Search

Studies have confirmed that prostate stem cell antigen (PSCA) rs2294008 C>T polymorphism is related to gastric cancer susceptibility, but some studies have reached the opposite conclusion. In this meta-analysis, we attempted to clear up these differences and explore the relationship between the different factors that influence susceptibility to gastric cancer. Studies with publication dates that preceded 16 April 2022 were selected from PubMed, Springer, EMBASE, and Web of Science, and the relationship between risk models and gastric cancer was analyzed by odds ratios (ORs) and 95% confidence intervals. Consequently, it was confirmed that PSCA rs2294008 polymorphism leads to an increased risk of gastric cancer. Subgroup analysis found that individuals with diffuse gastric cancer, non-cardia gastric cancer, Helicobacter pylori (HP)-positive or who are from the white or Asian population faced an increased susceptibility to gastric cancer. Those from the white populations faced significantly higher risks than Asians, and the association of PSCA with gastric cancer could be significantly increased by genome-wide association analysis. However, the conclusion that smoking reduces susceptibility to gastric cancer appears to be abnormal. Further prospective investigations that involve smoking and have a larger sample size are required.

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3–4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.

Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Additional file 1: Table S1. Mutations in limb development genes found in WGS