (polymerase chain reaction). Testi perustuu ribosomaalista RNA:ta tuottavien geenien välialueisiin (ITS1 ja ITS2), joiden DNA-sekvenssi vaihtelee sienilajien välillä. Phaseolus vulgaris endornavirus 1:n (PvEV-1) ja PvEV-2:n läsnäolo havaittiin pavuissa sekä Nicaraguassa että Tansaniassa. Samoin Cowpea mosaic virus havaittiin pavuissa yhdellä Tansanian alueella. On ilmeistä, että uudet Nicaraguassa viljeltävät papulajikkeet ovat aiempaa kestävämpiä viruksille, koska viruksia ei näistä papulajikkeista löytynyt. Tansaniassakin papujen viruskestävyyttää on kehitetty kestävyysjalostuksella. Tämän tutkimuksen tulokset edustavat ensimmäistä laajempaa analyysiä siemenpavuissa esiintyvistä patogeenisista sienistä Nicaraguassa ja tuo esiin sienten, kuten F. equiseti, F. incarnatum, L. theobromae, C. cassiicola ja Diaporthe-lajien merkityksen siementen itävyyden ja siten satotason heikentäjinä. Tutkimuksen tulokset edesauttavat Nicaraguan ja Tansanian kansallisen siementuotantojärjestelmän parantamista antamalla uutta tietoa siemenpapujen mukana leviävistä ja satotasoa heikentävistä taudinaiheuttajista.

Background: Birth weight is one of the key predictor for survival, health and future development of a child. In developing countries data on birth weights are limited to obtain due to difficulties in keeping records especially among rural women. Maternal recall of birth weight can therefore become a useful source of birth weight data. This study was carried out to determine recall of birth weight and delivery complications among mothers in Unguja West District of Zanzibar.Methods: This cross-sectional study involve mothers who had children below five years of age. Pretested structured questionnaire was used to collect information on socio-demographic characteristics of the mother, age of the child, birth weight of the child and delivery complications. Other information was obtained from maternal antenatal clinic and child’s growth monitoring cards. Results: A total of 260 women were included in the study. The mean age of the mothers was 29 years, ranging from 17 to 45 years. More than half (62%) had attained secondary education and few had informal education (6.5%) or post-secondary education (12%). Majority of the mothers (85%) delivered at the health facility assisted by trained health care provider. Those who delivered at home (15%) were either assisted by a relative or Traditional Birth Attendant (TBA). Over three quarters (78.5%) of the mothers had birth weights of their children recorded in the postnatal care cards. Out of 38 children who were born at home, 87% (n = 33) were not weighed and there were 23 women (10.4%) who delivered at the hospital but their children’s weight were not recorded. Overall, 46 (20%) mothers could not correctly recall birth weights of their children where. There was strong correlation between recall and recorded birth weight (r2=0.79; p

Changes in lifestyles and ageing have been associated with growing rates of modifiable cardiovascular risk factors (CRF). Dyslipidemia is one ofthe CRF associated with numbers of cardiovascular diseases. This descriptive cross-sectional study was conducted to determine the profile and degree of derangements of plasma lipids among 300 (176 females and 124 males) elderly individuals aged ≥ 60 years in Morogoro, Tanzania. The calorimetric enzymatic methods and the Friedewal's equation were used for determination of cholesterols and triglycerides (TG). Social and demographic characteristics were gathered by structured questionnaires. The logistic regression models were used to identify the determinants of abnormal serum lipids level. Mean Total Cholesterols (TC) and Low Density Lipoprotein Cholesterols (LDL-C) in females exceeded significantly that of males. Mean TC, LDL-C as well as TG (mg/dL) declined significantly with age while mean High Density Lipoprotein Cholesterols (HDL-C) also declined but only slightly. Elderly females were two times more likely to have elevated TC (OR = 2.11; 95% CI: 1.04-4.28: P = 0.05) and LDL-C (OR = 2.15; 95% CI: 1.17- 3.97: P = 0.019) and three times to have lowered HDL-C (OR = 3; 95% CI: 1.97-5.30: P < 0.001) than males. Urban residents were about two times more likely to have elevated LDL-C (OR = 1.84; 95% CI: 1.04-3.25: P = 0.047) than their rural counterparts. Body Mass Index of ≥ 30 kg/m2 was also associated with elevated LDL-C (OR = 1.89; 95% CI: 1.05-3.42: P = 0.045) and lowered HDL-C (OR = 2.18; 95% CI: 1.3-3.65: P = 0.004), respectively. The present study has established the profile and level of derangements of serum lipids among the elderly of Morogoro region in Tanzania. It appears that, female sex and BMI of ≥ 30 kg/m2 are significant factors for elevated TC, LDL-C and lowered HDL-C while urban life is a significant factor for elevated LDL-C.

Small mammals are considered to be involved in the transmission cycle of bubonic plague, still occurring in different parts of the world, including the Lushoto District in Tanzania. The objective of this study was to determine the relationship between land use types and practices and small mammal abundance and distribution. A field survey was used to collect data in three landscapes differing in plague incidences. Data collection was done both in the wet season (April-June 2012) and dry season (August-October 2012). Analysis of variance and Boosted Regression Trees (BRT) modelling technique were used to establish the relationship between land use and small mammal abundance and distribution. Significant variations (p ≤ 0.05) of small mammal abundance among land use types were identified. Plantation forest with farming, natural forest and fallow had higher populations of small mammals than the other aggregated land use types. The influence of individual land use types on small mammal abundance level showed that, in both dry and wet seasons, miraba and fallow tended to favour small mammals’ habitation whereas land tillage practices had the opposite effect. In addition, during the wet season crop types such as potato and maize appeared to positively influence the distribution and abundance of small mammals which was attributed to both shelter and food availability. Based on the findings from this study it is recommended that future efforts to predict and map spatial and temporal human plague infection risk at fine scale should consider the role played by land use and associated human activities on small mammal abundance and distribution ispartof: Tanzania Journal of Health Research vol:16 issue:3 pages:1-12 ispartof: location:Tanzania status: published

Previous studies suggest that rodent burrows, a proxy for rodent population are important for predicting plague risk areas. However, studies that link landform, surface attributes and rodent burrows in the Western Usambara Mountains in Tanzania are scanty. Therefore, this study was conducted in plague endemic area of the Western Usambara Mountains in northern, Tanzania, to explore the relationship between rodent burrows, and landform and surface attributes. The study was carried out in three areas corresponding to high (Lokome), medium (Lukozi) and low (Mwangoi) frequency of reported plague cases. Data were collected from 117, 200 and 170 observation sites for Lokome, Lukozi and Mwangoi, respectively using 100 m x 200 m quadrats. Remote sensing and field surveys were used to collect data on landform and surface attributes. Rodent burrows were surveyed and quantified by counting the number of burrows in 20m x 20m grids demarcated on the main 100m x 200m quadrats. The collected data were analysed in R software using boosted regression trees (BRT) technique. Rodent burrows were found at an elevation of above 1600m in the high and medium plague frequency landscapes. No burrows were found in the low plague frequency landscape situated below 1500m. BRT analysis shows a significant relationship between landform characteristics and rodent burrows in both high and medium plague frequency landscapes. Overall, elevation and hillshade are the most important determinants of rodent burrow distribution in the studied landscapes. It is concluded that in high altitudes, specific landform attributes (hill-shade, slope, elevation) and vegetation cover- favour rodent burrowing ispartof: Tanzania Journal of Health Research vol:16 issue:3 pages:1-14 ispartof: location:Tanzania status: published

The aim of this study was to assess and characterize Mycobacterium tuberculosis complex (MTBC) genotypic diversity in Tanzania, as well as in neighbouring East and other several African countries. We used spoligotyping to identify a total of 293 M. tuberculosis clinical isolates (one isolate per patient) collected in the Bunda, Dar es Salaam, Ngorongoro and Serengeti areas in Tanzania. The results were compared with results in the SITVIT2 international database of the Pasteur Institute of Guadeloupe. Genotyping and phylogeographical analyses highlighted the predominance of the CAS, T, EAI, and LAM MTBC lineages in Tanzania. The three most frequent Spoligotype International Types (SITs) were: SIT21/CAS1-Kili (n = 76; 25.94%), SIT59/LAM11-ZWE (n = 22; 7.51%), and SIT126/EAI5 tentatively reclassified as EAI3-TZA (n = 18; 6.14%). Furthermore, three SITs were newly created in this study (SIT4056/EAI5 n = 2, SIT4057/T1 n = 1, and SIT4058/EAI5 n = 1). We noted that the East-African-Indian (EAI) lineage was more predominant in Bunda, the Manu lineage was more common among strains isolated in Ngorongoro, and the Central-Asian (CAS) lineage was more predominant in Dar es Salaam (p-value

Background and Objective: Lushoto district in north-eastern Tanzania has been an active focus of plague disease since 1980 and many pesticides were used to control rodents and fleas from 1980 to 2003 when outbreaks occurred yearly. For over seven years ago commercial Carbaryl 5% powder has been used for controlling fleas in the area. However, there is no current research to substantiate its effectiveness either in the laboratory or in the field.Methods: Immature stages of Xenopsylla brasiliensis were collected from two villages in Lushoto and transported to Sokoine University of Agriculture, Morogoro and reared in an insectary to stock colony. Known weights of commercial Carbaryl 5% powder were thoroughly mixed with known weights of clean fine sand as to obtain a final concentration of 0.05% of Carbaryl+sand mixture. The same concentration was suspended in 50cc distilled water and pieces of filter paper were soaked in the solution, left at room temperature until the suspension was fully adsorbed and the papers were left to dry. Adult fleas of mixed ages and of both sexes were obtained from the stock colony and exposed to both Carbaryl+sand mixture and Carbaryl-adsorbed filter papers for various periods of time. Field trials were carried out at Manolo and Viti villages where house and rodent flea indices were determined before and after dusting with commercial Carbaryl 5% powder. Results: In the laboratory tests, 100% mortality occurred at 90 minutes exposure in Carbaryl+sand mixture experiments and at 35 minutes exposure to Carbaryl-adsorbed filter papers. LT50 in both sets of exposure was 48.2 min and 23.1 min in Carbaryl+sand mixture and Carbaryl-coated filter papers tests respectively. In field trials, X. brasiliensis and Pulex irritans were the most abundant flea species. Post-dusting flea populations were significantly lower in treated than in control houses (p=0.028). House flea indices dropped from 7.7 to 0.33 and 37.8 to 0 in Viti and Manolo villages respectively at 3 months post-dusting.Conclusion: Commercial Carbaryl 5% powder in current use was still effective against potential flea vectors in Lushoto.

Background: Positive plant-plant interactions similar to specialised plant growth forms are potential strategies to overcome the environmental harshness of Afro-alpine ecosystems. However, knowledge about plant-plant interactions is limited for African alpine regions. Aims: We investigated the ameliorative effect of the densely leaved dwarf shrub Helichrysum citrispinum on two frequently co-occurring herbaceous plant species in the alpine zone of Mt. Kilimanjaro. Methods: We recorded microclimatic conditions, plant water potentials and gross primary production (GPP) for plants of the low-growing perennial Alchemilla johnstonii and the tussock grass Festuca abyssinica and compared these parameters between open sites and under H. citrispinum shrubs between July and August 2012. Results: Shrubs significantly buffered daily variation and extreme values of irradiation, air-, plant surface- and soil-temperatures as well as vapour pressure deficit. We found enhanced plant water potentials and gross primary production for shaded plants of both species investigated; ameliorative effects were higher for A. johnstonii than for F. abyssinica. Conclusions: Habitat amelioration of H. citrispinum significantly improves the productivity of plant species that grow under the shrub, although the net outcome may be affected by interspecific growth form differences. Future studies on positive plant-plant interactions should more strongly focus on the ecophysiological consequences of habitat amelioration.

International audience; First report of Rice yellow mottle virus in rice in Malawi

Since 1980 plague has been a human threat in the Western Usambara Mountains in Tanzania. However, the spatial-temporal pattern of plague occurrence remains poorly understood. The main objective of this study was to gain understanding of human activity patterns in relation to spatial distribution of fleas in Lushoto District. Data were collected in three landscapes differing in plague incidence. Field survey coupled with Geographic Information System (GIS) and physical sample collections were used to collect data in wet (April to June 2012) and dry (August to October 2012) seasons. Data analysis was done using GIS, one-way ANOVA and nonparametric statistical tools. The degree of spatial cooccurrence of potential disease vectors (fleas) and humans in Lushoto focus differs significantly (p ≤ 0.05) among the selected landscapes, and in both seasons. This trend gives a coarse indication of the possible association of the plague outbreaks and the human frequencies of contacting environments with fleas. The study suggests that plague surveillance and control programmes at landscape scale should consider the existence of plague vector contagion risk gradient from high to low incidence landscapes due to human presence and intensity of activities. ispartof: Tanzania Journal of Health Research vol:16 issue:3 pages:1-13 ispartof: location:Tanzania status: published

Fleas associated with different rodent species are considered as the major vectors of bubonic plague, which is still rampant in different parts of the world. The objective of this study was to investigate the contribution of land use to rodent flea load distribution at fine scale in the plague endemic area of north-eastern Tanzania. Data was collected in three case areas namely, Shume, Lukozi and Mwangoi, differing in plague incidence levels. Data collection was carried out during both wet and dry seasons of 2012. Analysis of Variance and Boosted Regression Tree (BRT) statistical methods were used to clarify the relationships between fleas and specific land use characteristics. There was a significant variation (P ≤ 0.05) of flea indices in different land use types. Fallow and natural forest had higher flea indices whereas plantation forest mono-crop and mixed annual crops had the lowest flea indices among the aggregated land use types. The influence of individual land use types on flea indices was variable with fallow having a positive effect and land tillage showing a negative effect. The results also demonstrated a seasonal effect, part of which can be attributed to different land use practices such as application of pesticides, or the presence of grass strips around fields. These findings suggest that land use factors have a major influence on rodent flea abundance which can be taken as a proxy for plague infection risk. The results further point to the need for a comprehensive package that includes land tillage and crop type considerations on one hand and the associated human activities on the other, in planning and implementation of plague control interventions.

Heterogeneity in the landscapes of West Usambara Mountains on land use and human activities has been reported. However, the interface of land use patterns and human modified soils with small mammal and flea abundance for possible explanation of plague has not been explored. This study was carried out to determine the link between anthropogenic soils and land use patterns on small mammal and flea abundance and the occurrence of reported plague in the Western Usambara Mountains in Tanzania. Standard soil survey methods were used to identify and describe soils and land use patterns on lower slopes and valley bottoms on which the surrounding villages are reported to have high and medium plague frequencies. The identified soils were characterised in terms of their morphological and physico-chemical properties and classified according to FAO-World Reference Base for Soil Resources. Small mammals were trapped on the same landscape positions and identified to genus/species level. Fleas were removed from the trapped small mammals, counted and identified to species level. In total 57 small mammals were captured from which 32 fleas were collected. Results show that human settlements and mixed cultivation on lower slopes and continuous vegetable cropping in the valley bottoms are dominant land use types. Intensive use of forest soils, manuring and irrigation on farms in the studied landscapes have contributed to the development of uniquely human modified soils namely Hortic Anthrosols in the lower slopes and Plaggic Irragric Hortic Anthrosols in valley bottoms. The identified anthropogenic soils and land use patterns are associated with high abundance of small mammals (Mastomys natalensis) and flea species (Xenopsylla brasiliensis and Dinopsyllus lypusus). This phenomenon is vividly apparent in the villages with medium to high plague frequencies. The study suggests that plague surveillance programmes should consider the existing relationship between anthropogenic soils, land use patterns, small mammal and flea abundance.

Literature suggests that higher resolution remote sensing data integrated in Geographic Information System (GIS) can provide greater possibility to refine the analysis of land cover and terrain characteristics for explanation of abundance and distribution of plague hosts and vectors and hence of health risk hazards to humans. These technologies are not widely used in East Africa for studies on diseases including plague. The objective of this study was to refine the analysis of single and combined land cover and terrain characteristics in order to gain an insight into localized plague infection risks in the West Usambara Mountains in north-eastern Tanzania. The study used a geospatial approach to assess the influence of land cover and terrain factors on the abundance and spatial distribution of plague hosts (small mammals) and plague vectors (fleas). It considered different levels of scale and resolution. Boosted Regression Tree (BRT) statistical method was used to clarify the relationships between land cover and terrain variables with small mammals and fleas. Results indicate that elevation positively influenced the presence of small mammals. The presence of fleas was clearly influenced by land management features such as miraba. Medium to high resolution remotely sensed data integrated in a GIS have been found to be quite useful in this type of analysis. These findings contribute to efforts on plague surveillance and awareness creation among communities on the probable risks associated with various landscape factors during epidemics ispartof: Tanzania Journal of Health Research vol:16 issue:3 pages:1-13 ispartof: location:Tanzania status: published

Small mammals particularly rodents, are considered the primary natural hosts of plague. Literature suggests that plague persistence in natural foci has a root cause in soils. The objective of this study was to investigate the relationship between on the one hand landforms and associated soil properties, and on the other hand small mammals and fleas in West Usambara Mountains in Tanzania, a plague endemic area. Standard field survey methods coupled with Geographical Information System (GIS) technique were used to examine landform and soils characteristics. Soil samples were analysed in the laboratory for physico-chemical properties. Small mammals were trapped on pre-established landform positions and identified to genus/species level. Fleas were removed from the trapped small mammals and counted. Exploration of landform and soil data was done using ArcGIS Toolbox functions and descriptive statistical analysis. The relationships between landforms, soils, small mammals and fleas were established by generalised linear regression model (GLM) operated in R statistics software. Results show that landforms and soils influence the abundance of small mammals and fleas and their spatial distribution. The abundance of small mammals and fleas increased with increase in elevation. Small mammal species richness also increases with elevation. A landform-soil model shows that available phosphorus, slope aspect and elevation were statistically significant predictors explaining richness and abundance of small mammals. Fleas’ abundance and spatial distribution were influenced by hill-shade, available phosphorus and base saturation. The study suggests that landforms and soils have a strong influence on the richness and evenness of small mammals and their fleas’ abundance hence could be used to explain plague dynamics in the area.

The ability of bacteria to bind different compounds and to adhere to biotic and abiotic surfaces provides them with a range of advantages, such as colonization of various tissues, internalisation, avoidance of an immune response and survival and persistence in the environment. A variety of bacterial surface structures are involved in this process and these promote bacterial adhesion in a more or less specific manner. In this review, we will focus on those surface adhesins and exopolymers in selected foodborne pathogens that are involved mainly in primary adhesion. Their role in biofilm development will also be considered when appropriate. Both the clinical impact and implications for food safety of such adhesion will be discussed., The authors are members of the EU COST Action FA1202 (CGAFA1202): A European Network for Mitigating Bacterial Colonisation and Persistence on Foods and Food Processing Environments (http://www.bacfoodnet.org/) and acknowledge this action for facilitating collaborative networking that assisted with this study. The work was further supported by the Ministry of Education, Youth and Sports of the Czech Republic (project COST LD 14015 and project LO1218 under the NPU I program), the 'Cooperation Scientifique Universitaire (CSU)' France Denmark 2012 from the Embassy of France in Denmark 'Institut Francais du Danemark' (IFD) (no. 14/2012/CSU.8.2.1), the EGIDE Programme Hubert Curien (PHC) France Germany PROCOPE 2013 2015 from the 'Ministere des Affaires Etrangeres et Europeennes' (no. 28297WG) and by the Norwegian Research Council (grant no. 192402).

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

Congenital malaria is increasingly reported among babies born to mothers residing in malaria endemic areas despite the fact that maternal antibodies block malaria parasites from crossing the placenta into the foetus. The aim of this study was to determine the prevalence of congenital malaria among newborn babies delivered at Morogoro Regional Hospital, Tanzania. A cross-sectional study involving 200 women was conducted among pregnant women attending delivery services at the hospital. Socio-demographic and obstetric information of the mothers was also collected. Samples of the placental, cord and peripheral blood smears of mothers and babies were stained with Giemsa and examined for malaria parasites. Results showed that, prevalence of congenital malaria among newly born babies was 4.0% (n = 190). Prevalence rate of placental parasitemia was 7.0% (n = 184), while prevalence of cord parasitemia was 0.5% (n = 184). Prevalence rate of malaria among the mothers at delivery was 11.5% (n = 184). Plasmodiun falciparum was the dominant malaria parasite species. There was a strong association between placental, cord, maternal and congenital parasitemia whereby all babies with congenital malaria had infected mothers and placentas (p < 0.01). In conclusion, congenital malaria is still common in Tanzania especially in malaria endemic areas. It is recommended that, all malaria prevention and control programmes for pregnant women should adhere to the WHO guidelines involving intermittent presumptive treatment of pregnant women with an effective ant-malarial drug, prompt management of all cases and use of insecticide treated bed nets.