Search

Zinc (Zn) is essential for normal plant growth and development. The Zn-regulated transporter, iron-regulated transporter (IRT)-like protein (ZIP) family members are involved in Zn transport and cellular Zn homeostasis throughout the domains of life. In this study, we have characterized four ZIP transporters from Arabidopsis thaliana (IRT3, ZIP4, ZIP6, and ZIP9) to better understand their functional roles. The four ZIP proteins can restore the growth defect of a yeast Zn uptake mutant and are upregulated under Zn deficiency. Single and double mutants show no phenotypes under Zn-sufficient or Zn-limited growth conditions. In contrast, triple and quadruple mutants show impaired growth irrespective of external Zn supply due to reduced Zn translocation from root to shoot. All four ZIP genes are highly expressed during seed development, and siliques from all single and higher-order mutants exhibited an increased number of abnormal seeds and decreased Zn levels in mature seeds relative to wild type. The seed phenotypes could be reversed by supplementing the soil with Zn. Our data demonstrate that IRT3, ZIP4, ZIP6, and ZIP9 function redundantly in maintaining Zn homeostasis and seed development in A. thaliana.

Rice is a major crop worldwide, providing staple nourishment to half the global population. Improvements in rice productivity are essential to meet the needs of the growing global population. Rice productivity relies heavily on nitrogen (N) fertilization as N is crucial for rice growth and development and is the major limiting factor in most agricultural practices. However, excessive reliance on N fertilizer has adverse environmental impacts and increases production costs. Enhancing nitrogen use efficiency (NUE) is an urgent challenge in sustainable agriculture. This review summarizes the current understanding of N metabolism in rice and outlines the genetic modification of genes associated with N uptake and transport, assimilation, remobilization, and regulation to improve NUE. Recent research into NUE efficiency will facilitate the practical development of novel rice lines with increased productivity alongside low inputs of N fertilization.

Nitrogen (N) is a major limiting factor affecting crop yield in unfertilized soil. Thus, cultivars with a high N use efficiency (NUE) and good grain protein content (GPC) are needed to fulfill the growing food demand and to reduce environmental burden. This is especially true for rice (Oryza sativa L.) that is cultivated with a high input of N fertilizer and is a primary staple food crop for more than half of the global population. Here, we report that rice asparagine synthetase 1 (OsASN1) is required for grain yield and grain protein contents under both N-sufficient (conventional paddy fields) and N-limiting conditions from analyses of knockout mutant plants. In addition, we show that overexpression (OX) of OsASN1 results in better nitrogen uptake and assimilation, and increased tolerance to N limitation at the seedling stage. Under field conditions, the OsASN1 OX rice plants produced grains with increased N and protein contents without yield reduction compared to wild-type (WT) rice. Under N-limited conditions, the OX plants displayed increased grain yield and protein content with enhanced photosynthetic activity compared to WT rice. Thus, OsASN1 can be an effective target gene for the development of rice cultivars with higher grain protein content, NUE, and grain yield under N-limiting conditions.

Nicotianamine (NA) is produced by NA synthase (NAS), which contains three genes in rice and is responsible for chelating metals such as iron (Fe) and zinc (Zn), as well as preserving metal homeostasis. In this study, we generated a transgenic plant (23D) that shows simultaneous activation of OsNAS2 and OsNAS3 by crossing two previously identified activation-tagged mutants, OsNAS2-D1 (2D) and OsNAS3-D1 (3D). Concomitant activation of both genes resulted in the highest Fe and Zn concentrations in shoots and roots of the 23D plants grown under normal conditions and Fe and Zn limited growth conditions. Expression of genes for the biosynthesis of mugineic acid family phytosiderophores (MAs) and Fe and Zn uptake were enhanced in 23D roots. Additionally, 23D plants displayed superior growth to other plants at higher pH levels. Importantly, 23D seeds had NA and 2′-deoxymugineic acid (DMA) concentrations that were 50.6- and 10.0-fold higher than those of the WT. As a result, the mature grain Fe and Zn concentrations of the 23D plant were 4.0 and 3.5 times greater, respectively, than those of the WT. Furthermore, 23D plants exhibited the greatest resistance to excess metals. Our research suggests that simultaneous activation of OsNAS2 and OsNAS3 can enhance Fe and Zn accumulation in rice grains while also increasing plant tolerance to growing situations with metal deficiency and excess metal availability.

Chloroplasts are essential plant organelles that play important roles in photosynthesis and are involved in many fundamental metabolic pathways. Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development during chloroplast differentiation. In this study, we isolated and characterized T-DNA-tagged rice mutant (prpl13), which exhibited albino seedling lethality. PRPL13 is a nuclear gene encoding the 50S ribosomal protein L13, which is localized in chloroplasts. Transmission electronic microscopy analysis showed abnormal plastid development in the thylakoids of the chloroplasts of the prpl13 mutant seedlings. Chlorophyll and carotenoid contents were also significantly reduced in the leaves of the mutants. Quantitative reverse transcription-PCR analysis revealed that the prpl13 mutations altered the expression levels of genes involved in photosynthesis and chloroplast development. Thus, our data indicate that nuclear-encoded PRPL13 plays an important role in chloroplast development in rice.

International audience; Leaf senescence, which is the last developmental phase of plant growth, is controlled by multiple genetic and environmental factors. Leaf yellowing is a visual indicator of senescence due to the loss of the green pigment chlorophyll. During senescence, the methodical disassembly of macromolecules occurs, facilitating nutrient recycling and translocation from the sink to the source organs, which is critical for plant fitness and productivity. Leaf senescence is a complex and tightly regulated process, with coordinated actions of multiple pathways, responding to a sophisticated integration of leaf age and various environmental signals. Many studies have been carried out to understand the leaf senescence-associated molecular mechanisms including the chlorophyll breakdown, phytohormonal and transcriptional regulation, interaction with environmental signals, and associated metabolic changes. The metabolic reprogramming and nutrient recycling occurring during leaf senescence highlight the fundamental role of this developmental stage for the nutrient economy at the whole plant level. The strong impact of the senescence-associated nutrient remobilization on cereal productivity and grain quality is of interest in many breeding programs. This review summarizes our current knowledge in rice on (i) the actors of chlorophyll degradation, (ii) the identification of stay-green genotypes, (iii) the identification of transcription factors involved in the regulation of leaf senescence, (iv) the roles of leaf-senescence-associated nitrogen enzymes on plant performance, and (v) stress-induced senescence. Compiling the different advances obtained on rice leaf senescence will provide a framework for future rice breeding strategies to improve grain yield.

Zinc and iron are essential micronutrients for plant growth, and their homeostasis must be tightly regulated. Previously, it has been shown that Zinc-Induced Facilitator 1 (ZIF1) is involved in basal Zn tolerance by controlling the vacuolar storage of nicotianamine (NA). However, knowledge of the functional roles of two ZIF1 paralogs, ZIF-LIKE1 (ZIFL1) and ZIFL2, in metal homeostasis remains limited. Here, we functionally characterized the roles of ZIF1, ZIFL1, and ZIFL2 in Zn and Fe homeostasis. Expression of ZIF1 and ZIFL1 was induced by both excess Zn and Fe-deficiency, and their loss-of-function led to hypersensitivity under excess Zn and Fe-deficiency, suggesting functional overlap between ZIF1 and ZIFL1. By contrast, the disruption of ZIFL2 resulted in no obvious phenotypic alteration under both conditions. Additionally, the expression of ZIFL1, but not that of ZIFL2, in the zif1 mutant partially restored the phenotype under excess Zn, suggesting that ZIF1 and ZIFL1 perform functionally redundant roles in Zn homeostasis.

Summary Nitrogen (N) is a major factor for plant development and productivity. However, the application of nitrogenous fertilizers generates environmental and economic problems. To cope with the increasing global food demand, the development of rice varieties with high nitrogen use efficiency (NUE) is indispensable for reducing environmental issues and achieving sustainable agriculture. Here, we report that the concomitant activation of the rice (Oryza sativa) Ammonium transporter 1;2 (OsAMT1;2) and Glutamate synthetase 1 (OsGOGAT1) genes leads to increased tolerance to nitrogen limitation and to better ammonium uptake and N remobilization at the whole plant level. We show that the double activation of OsAMT1;2 and OsGOGAT1 increases plant performance in agriculture, providing better N grain filling without yield penalty under paddy field conditions, as well as better grain yield and N content when plants are grown under N llimitations in field conditions. Combining OsAMT1;2 and OsGOGAT1 activation provides a good breeding strategy for improving plant growth, nitrogen use efficiency and grain productivity, especially under nitrogen limitation, through the enhancement of both nitrogen uptake and assimilation., Significance Statement We report that concurrent activation of OsAMT1;2 and OsGOGAT1 confers better growth and improves the grain yield and quality of rice, especially under nitrogen limitation. Thus, our approach constitutes a promising strategy for improving nitrogen use efficiency in rice.

Increased grain yield will be critical to meet the growing demand for food, and could be achieved by delaying crop senescence. Here, via quantitative trait locus (QTL) mapping, we uncover the genetic basis underlying distinct life cycles and senescence patterns of two rice subspecies, indica and japonica. Promoter variations in the Stay-Green (OsSGR) gene encoding the chlorophyll-degrading Mg++-dechelatase were found to trigger higher and earlier induction of OsSGR in indica, which accelerated senescence of indica rice cultivars. The indica-type promoter is present in a progenitor subspecies O. nivara and thus was acquired early during the evolution of rapid cycling trait in rice subspecies. Japonica OsSGR alleles introgressed into indica-type cultivars in Korean rice fields lead to delayed senescence, with increased grain yield and enhanced photosynthetic competence. Taken together, these data establish that naturally occurring OsSGR promoter and related lifespan variations can be exploited in breeding programs to augment rice yield., Breeding crops with delayed senescence could plausibly increase grain yield. Here the authors show that variation at the rice SGR locus contributes to differences in senescence between indica and japonica subspecies and show that introgression can increase yield in an elite indica rice variety.

Flag leaves (FL) and second leaves (SL) in rice show differential aging patterns during monocarpic senescence. Coordination of aging programs between FL and SL is important for grain yield and quality. However, the molecular bases for differential aging programs between FL and SL have not been systematically explored in rice. Here, we performed mRNA-sequencing of FL and SL at six time points during grain-filling and identified four molecular bases for differential aging programs between FL and SL: phenylpropanoid biosynthesis, photosynthesis, amino acid (AA) transport, and hormone response. Of them, photosynthesis (carbon assimilation) and AA transport (nitrogen remobilization) predominantly occurred in FL and SL, respectively, during grain-filling. Unlike other molecular bases, AA transport showed consistent differential expression patterns between FL and SL in independent samples. Moreover, long-distance AA transporters showed invariant differential expression patterns between FL and SL after panicle removal, which was consistent to invariant differential nitrogen contents between FL and SL after panicle removal. Therefore, our results suggest that the supplies of carbon and nitrogen to seeds is functionally segregated between FL and SL and that long-distance AA transport is an invariant core program for high nitrogen remobilization in SL.

Internode elongation is one of the key agronomic traits determining a plant&rsquo, s height and biomass. However, our understanding of the molecular mechanisms controlling internode elongation is still limited in crop plant species. Here, we report the functional identification of an atypical basic helix-loop-helix transcription factor (OsbHLH073) through gain-of-function studies using overexpression (OsbHLH073-OX) and activation tagging (osbhlh073-D) lines of rice. The expression of OsbHLH073 was significantly increased in the osbhlh073-D line. The phenotype of osbhlh073-D showed semi-dwarfism due to deficient elongation of the first internode and poor panicle exsertion. Transgenic lines overexpressing OsbHLH073 confirmed the phenotype of the osbhlh073-D line. Exogenous gibberellic acid (GA3) treatment recovered the semi-dwarf phenotype of osbhlh073-D plants at the seedling stage. In addition, quantitative expression analysis of genes involving in GA biosynthetic and signaling pathway revealed that the transcripts of rice ent-kaurene oxidases 1 and 2 (OsKO1 and OsKO2) encoding the GA biosynthetic enzyme were significantly downregulated in osbhlh073-D and OsbHLH073-OX lines. Yeast two-hybrid and localization assays showed that the OsbHLH073 protein is a nuclear localized-transcriptional activator. We report that OsbHLH073 participates in regulating plant height, internode elongation, and panicle exsertion by regulating GA biosynthesis associated with the OsKO1 and OsKO2 genes.

Iron (Fe) is an important micronutrient used by all living organisms for proper development. A deficiency in that element causes a metabolic imbalance that is deleterious to plant growth, making it a significant worldwide health concern. In response to limited Fe supplies, rice plants use a combination of strategies to take up iron from the soil. As a major staple crop, rice varieties that contain high levels of Fe would be vital for improving public nutritional status. Therefore, understanding the molecular components for Fe homeostasis and fortification in rice is crucial to the production of high-iron grains.

Micronutrient deficiencies affect approximately 3 billion people worldwide. Malnutrition hinders the development of human potential and social and economic development in developing countries. The World Health Organization (WHO) and the Consultative Group on International Agricultural Research (CGIAR) have made fighting micronutrient deficiencies, known as hidden hunger, a high priority. Deficiencies of the micronutrients, such as iron, zinc, and vitamin A, are the most devastating among the world’s poor. WHO emphasizes nutrient supplementation and food fortification to address the malnutrition. CGIAR has placed a greater emphasis on biofortification through the HarvestPlus challenge program, and improved micronutrient content of the staple crops (rice, wheat, maize, beans, cassava, pearl millet, and sweet potato) through breeding and biotechnological approaches. An excellent example of biotechnology application is the development of ‘golden rice’ with adequate levels of a provitamin A, β-carotene. The Africa Harvest and the BioCassava Plus programs, respectively, are developing sorghum and cassava with improved nutritional quality. Here, we summarize current strategies of crop biofortification and future prospects towards the development of biofortified crops.

Because micronutrients in human diets ultimately come from plant sources, malnutrition of essential minerals is a significant public health concern. By increasing the expression of nicotianamine synthase (NAS), we fortified the level of bioavailable iron in rice seeds. Activation of iron deficiency-inducible OsNAS2 resulted in a rise in Fe content (3.0-fold) in mature seeds. Its ectopic expression also increased that content. Enhanced expression led to higher tolerance of Fe deficiency and better growth under elevated pH. Mice fed with OsNAS2-D1 seeds recovered more rapidly from anemia, indicating that bioavailable Fe contents were improved by this increase in OsNAS2 expression.

Zinc is an essential micronutrient for several physiological and biochemical processes. To investigate its transport in rice, we characterized OsZIP8, a rice ZIP (Zrt, Irt-like Protein) gene that is strongly up-regulated in shoots and roots under Zn deficiency. OsZIP8 could complement the growth defect of Zn-uptake yeast mutant. The OsZIP8-GFP fusion proteins were localized to the plasma membrane, suggesting that OsZIP8 is a plasma membrane zinc transporter in rice. Activation and overexpression of this gene disturbed the zinc distribution in rice plants, resulting in lower levels in shoots and mature seeds, but an increase in the roots. Field-grown transgenic plants were shorter than the WT. Under treatment with excess zinc, transgenics contained less zinc in their shoots but accumulated more in the roots. Altogether, these results demonstrate that OsZIP8 is a zinc transporter that functions in Zn uptake and distribution. Furthermore, zinc homeostasis is important to the proper growth and development of rice.

Uptake and translocation of metal nutrients are essential processes for plant growth. Graminaceous species release phytosiderophores that bind to Fe3+; these complexes are then transported across the plasma membrane. We have characterized OsYSL15, one of the rice (Oryza sativa) YS1-like (YSL) genes that are strongly induced by iron (Fe) deficiency. The OsYSL15 promoter fusion to β-glucuronidase showed that it was expressed in all root tissues when Fe was limited. In low-Fe leaves, the promoter became active in all tissues except epidermal cells. This activity was also detected in flowers and seeds. The OsYSL15:green fluorescent protein fusion was localized to the plasma membrane. OsYSL15 functionally complemented yeast strains defective in Fe uptake on media containing Fe3+-deoxymugineic acid and Fe2+-nicotianamine. Two insertional osysl15 mutants exhibited chlorotic phenotypes under Fe deficiency and had reduced Fe concentrations in their shoots, roots, and seeds. Nitric oxide treatment reversed this chlorosis under Fe-limiting conditions. Overexpression of OsYSL15 increased the Fe concentration in leaves and seeds from transgenic plants. Altogether, these results demonstrate roles for OsYSL15 in Fe uptake and distribution in rice plants.

Uptake and translocation of micronutrients are essential for plant growth. These micronutrients are also important food components. We generated transgenic rice plants over-expressing OsIRT1 to evaluate its functional roles in metal homeostasis. Those plants showed enhanced tolerance to iron deficiency at the seedling stage. In paddy fields, this over-expression caused plant architecture to be altered. In addition, those plants were sensitive to excess Zn and Cd, indicating that OsIRT1 also transports those metals. As expected, iron and zinc contents were elevated in the shoots, roots and mature seeds of over-expressing plants. This demonstrates that OsIRT1 can be used for enhancing micronutrient levels in rice grains.

Rice blast, caused by the fungus Magnaporthe oryzae, is one of the most devastating diseases of rice. To understand the molecular basis of Pi5-mediated resistance to M. oryzae, we cloned the resistance (R) gene at this locus using a map-based cloning strategy. Genetic and phenotypic analyses of 2014 F2 progeny from a mapping population derived from a cross between IR50, a susceptible rice cultivar, and the RIL260 line carrying Pi5 enabled us to narrow down the Pi5 locus to a 130-kb interval. Sequence analysis of this genomic region identified two candidate genes, Pi5-1 and Pi5-2, which encode proteins carrying three motifs characteristic of R genes: an N-terminal coiled-coil (CC) motif, a nucleotide-binding (NB) domain, and a leucine-rich repeat (LRR) motif. In genetic transformation experiments of a susceptible rice cultivar, neither the Pi5-1 nor the Pi5-2 gene was found to confer resistance to M. oryzae. In contrast, transgenic rice plants expressing both of these genes, generated by crossing transgenic lines carrying each gene individually, conferred Pi5-mediated resistance to M. oryzae. Gene expression analysis revealed that Pi5-1 transcripts accumulate after pathogen challenge, whereas the Pi5-2 gene is constitutively expressed. These results indicate that the presence of these two genes is required for rice Pi5-mediated resistance to M. oryzae.

P1B-type heavy-metal ATPases (HMAs) are transmembrane metal-transporting proteins that play a key role in metal homeostasis. Despite their importance, very little is known about their functions in monocot species. We report the characterization of rice (Oryza sativa) OsHMA9, a member of the P1B-type ATPase family. Semiquantitative reverse transcription-polymerase chain reaction analyses of seedlings showed that OsHMA9 expression was induced by a high concentration of copper (Cu), zinc (Zn), and cadmium. We also determined, through promoter∷β-glucuronidase analysis, that the main expression was in the vascular bundles and anthers. The OsHMA9:green fluorescence protein fusion was localized to the plasma membrane. Heterologous expression of OsHMA9 partially rescued the Cu sensitivity of the Escherichia coli copA mutant, which is defective in Cu-transporting ATPases. It did not rescue the Zn sensitivity of the zntA mutant, which is defective in Zn-transporting ATPase. To further elucidate the functional roles of OsHMA9, we isolated two independent null alleles, oshma9-1 and oshma9-2, from the T-DNA insertion population. Mutant plants exhibited the phenotype of increased sensitivity to elevated levels of Cu, Zn, and lead. These results support a role for OsHMA9 in Cu, Zn, and lead efflux from the cells. This article is the first report on the functional characterization of a P1B-type metal efflux transporter in monocots.

T-DNA and transposable elements e.g., Ds and Tos17, are used to generate a large number of insertional mutant lines in rice. Some carry the GUS or GFP reporter for gene trap or enhancer trap. These reporter systems are valuable for identifying tissue- or organ-preferential genes. Activation tagging lines have also been generated for screening mutants and isolating mutagenized genes. To utilize these resources more efficiently, tagged lines have been produced for reverse genetic approaches. DNA pools of the T-DNA tagged lines and Tos17 lines have been prepared for PCR screening of insertional mutants in a given gene. Tag end sequences (TES) of the inserts have also been produced. TES databases are beneficial for analyzing the function of a large number of rice genes.

We investigated the frequency of callus induction from mature-seed scutella of 39 varieties of Tongil rice(Oryza sativa japonica x indica). These were divided into two groups according to condition of the callus at the time of induction. Members of the first group, which developed brown calli, were further classified into two types (B1 or B2), based on the extent of their color change and callus condition. Tissues in the second group developed yellow calli, with varieties being placed into one of three types (Y1, Y2, or Y3) according to solidity. Type-Y1 seeds generated suitably soft calli that were healthy and grew rapidly. These calli were transformed with binary vector pGA2722 viaAgrobacterium- mediated co-cultivation. The vector contained the hygromycin-resistance selectable marker and agus reporter gene with an intron that is functional in plant cells but not inAgrobacterium. Most varieties that formed brown calli failed to generate transformants. Likewise, several varieties with suitably soft calli also failed. Among the 16 transformable varieties, the final regeneration frequencies ranged from 1.0 to 10.7%. The highest frequency was achieved by the variety Tongil, which also had the most rapidly growing calli. DNA gel-blot analysis revealed one to three copies of the introducedgus gene.

The genomic clone encoding an α-tubulin,OsTubA1, has been isolated from rice (Oryza sativa L.). The gene consists of four exons and three introns. RNA-blot analysis showed that the gene is strongly expressed in actively dividing tissues, including root tips, young leaves, and young flowers. Analysis of chimeric fusions between OsTubA1and β-glucuronidase (GUS) revealed that the intron 1 was required for high-level GUS expression in actively dividing tissues, corresponding with normal expression pattern ofOsTubA1. Fusion constructs lacking the intron 1 showed more GUS staining in mature tissues rather than young tissues. When the intron 1 was placed at the distal region from 5′-upstream region or at the 3′-untranslated region, no enhancement of GUS expression was observed. Sequential deletions of the OsTubA1 intron 1 brought about a gradual reduction of GUS activity in calli. These results suggest that tissue-preferential expression of theOsTubA1 gene is mediated by the intron 1 and that it may be involved in a mechanism for an efficient RNA splicing that is position dependent.

We have produced 22 090 primary transgenic rice plants that carry a T-DNA insertion, which has resulted in 18 358 fertile lines. Genomic DNA gel-blot and PCR analyses have shown that approximately 65% of the population contains more than one copy of the inserted T-DNA. Hygromycin resistance tests revealed that transgenic plants contain an average of 1.4 loci of T-DNA inserts. Therefore, it can be estimated that approximately 25 700 taggings have been generated. The binary vector used in the insertion contained the promoterless beta-glucuronidase (GUS) reporter gene with an intron and multiple splicing donors and acceptors immediately next to the right border. Therefore, this gene trap vector is able to detect a gene fusion between GUS and an endogenous gene, which is tagged by T-DNA. Histochemical GUS assays were carried out in the leaves and roots from 5353 lines, mature flowers from 7026 lines, and developing seeds from 1948 lines. The data revealed that 1.6-2.1% of tested organs were GUS-positive in the tested organs, and that their GUS expression patterns were organ- or tissue-specific or ubiquitous in all parts of the plant. The large population of T-DNA-tagged lines will be useful for identifying insertional mutants in various genes and for discovering new genes in rice.

Plant architecture is an important factor that controls several characteristics, such as light interception, harvest index, and lodging. Plant architecture is controlled by a group of regulatory genes. It was previously found that ectopic expression of some MADS-box genes resulted in early flowering and a dwarf habit in Arabidopsis and tobacco (Nicotiana tabacum) plants. To explore ways to alter heading time and heading height, we expressed ectopically several OsMADS (Oryza sativa MADS-box) genes in rice plants. The OsMADS cDNA clones were connected to the maize ubiquitin promoter in the sense orientation, and the constructs were introduced into rice plants by the Agrobacterium-mediated transformation. Ectopic expression of the rice MADS-box genes hastened flowering to varying extents. RNA-blot analyses revealed that the phenotypes of early flowering and dwarfism were correlated with the transcript level of the transgene. In addition, weak expression of OsMADS1 using the nopaline synthase (nos) promoter, shortened the heading time by a few days and resulted in a mild reduction of heading height without any pleiotropic effects. The present study suggests that the rice MADS box genes could be used as sources of early-flowering and dwarfing traits in monocot species.

We constructed binary vectors that were designed for transfer and expression of a gene into rice chromosomes. The binary vectors contained the hygromycin-resistance gene for selection of transformants and multiple-cloning sites within the transfer DNA. In addition, vectors were designed to express foreign genes using four kinds of promoters. We also report a procedure for efficient transformation of rice plants using scutellum-derived calli and theAgrobacterium strain LBA4404.

An anther-specific cDNA clone of rice, RA8, was isolated from an anther cDNA library by differential screening. RNA blot analysis indicated that the RA8 transcript is present specifically in anthers and the transcript level increased as flowers matured, reaching the highest level in mature flowers. The RA8 clone contains an open reading frame of 264 amino acid residues with a hydrophobic N-terminal region. The deduced amino acid sequences did not show significant homology to any known sequences. Genomic DNA blot analysis showed that RA8 is a single-copy gene. A genomic clone corresponding to the RA8 cDNA was isolated and its promoter region was fused to the β-glucuronidase (GUS) gene. Transgenic rice plants exhibited anther-specific expression of the GUS reporter gene. Histochemical GUS analysis showed that the RA8 promoter was active in the tapetum, endothecium, and connective tissues of anthers. Experiments showed that expression of the gene starts when microspores are released from tetrads, and it reaches to the maximum level at the late vacuolated-pollen stage. The RA8 promoter may be useful for controlling gene expression in anthers of cereal plants and for generating male-sterile plants.

The functions of two rice MADS-box genes were studied by the loss-of-function approach. The first gene, OsMADS4, shows a significant homology to members in the PISTILLATA (PI) family, which is required to specify petal and stamen identity. The second gene, OsMADS3, is highly homologous to the members in the AGAMOUS (AG) family that is essential for the normal development of the internal two whorls, the stamen and carpel, of the flower. These two rice MADS box cDNA clones were connected to the maize ubiquitin promoter in an antisense orientation and the fusion molecules were introduced to rice plants by the Agrobacterium-mediated transformation method. Transgenic plants expressing antisense OsMADS4 displayed alterations of the second and third whorls. The second-whorl lodicules, which are equivalent to the petals of dicot plants in grasses, were altered into palea/lemma-like organs, and the third whorl stamens were changed to carpel-like organs. Loss-of-function analysis of OsMADS3 showed alterations in the third and fourth whorls. In the third whorl, the filaments of the transgenic plants were changed into thick and fleshy bodies, similar to lodicules. Rather than making a carpel, the fourth whorl produced several abnormal flowers. These phenotypes are similar to those of the agamous and plena mutants in Arabidopsis and Antirrhinum, respectively. These results suggest that OsMADS4 belongs to the class B gene family and OsMADS3 belongs to the class C gene family of floral organ identity determination.

We generated rice lines with increased content of nicotianamine (NA), a key ligand for metal transport and homeostasis. This was accomplished by activation tagging of rice nicotianamine synthase 2 (OsNAS2). Enhanced expression of the gene resulted in elevated NA levels, greater Zn accumulations and improved plant tolerance to a Zn deficiency. Expression of Zn-uptake genes and those for the biosynthesis of phytosiderophores (PS) were increased in transgenic plants. This suggests that the higher amount of NA led to greater exudation of PS from the roots, as well as stimulated Zn uptake, translocation and seed-loading. In the endosperm, the OsNAS2 activation-tagged line contained up to 20-fold more NA and 2.7-fold more zinc. Liquid chromatography combined with inductively coupled plasma mass spectrometry revealed that the total content of zinc complexed with NA and 2'-deoxymugineic acid was increased 16-fold. Mice fed with OsNAS2-D1 seeds recovered more rapidly from a zinc deficiency than did control mice receiving WT seeds. These results demonstrate that the level of bio-available zinc in rice grains can be enhanced significantly by activation tagging of OsNAS2.

Zinc is essential for normal plant growth and development. To understand its transport in rice, we characterized OsZIP5, which is inducible under Zn deficiency. OsZIP5 complemented the growth defect of a yeast Zn-uptake mutant, indicating that OsZIP5 is a Zn transporter. The OsZIP5-GFP fusion protein was localized to the plasma membrane. Transgenic plants overexpressing the gene grew less well. Overexpression of the gene decreased the Zn concentration in shoots, but caused it to rise in the roots. Knockout plants showed no visible phenotypic changes under either normal or deficient conditions. However, they were tolerant to excess Zn and contained less Zn. In contrast, overexpressing transgenics were sensitive to excess Zn. These results indicate that OsZIP5 plays a role in Zn distribution within rice.

Cadmium (Cd) is a widespread soil pollutant; thus, the underlying molecular controls of plant Cd tolerance are of substantial interest. A screen for wheat (Triticum aestivum) genes that confer Cd tolerance to a Cd hypersensitive yeast strain identified Heat shock transcription factor A4a (HsfA4a). Ta HsfA4a is most similar to the class A4 Hsfs from monocots. The most closely related rice (Oryza sativa) homolog, Os HsfA4a, conferred Cd tolerance in yeast, as did Ta HsfA4a, but the second most closely related rice homolog, Os HsfA4d, did not. Cd tolerance was enhanced in rice plants expressing Ta HsfA4a and decreased in rice plants with knocked-down expression of Os HsfA4a. An analysis of the functional domain using chimeric proteins constructed from Ta HsfA4a and Os HsfA4d revealed that the DNA binding domain (DBD) of HsfA4a is critical for Cd tolerance, and within the DBD, Ala-31 and Leu-42 are important for Cd tolerance. Moreover, Ta HsfA4a–mediated Cd resistance in yeast requires metallothionein (MT). In the roots of wheat and rice, Cd stress caused increases in HsfA4a expression, together the MT genes. Our findings thus suggest that HsfA4a of wheat and rice confers Cd tolerance by upregulating MT gene expression in planta.

The most widespread dietary problem in the world is mineral deficiency. We used the nicotianamine synthase ( NAS ) gene to increase mineral contents in rice grains. Nicotianamine (NA) is a chelator of metals and a key component of metal homeostasis. We isolated activation-tagged mutant lines in which expression of a rice NAS gene, OsNAS3 , was increased by introducing 35S enhancer elements. Shoots and roots of the OsNAS3 activation-tagged plants ( OsNAS3-D1 ) accumulated more Fe and Zn. Seeds from our OsNAS3-D1 plants grown on a paddy field contained elevated amounts of Fe (2.9-fold), Zn (2.2-fold), and Cu (1.7-fold). The NA level was increased 9.6-fold in OsNAS3-D1 seeds. Analysis by size exclusion chromatography coupled with inductively coupled plasma mass spectroscopy showed that WT and OsNAS3-D1 seeds contained equal amounts of Fe bound to IP6, whereas OsNAS3-D1 had 7-fold more Fe bound to a low molecular mass, which was likely NA. Furthermore, this activation led to increased tolerance to Fe and Zn deficiencies and to excess metal (Zn, Cu, and Ni) toxicities. In contrast, disruption of OsNAS3 caused an opposite phenotype. To test the bioavailability of Fe, we fed anemic mice with either engineered or WT seeds for 4 weeks and measured their concentrations of hemoglobin and hematocrit. Mice fed with engineered seeds recovered to normal levels of hemoglobin and hematocrit within 2 weeks, whereas those that ate WT seeds remained anemic. Our results suggest that an increase in bioavailable mineral content in rice grains can be achieved by enhancing NAS expression.

OsMADS1 is a rice MADS box gene necessary for floral development. To identify the key cis-regulatory regions for its expression, we utilized transgenic rice plants expressing GUS fusion constructs. Histochemical analysis revealed that the 5.7-kb OsMADS1 intragenic sequences, encompassing exon 1, intron 1, and a part of exon 2, together with the 1.9-kb 5' upstream promoter region, are required for the GUS expression pattern that coincides with flower-preferential expression of OsMADS1. In contrast, the 5' upstream promoter sequence lacking this intragenic region caused ectopic expression of the reporter gene in both vegetative and reproductive tissues. Notably, incorporation of the intragenic region into the CaMV35S promoter directed the GUS expression pattern similar to that of the endogenous spatial expression of OsMADS1 in flowers. In addition, our transient gene expression assay revealed that the large first intron following the CaMV35S minimal promoter enhances flower-preferential expression of GUS. These results suggest that the OsMADS1 intragenic sequence, largely intron 1, contains a key regulatory region(s) essential for expression.

A novel approach to utilizing whey permeate, the cultivation of mycelia of the edible mushroom Ganoderma lucidum, is introduced. The major objective of this research was to use whey permeate as an alternative growth medium for the cultivation of mycelia of edible mushroom G. lucidum and to find an optimum condition for solid-state cultivation. Response surface analysis was applied to determine the combination of substrate concentration (25 to 45 g of lactose/L), pH (3.5 to 5.5), and temperature (25 to 35 degrees C) resulting in a maximal mycelial growth. The radial extension rates, estimated by measuring the diameters of growing colonies on the Petri dishes, were used as the growth of the mycelia at different conditions. In the model, pH and temperature significantly affected mycelial growth, but lactose concentration did not. The condition predicted to maximize the radial extension rate of 17.6 +/- 0.4 mm/d was determined to be pH 4.4 and temperature 29.4 degrees C. Therefore, the results suggest that whey permeate could be utilized as a growth substrate for the cultivation of mycelia from the edible mushroom G. lucidum, enhancing the use of this by-product by the cheese manufacturing industry.

T-DNA-tagged rice plants were screened under cold- or salt-stress conditions to determine the genes involved in the molecular mechanism for their abiotic-stress response. Line 0-165-65 was identified as a salt-responsive line. The gene responsible for this GUS-positive phenotype was revealed by inverse PCR as OsGSK1 (O ryza s ativa g lycogen s ynthase k inase3-like gene 1), a member of the plant GSK3/SHAGGY-like protein kinase genes and an orthologue of the Arabidopsis b rassinosteroid in sensitive 2 (BIN2), AtSK21. Northern blot analysis showed that OsGSK1 was most highly detected in the developing panicles, suggesting that its expression is developmental stage specific. Knockout (KO) mutants of OsGSK1 showed enhanced tolerance to cold, heat, salt, and drought stresses when compared with non-transgenic segregants (NT). Overexpression of the full-length OsGSK1 led to a stunted growth phenotype similar to the one observed with the gain-of-function BIN/AtSK21 mutant. This suggests that OsGSK1 might be a functional rice orthologue that serves as a negative regulator of brassinosteroid (BR)-signaling. Therefore, we propose that stress-responsive OsGSK1 may have physiological roles in stress signal-transduction pathways and floral developmental processes.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

As a first step towards identifying genes involving in the signal transduction pathways mediating rice blast resistance, we isolated 3 mutants lines that showed enhanced susceptibility to rice blast KJ105 (91-033) from a T-DNA insertion library of the japonica rice cultivar, Hwayeong. Since none of the susceptible phenotypes co-segregated with the T-DNA insertion we adapted a map-based cloning strategy to isolate the gene(s) responsible for the enhanced susceptibility of the Hwayeong mutants. A genetic mapping population was produced by crossing the resistant wild type Hwayeong with the susceptible cultivar, Nagdong. Chi-square analysis of the F2 segregating population indicated that resistance in Hwayeong was controlled by a single major gene that we tentatively named Pi-hy. Randomly selected susceptible plants in the F2 population were used to build an initial map of Pi-hy. The SSLP marker RM2265 on chromosome 2 was closely linked to resistance. High resolution mapping using 105 F2 plants revealed that the resistance gene was tightly linked, or identical, to Pib, a resistance gene with a nucleotide binding sequence and leucine-rich repeats (NB-LRR) previously isolated. Sequence analysis of the Pib locus amplified from three susceptible mutants revealed lesions within this gene, demonstrating that the Pi-hy gene is Pib. The Pib mutations in 1D-22-10-13, 1D-54-16-8, and 1C-143-16-1 were, respectively, a missense mutation in the conserved NB domain 3, a nonsense mutation in the 5th LRR, and a nonsense mutation in the C terminus following the LRRs that causes a small deletion of the C terminus. These findings provide evidence that NB domain 3 and the C terminus are required for full activity of the plant R gene. They also suggest that alterations of the resistance gene can cause major differences in pathogen specificity by affecting interactions with an avirulence factor.

Chlorophyll b is synthesized from chlorophyll a by chlorophyll a oxygenase. We have identified two genes (OsCAO1 and OsCAO2) from the rice genome that are highly homologous to previously studied chlorophyll a oxygenase (CAO) genes. They are positioned in tandem, probably resulting from recent gene duplications. The proteins they encode contain two conserved functional motifs - the Rieske Fe-sulfur coordinating center and a non-heme mononuclear Fe-binding site. OsCAO1 is induced by light and is preferentially expressed in photosynthetic tissues. Its mRNA level decreases when plants are grown in the dark. In contrast, OsCAO2 mRNA levels are higher under dark conditions, and its expression is down-regulated by exposure to light. To elucidate the physiological function of the CAO genes, we have isolated knockout mutant lines tagged by T-DNA or Tos17. Mutant plants containing a T-DNA insertion in the first intron of the OsCAO1 gene have pale green leaves, indicating chlorophyll b deficiency. We have also isolated a pale green mutant with a Tos17 insertion in that OsCAO1 gene. In contrast, OsCAO2 knockout mutant leaves do not differ significantly from the wild type. These results suggest that OsCAO1 plays a major role in chlorophyll b biosynthesis, and that OsCAO2 may function in the dark.

We used a transgenic approach and yeast two-hybrid experiments to study the role of the rice ( Oryza sativa L.) B-function MADS-box gene, OsMADS16. Transgenic rice plants were generated that ectopically expressed OsMADS16 under the control of the maize ( Zea mays L.) ubiquitin1 promoter. Microscopic observations revealed that the innermost-whorl carpels had been replaced by stamen-like organs, which resembled the flowers of the previously described Arabidopsis thaliana (L.) Heynh. mutation superman as well as those ectopically expressing the AP3 gene. These results indicate that expression of OsMADS16 in the innermost whorl induces stamen development. Occasionally, carpels had completely disappeared. In addition, ectopic expression of OsMADS16 enhanced expression of OsMADS4, another B-function gene, causing superman phenotypes. In the yeast two-hybrid system, OsMADS16 did not form a homodimer but, rather, the protein interacted with OsMADS4. OsMADS16 also interacted with OsMADS6 and OSMADS8, both of which are homologous to SEPALLATA proteins required for the proper function of class-B and class-C genes in Arabidopsis. Based on the gene expression pattern and our yeast two-hybrid data, we discuss a quartet model of MADS-domain protein interactions in the lodicule and stamen whorls of rice florets.

Rice contains several MADS box genes. It has been demonstrated previously that one of these genes, OsMADS1 (for Oryza sativa MADS box gene1), is expressed preferentially in flowers and causes early flowering when ectopically expressed in tobacco plants. In this study, we demonstrated that ectopic expression of OsMADS1 in rice also results in early flowering. To further investigate the role of OsMADS1 during rice flower development, we generated transgenic rice plants expressing altered OsMADS1 genes that contain missense mutations in the MADS domain. There was no visible alteration in the transgenic plants during the vegetative stage. However, transgenic panicles typically exhibited phenotypic alterations, including spikelets consisting of elongated leafy paleae and lemmas that exhibit a feature of open hull, two pairs of leafy palea-like and lemma-like lodicules, a decrease in stamen number, and an increase in the number of carpels. In addition, some spikelets generated an additional floret from the same rachilla. These characteristics are very similar to those of leafy hull sterile1 (lhs1). The map position of OsMADS1 is closely linked to that of lhs1 on chromosome 3. Examination of lhs1 revealed that it contains two missense mutations in the OsMADS1 MADS domain. A genetic complementation experiment showed that the 11.9-kb genomic DNA fragment containing the wild-type OsMADS1 gene rescued the mutant phenotypes. In addition, ectopic expression of the OsMADS1 gene isolated from the lhs1 line resulted in lhs1-conferred phenotypes. These lines of evidence demonstrate that OsMADS1 is the lhs1 gene.