Search

The free-field switching of the perpendicular magnetization by the out-of-plane polarized spin current induced spin-orbit torque makes it a promising technology for developing high-density memory and logic devices. The materials intrinsically with low symmetry are generally utilized to generate the spin current with out-of-plane spin polarization. However, the generation of the out-of-plane polarized spin current by engineering the symmetry of materials has not yet been reported. Here, we demonstrate that paramagnetic CaRuO 3 films are able to generate out-of-plane polarized spin current by engineering the crystal symmetry. The non-uniform oxygen octahedral tilt/rotation along film's normal direction induced by oxygen octahedral coupling near interface breaks the screw-axis and glide-plane symmetries, which gives rise to a significant out-of-plane polarized spin current. This spin current can drive field-free spin-orbit torque switching of perpendicular magnetization with high efficiency. Our results offer a promising strategy based on crystal symmetry design to manipulate spin current and could have potential applications in advanced spintronic devices., (© 2024. The Author(s).)

Aim: To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32., Methods: A family with familial exudative vitreoretinopathy (FEVR) phenotype was included in the study. Whole-exome sequencing (WES) was initially used to locate copy number variations (CNVs) on 7q31.31-31.32, but failed to detect the precise breakpoint. The long-read sequencing, Oxford Nanopore sequencing Technology (ONT) was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction (QPCR) and Sanger Sequencing., Results: The proband, along with her father and younger brother, were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32, which included the FEVR-related gene TSPAN12 . The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del. The proband exhibited a phase 2A FEVR phenotype, characterized by a falciform retinal fold, macular dragging, and peripheral neovascularization with leaking of fluorescence. These symptoms led to a significant decrease in visual acuity in both eyes. On the other hand, the affected father and younger brother showed a milder phenotype., Conclusion: The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype. The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders., (International Journal of Ophthalmology Press.)

Polarized quarks and antiquarks in high-energy heavy-ion collisions can lead to the spin alignment of vector mesons formed by quark coalescence. Using the relativistic spin Boltzmann equation for vector mesons derived from Kadanoff-Baym equations with an effective quark-meson model for strong interaction and quark coalescence model for hadronizaton, we calculate the spin density matrix element ρ_{00} for ϕ mesons and show that anisotropies of local field correlations with respect to the spin quantization direction lead to ϕ meson's spin alignment. We propose that the local correlation or fluctuation of ϕ fields is the dominant mechanism for the observed ϕ meson's spin alignment and its strength can be extracted from experimental data as functions of collision energies. The calculated transverse momentum dependence of ρ_{00} agrees with STAR's data. We further predict the azimuthal angle dependence of ρ_{00} which can be tested in future experiments.

Treatment with metformin can lead to the recovery of pleiotropic biological activities after spinal cord injury. However, its effect on spinal cord injury in aged mice remains unclear. Considering the essential role of angiogenesis during the regeneration process, we hypothesized that metformin activates the adenosine monophosphate-activated protein kinase/endothelial nitric oxide synthase pathway in endothelial cells, thereby promoting microvascular regeneration in aged mice after spinal cord injury. In this study, we established young and aged mouse models of contusive spinal cord injury using a modified Allen method. We found that aging hindered the recovery of neurological function and the formation of blood vessels in the spinal cord. Treatment with metformin promoted spinal cord microvascular endothelial cell migration and blood vessel formation in vitro. Furthermore, intraperitoneal injection of metformin in an in vivo model promoted endothelial cell proliferation and increased the density of new blood vessels in the spinal cord, thereby improving neurological function. The role of metformin was reversed by compound C, an adenosine monophosphate-activated protein kinase inhibitor, both in vivo and in vitro, suggesting that the adenosine monophosphate-activated protein kinase/endothelial nitric oxide synthase pathway likely regulates metformin-mediated angiogenesis after spinal cord injury. These findings suggest that metformin promotes vascular regeneration in the injured spinal cord by activating the adenosine monophosphate-activated protein kinase/endothelial nitric oxide synthase pathway, thereby improving the neurological function of aged mice after spinal cord injury., Competing Interests: None

Purpose: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome., Materials and Methods: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants., Results: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS)., Conclusions: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage., (© 2022. The Author(s).)

Real topological phases featuring real Chern numbers and second-order boundary modes have been a focus of current research, but finding their material realization remains a challenge. Here, based on first-principles calculations and theoretical analysis, we reveal the already experimentally synthesized three-dimensional (3D) graphdiyne as the first realistic example of the recently proposed second-order real nodal-line semimetal. We show that the material hosts a pair of real nodal rings, each protected by two topological charges: a real Chern number and a 1D winding number. The two charges generate distinct topological boundary modes at distinct boundaries. The real Chern number leads to a pair of hinge Fermi arcs, whereas the winding number protects a double drumhead surface bands. We develop a low-energy model for 3D graphdiyne which captures the essential topological physics. Experimental aspects and possible topological transition to a 3D real Chern insulator phase are discussed.

Response properties that are purely intrinsic to physical systems are of paramount importance in physics research, as they probe fundamental properties of band structures and allow quantitative calculation and comparison with experiment. For anomalous Hall transport in magnets, an intrinsic effect can appear at the second order to the applied electric field. We show that this intrinsic second-order anomalous Hall effect is associated with an intrinsic band geometric property-the dipole moment of Berry-connection polarizability (BCP) in momentum space. The effect has scaling relation and symmetry constraints that are distinct from the previously studied extrinsic contributions. Particularly, in antiferromagnets with PT symmetry, the intrinsic effect dominates. Combined with first-principles calculations, we demonstrate the first quantitative evaluation of the effect in the antiferromagnet Mn_{2}Au. We show that the BCP dipole and the resulting intrinsic second-order conductivity are pronounced around band near degeneracies. Importantly, the intrinsic response exhibits sensitive dependence on the Néel vector orientation with a 2π periodicity, which offers a new route for electric detection of the magnetic order in PT-invariant antiferromagnets.

We derive the collision term in the Boltzmann equation using the equation of motion for the Wigner function of massive spin-1/2 particles. To next-to-lowest order in ℏ, it contains a nonlocal contribution, which is responsible for the conversion of orbital into spin angular momentum. In a proper choice of pseudogauge, the antisymmetric part of the energy-momentum tensor arises solely from this nonlocal contribution. We show that the collision term vanishes in global equilibrium and that the spin potential is, then, equal to the thermal vorticity. In the nonrelativistic limit, the equations of motion for the energy-momentum and spin tensors reduce to the well-known form for hydrodynamics for micropolar fluids.

Objective: To compare the efficacy, advantages and disadvantages of endoscopic CO 2 laser cauterization (ECLC) and open neck surgery in the treatment of congenital pyriform sinus fistula (CPSF). Methods: From September 2014 to March 2017, 80 cases with confirmed diagnosis of CPSF received initial treatment at Guangdong Provincial People's Hospital were prospectively analyzed, including 34 males and 46 females, aged 18 to 672 (194.17±141.18) months. They were consecutively divided into endoscopic group and open-surgery group, with 40 cases in each group. Both groups of patients received surgical treatment under general anesthesia. The endoscopic group was treated by endoscopic CO 2 laser cauterization, and the open-surgery group underwent the following surgery: first, we performed suspension laryngoscopy examination to confirm the presence of fistula in the bottom of the piriform fossa, then open-neck resection of congenital piriform sinus fistula with recurrent laryngeal nerve and/or lateral branch of superior laryngeal nerve anatomy plus partial thyroidectomy were performed. The data between the two groups were compared, including the operative time, intraoperative blood loss, postoperative pain, average length of stay, neck cosmetic scores, complications and cure rates. All patients were followed up in outpatient clinics. Statistical analysis was performed using SPSS 20.0 software. P<0.05 indicates that the difference is statistically significant. Results: All patients were successfully completed the operation. The operative time, intraoperative blood loss, postoperative pain and average length of hospital stay in the endoscopic group were significantly less than those in the open group [(27.4±5.5) min to (105.8±52.5) min, (0.6±0.5) ml to (33.6±41.5) ml, (1.7±0.9) points to (4.6±0.7) points, (5.9±2.9)d to(8.9±3.3)d, t values were-9.400, -5.031, -16.199, -4.293, P values were all<0.01]; The neck cosmetic score in the endoscopy group was significantly greater than that of the open group [(9.9±0.4) against (5.8±0.9) points, t =25.847, P <0.01]. Compared with the open group (15.0%, 6/40), the complication rate of the endoscopic group (7.5%, 3/40) was not statistically significant (χ²=0.50, P >0.05). Three months after the first treatment, the cure rate in the endoscopic group (82.5%, 33/40) was significantly lower than that in the open-neck group (100.0%, 40/40), χ²=5.64, P <0.05. The follow-up time was 12 months after the last treatment. Eighty cases were followed up and none was lost to follow-up. During the follow-up period, the cure rate of the endoscopy group (97.5%, 39/40) was compared with that of the open group (100.0%, 40/40), and the difference was not statistically significant. Conclusions: In the treatment of CPSF, the two-surgical method each has their advantages. Compared with open-neck surgery, ECLC is simpler, repeatable. ECLC has shorter time in operation and hospital stay, less complications, and less postoperative pain and more precise cosmetic results. It could be preferred for the initial treatment of CPSF and relapsed cases after cauterization. But subject to relatively low cure rate of one-time cauterization and uncertain long-term efficacy, it cannot completely replace the open-neck surgery at present.

A fundamental dichotomous classification for all physical systems is according to whether they are spinless or spinful. This is especially crucial for the study of symmetry-protected topological phases, as the two classes have distinct symmetry algebra. As a prominent example, the spacetime inversion symmetry PT satisfies (PT)^{2}=±1 for spinless/spinful systems, and each class features unique topological phases. Here, we reveal a possibility to switch the two fundamental classes via Z&#95;{2} projective representations. For PT symmetry, this occurs when P inverses the gauge transformation needed to recover the original Z&#95;{2} gauge connections under P. As a result, we can achieve topological phases originally unique for spinful systems in a spinless system, and vice versa. We explicitly demonstrate the claimed mechanism with several concrete models, such as Kramers degenerate bands and Kramers Majorana boundary modes in spinless systems, and real topological phases in spinful systems. Possible experimental realization of these models is discussed. Our work breaks a fundamental limitation on topological phases and opens an unprecedented possibility to realize intriguing topological phases in previously impossible systems.

Aim: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES)., Methods: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations., Results: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672&#95;701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234&#95;Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein., Conclusion: A novel FOXL2 mutation c.672&#95;701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234&#95;Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling., (International Journal of Ophthalmology Press.)

Purpose: The purpose of the study is to describe the genetic and clinical features of 17 patients with ABCA4-related inherited retinal degenerations (IRDs) and define the phenotype-genotype correlations., Methods: In this multicenter retrospective study, 17 patients from 16 families were enrolled, and ABCA4 gene variants were detected using targeted next-generation sequencing using a custom designed panel for IRDs. Sanger sequencing and co-segregation analysis of the suspected pathogenic variants were performed with the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Protein structure modifications mediated by the variants were studied using bioinformatic analyses., Results: The probands were diagnosed with Stargardt disease 1 (7), cone-rod dystrophy type 3 (8), cone dystrophy (1), and retinitis pigmentosa 19 (1). Onset of symptoms occurred between 5 and 27 years of age (median age = 12.4 years). A total of 30 unique ABCA4 suspicious pathogenic variations were observed, including 18 missense mutations, seven frameshift mutations, two nonsense mutations, one canonical splice site mutation, one small in-frame deletion, and one insertion. Four novel ABCA4 variants were identified. Two novel frameshift variants, c.1290dupC (p.W431fs), and c.2967dupT (G990fs), were determined to be pathogenic. A novel missense variant c.G5761T (p.V1921L) was likely pathogenic, and another novel missense c.C170G (p.P57R) variant was of undetermined significance. All ABCA4 variants tested in this study inordinately changed the physico-chemical parameters and structure of protein based on in silico analysis., Conclusion: ABCA4-related IRD is genetically and clinically highly heterogeneous. Four novel ABCA4 variants were identified. This study will expand the spectrum of disease-causing variants in ABCA4, which will further facilitate genetic counseling., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Zhu, Rui, Li, You, Sheng and Lei.)

Neural stem cells (NSCs) play vital roles in the homeostasis of neurological function. Ubiquitously transcribed tetratricopeptide repeat, X chromosome (UTX) is an important regulator of stem cell phenotypes. In our current study, we aimed to investigate whether the conditional knockout of UTX on neural stem cells alters macrophage assembly in response to spinal cord injury (SCI). Conditional knockout Utx of NSC ( Utx -KO) mice was used to generate SCI models by the modified Allen method. We reported that neurological function and scar hyperplasia significantly improved in Utx -KO mice after SCI, accompanied by significantly reduced assembly of macrophages. With a 45-fold pathway array and Western blot, we found that Utx -KO could significantly inhibit NF-κB signaling activation and promote the synthesis and secretion of macrophage migration inhibitory factor (MIF) in NSCs. Administration of the selective NF-κB p65 activator betulinic acid and the selective MIF inhibitor ISO-1 confirmed that the activation of NF-κB p65 phosphorylation or inhibition of MIF could eliminate the benefits of Utx -KO in SCI, such as inhibition of macrophage aggregation and reduction in scar proliferation. This study confirmed that UTX in NSCs could alter macrophage migration and improve neurological function recovery after SCI in mice.

Objective: We investigated the effect of electrical stimulation (ES) of varying pulse frequency on differentiation and proliferation of canine myloglossus satellite cells in vitro., Materials and Methods: Cellular viability and proliferation were assayed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) assay and flow cytometry fluorescence-activated cell sorting analysis. Cellular differentiation and expression of mark molecule were assayed by Real Time-PCR and Western blot., Results: With increasing frequency ES, we found a significant increase in Myod (r=0.988, p<0.0001), myogenin (r=0.988, p<0.0001), MyHC-slow (r=0.988, p<0.0001), MyHC-fast (r=0.875, p<0.0001) protein expression, and Pax7 mRNA expression (r=0.712, p=0.001)., Conclusions: Pax7 mRNA expression and MyoD, myogenin, and MyHC protein expression were increased with increment of electrical stimulation frequency in myloglossus muscle satellite. Higher frequency ES enhanced myloglossus satellite cell differentiation, not proliferation and viability.

Aim: To identify mutations with whole exome sequencing (WES) in a Chinese X-linked retinitis pigmentosa (XLRP) family., Methods: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to SureSelect Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiSeq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation., Results: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29&#95;113del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp (D10Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa (RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP., Conclusion: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia., (International Journal of Ophthalmology Press.)

We propose a universal practical approach to realize magnetic second-order topological insulator (SOTI) materials, based on properly breaking the time reversal symmetry in conventional (first-order) topological insulators. The approach works for both three dimensions (3D) and two dimensions (2D), and is particularly suitable for 2D, where it can be achieved by coupling a quantum spin Hall insulator with a magnetic substrate. Using first-principles calculations, we predict bismuthene on EuO(111) surface as the first realistic system for a two-dimensional magnetic SOTI. We explicitly demonstrate the existence of the protected corner states. Benefitting from the large spin-orbit coupling and sizable magnetic proximity effect, these corner states are located in a boundary gap ∼83  meV, and hence can be readily probed in experiment. By controlling the magnetic phase transition, a topological phase transition between a first-order TI and a SOTI can be simultaneously achieved in the system. The effect of symmetry breaking, the connection with filling anomaly, and the experimental detection are discussed.

Frustrated magnets hold the promise of material realizations of exotic phases of quantum matter, but direct comparisons of unbiased model calculations with experimental measurements remain very challenging. Here we design and implement a protocol of employing many-body computation methodologies for accurate model calculations-of both equilibrium and dynamical properties-for a frustrated rare-earth magnet TmMgGaO 4 (TMGO), which explains the corresponding experimental findings. Our results confirm TMGO is an ideal realization of triangular-lattice Ising model with an intrinsic transverse field. The magnetic order of TMGO is predicted to melt through two successive Kosterlitz-Thouless (KT) phase transitions, with a floating KT phase in between. The dynamical spectra calculated suggest remnant images of a vanishing magnetic stripe order that represent vortex-antivortex pairs, resembling rotons in a superfluid helium film. TMGO therefore constitutes a rare quantum magnet for realizing KT physics, and we further propose experimental detection of its intriguing properties.

The current valleytronics research is based on the paradigm of time-reversal-connected valleys in two-dimensional (2D) hexagonal materials, which forbids the fully electric generation of valley polarization by a gate field. Here, we go beyond the existing paradigm to explore 2D systems with a novel valley-layer coupling (VLC) mechanism, where the electronic states in the emergent valleys have a valley-contrasted layer polarization. The VLC enables a direct coupling between a valley and a gate electric field. We analyze the symmetry requirements for a system to host VLC, demonstrate our idea via first-principles calculations and model analysis of a concrete 2D material example, and show that an electric, continuous, wide-range, and switchable control of valley polarization can be achieved by VLC. Furthermore, we find that systems with VLC can exhibit other interesting physics, such as valley-contrasting linear dichroism and optical selection of the valley and the electric polarization of interlayer excitons. Our finding opens a new direction for valleytronics and 2D materials research.

A second-order topological insulator (SOTI) in d spatial dimensions features topologically protected gapless states at its (d-2)-dimensional boundary at the intersection of two crystal faces, but is gapped otherwise. As a novel topological state, it has been attracting great interest, but it remains a challenge to identify a realistic SOTI material in two dimensions (2D). Here, based on combined first-principles calculations and theoretical analysis, we reveal the already experimentally synthesized 2D material graphdiyne as the first realistic example of a 2D SOTI, with topologically protected 0D corner states. The role of crystalline symmetry, the robustness against symmetry breaking, and the possible experimental characterization are discussed. Our results uncover a hidden topological character of graphdiyne and promote it as a concrete material platform for exploring the intriguing physics of higher-order topological phases.

The discovery of two-dimensional (2D) magnetic materials with high critical temperature and intrinsic magnetic properties has attracted significant research interest. By using swarm-intelligence structure search and first-principles calculations, we predict three 2D iron arsenide monolayers (denoted as FeAs-I, II and III) with good energetic and dynamical stabilities. We find that FeAs-I and II are ferromagnets, while FeAs-III is an antiferromagnet. FeAs-I and III have sizable magnetic anisotropy comparable to the magnetic recording materials such as the FeCo alloy. Importantly, we show that FeAs-I and III have critical temperatures of 645 K and 350 K, respectively, which are above room temperature. In addition, FeAs-I and II are metallic, while FeAs-III is semiconducting with a gap comparable to Si. For FeAs-III, there exist two pairs of 2D antiferromagnetic Dirac points below the Fermi level, and it displays a giant magneto band-structure effect. The superior magnetic and electronic properties of the FeAs monolayers make them promising candidates for spintronics applications.

The influence of temperature (30-45℃) and ammonia-nitrogen volume load on the nitrification function and microbial community of activated sludge in an aerobic tank of a sewage treatment plant were investigated under simulated high-temperature stress in the summer. Meanwhile, the bioaugmentation effectiveness of the middle-temperature-enriched nitrifying sludge (with or without acclimation) was evaluated in two biological treatment systems under high-temperature shock. The results showed that the ammonium-nitrogen (NH 4 + -N) removal efficiency and the nitrifying bacteria content of the aerobic activated sludge at 30-40℃ were above 90% and up to 4.55% and decreased to 40% and 1.97% at 45℃, respectively. To quickly recover the nitrification function of the biological system under high-temperature shock in the summer, the middle-temperature-enriched nitrifying sludge was acclimated at 40℃ for 61 d and achieved (60±5) mg·(L·h) -1 nitrification activity. Then, its bioaugmentation efficiency was compared with that of the middle-temperature-enriched nitrifying sludge. In the bioaugmentation test, 10% of NH 4 + -N was removed in the reactor inoculated with 5% (volume fraction) of the acclimated nitrifying sludge, while the reactor needed inoculate with 10% (volume fraction) of the middle-temperature-enriched sludge to achieve the same removal efficiency. The results suggested that middle-temperature-enriched nitrifying sludge, after acclimating at 40℃, has a better enhancement effect under a high-temperature shocking load.

Objective: To analyze the relationship between genotype and phenotype of different types of hereditary retinopahty caused by ABCA4 gene. Method: Three (3) pedigrees that carried mutations on ABCA4 gene as determined through the second generation sequencing technology were selected from the patients diagnosed with hereditary retinal disease in Ningxia Eye Hospital between Januaryand September 2016. The clinical features of patients and other family members of them were collected and analyzed with complete ophthalmic examinations including visual acuity, best corrected visual acuity, fundus examination, macular OCT, fundus fluorescein angiography and electroretinogram (ERG). The relationship between genotype and phenotype was analyzed. Results: All the 3 pedigrees were autosomal recessive families. Four mutations on ABCA4 gene were detected, the CRD pedigree and the RP pedigress carried a homozygous frameshift mutation respectively. The Stargardt pedigree carried two heterozygous mutations. The onset age of the patients were less than 10 years. The best corrected visual acuity was lower than 0.1 and the macular OCT indicated different levels of macular area atrophy, and the visual electrophysiological changes varied from completely normal to significantly reduced visual stem cell function in different cases. Conclusions: The patients with hereditary retinal disease that carried ABCA4 gene mutations were featured with characteristics of early onset age, rapid progress and severe visual impairment. The second generation sequencing technique has the advantages of rapidness and high efficiency in the diagnosis of hereditary retinal disease. (Chin J Ophthalmol, 2018, 54:775 - 781) .

Nitrifying activated sludge (NAS) was enriched in a membrane bioreactor (MBR) with pre-treated municipal wastewater and additional ammonium sulfate as the culture medium. The influences of temperature, dissolved oxygen (DO), ammonia nitrogen volumetric load, free ammonia (FA), and free nitrite (FNA) on the enrichment of NAS were investigated, the cost of the process was evaluated, and then NAS's application in enhancing a wastewater biological treatment system against ammonia shocking loads was attempted. The results showed that after 182 days of cultivation in an MBR, NAS had a nitrification activity of 98.41 mg·(L·h) -1 , which was 30-times higher than that of the seeding sludge. The yield of NAS was 14.96 mg·(L·d) -1 , costing 3.52 Yuan for 1 kg. Temperature was found to be a key factor affecting the sludge nitrification activity. The sludge nitrification activity was decreased to 1/3 of the maximum value at temperatures below 15.0℃, while lowering the ammonium volumetric load retarded the decrease in the sludge nitrification activity to some extent. In addition, dissolved oxygen deficiency resulted in nitrite accumulation, and thereby slowed down the NAS enrichment rate. The enriched NAS was then applied to a wastewater biological treatment pilot equipment, which had just been exposed to an ammonium shocking load. The removal rate of ammonia nitrogen in the biological system increased from 29.4% to 88.4% after 2.0% of NAS was inoculated. The enhanced biological system retained ammonia removal rates of as high as 99.0%, even as the temperature dropped to 13.3℃±1.6℃ afterwards. The above pilot-experiment results suggested that enriched nitrifying sludge is suitable for quickly increasing the start-up or recovery rates of the nitrifying function in a biological system.

Nonsymmorphic symmetries, which involve fractional lattice translations, can generate exotic types of fermionic excitations in crystalline materials. Here we propose a topological phase arising from nonsymmorphic symmetries-the hourglass Dirac chain metal, and predict its realization in the rhenium dioxide. We show that ReO 2 features hourglass-type dispersion in the bulk electronic structure dictated by its nonsymmorphic space group. Due to time reversal and inversion symmetries, each band has an additional two-fold degeneracy, making the neck crossing-point of the hourglass four-fold degenerate. Remarkably, close to the Fermi level, the neck crossing-point traces out a Dirac chain-a chain of connected four-fold-degenerate Dirac loops-in the momentum space. The symmetry protection, the transformation under symmetry-breaking, and the associated topological surface states of the Dirac chain are revealed. Our results open the door to an unknown class of topological matters, and provide a platform to explore their intriguing physics.

Objective: To investigate the relationship between Work Ⅱ type of congenital first branchial cleft anomaly (CFBCA) and facial nerve and discuss surgical strategies. Methods: Retrospective analysis of 37 patients with CFBCA who were treated from May 2005 to September 2016. Among 37 cases with CFBCA, 12 males and 25 females; 24 in the left and 13 in the right; the age at diagnosis was from 1 to 76 ( years, with a median age of 20, 24 cases with age of 18 years or less and 13 with age more than 18 years; duration of disease ranged from 1 to 10 years (median of 6 years); 4 cases were recurren after fistula resection. According to the classification of Olsen, all 37 cases were non-cyst (sinus or fistula). External fistula located over the mandibular angle in 28 (75.7%) cases and below the angle in 9 (24.3%) cases. Results: Surgeries were performed successfully in all the 37 cases. It was found that lesions located at anterior of the facial nerve in 13 (35.1%) cases, coursed between the branches in 3 cases (8.1%), and lied in the deep of the facial nerve in 21 (56.8%) cases. CFBCA in female with external fistula below mandibular angle and membranous band was more likely to lie deep of the facial nerve than in male with external fistula over the mandibular angle but without myringeal web. Conclusions: CFBCA in female patients with a external fistula located below the mandibular angle, non-cyst of Olsen or a myringeal web is more likely to lie deep of the facial nerve. Surgeons should particularly take care of the protection of facial nerve in these patients, if necessary, facial nerve monitoring technology can be used during surgery to complete resection of lesions.

We reveal a class of three-dimensional d orbital topological materials in the antifluorite Cu 2 S family. Derived from the unique properties of low-energy t 2g states, their phases are solely determined by the sign of the spin-orbit coupling (SOC): topological insulator (TI) for negative SOC and topological semimetal for positive SOC, both having Dirac cone surface states but with contrasting helicities. With broken inversion symmetry, the semimetal becomes one with a nodal box consisting of butterfly-shaped nodal lines that are robust against SOC. Further breaking the tetrahedral symmetry by strain leads to an ideal Weyl semimetal with four pairs of Weyl points. Interestingly, the Fermi arcs coexist with a surface Dirac cone on the (010) surface, as required by a [Formula: see text] invariant.

In this work, a systematic study of Cu(NO 3 ) 2 ·2.5 H 2 O (copper nitrate hemipentahydrate, CN), an alternating Heisenberg antiferromagnetic chain model material, is performed with multi-technique approach including thermal tensor network (TTN) simulations, first-principles calculations, as well as magnetization measurements. Employing a cutting-edge TTN method developed in the present work, we verify the couplings J = 5.13 K, α = 0.23(1) and Landé factors g ∥ = 2.31, g ⊥  = 2.14 in CN, with which the magnetothermal properties have been fitted strikingly well. Based on first-principles calculations, we reveal explicitly the spin chain scenario in CN by displaying the calculated electron density distributions, from which the distinct superexchange paths are visualized. On top of that, we investigated the magnetocaloric effect (MCE) in CN by calculating its isentropes and magnetic Grüneisen parameter. Prominent quantum criticality-enhanced MCE was uncovered near both critical fields of intermediate strengths as 2.87 and 4.08 T, respectively. We propose that CN is potentially a very promising quantum critical coolant.

Aim: To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome., Methods: All five patients from this family were included and received comprehensive ophthalmic and systemic examinations. Direct sequencing of the FGFR2 gene was employed for mutation identification. Crystal structure analysis was applied to analyze the structural changes associated with the substitution., Results: All patients presented typical Crouzon features, including short stature, craniosynostosis, mandibular prognathism, shallow orbits with proptosis, and exotropia. Intrafamilial phenotypic diversities were observed. Atrophic optic nerves were exclusively detected in the proband and her son. Cranial magnetic resonance imaging (MRI) implied a cystic lesion in her sellar and third ventricular regions. A missense mutation, FGFR2 p.Cys342Trp, was found as disease causative. This substitution would generate conformational changes in the extracellular Ig-III domain of the FGFR-2 protein, thus altering its physical and biological properties., Conclusion: We describe the clinical presentations and genotypic lesions in a Chinese family with Crouzon syndrome. The intrafamilial phenotypic varieties in this family suggest that other genetic modifiers may also play a role in the pathogenesis of Crouzon syndrome.

Removal of conventional pollutants as well as genotoxicity was studied along a multistage A/O process, which was based on the monitoring data in a Municipal Wastewater Treatment Plant (MWWTP) of Yixing City. The results showed that the multistage A/O process removed (67.3±7.0)% of COD, (93.7±1.5)% of NH 4 + -N, (65.3±7.9)% of TN and (60.0±18.7)% of TP, respectively, which played a dominant role in the removal performance of the whole wastewater treatment process. The multistage A/O process showed significant ability to reduce alkanes, halogenated hydrocarbons and alcohols in the municipal wastewater, while it failed to remove the aromatic proteins which were the main fluorescent substances of this wastewater. Furthermore, the process removed 82.8% genotoxicity from its influent. Low organic load, single-phase influent and undesirable carbon source feeding pattern, which caused the downstream A/O stages being not fully utilized, were considered as the predominant reasons for the relatively low performance of the multistage A/O process. Multi-phase feeding and adjusting carbon source feeding pattern were thereby proposed. The results were considered to be helpful for improving the operational performance of the MWWTP and useful for performance evaluation of MWWTPs with similar process.

Objective: To investigate the optimal time of tracheotomy/arytenoidectomy and the improvement of dyspnoea, dysphonia and dysphagia after arytenoidectomy with CO₂ laser in iatrogenic bilateral vocal folds paralysis patients. Method: Thirty patients [29 females, 56 (49-60) years, one male, 49 years] with bilateral vocal cords paralysis resulted from neck surgery were retrospectively analyzed by case archived information and following-up questionnaire. The data included patients' dysponea time, degree and duration from tracheotomy/arytenoidectomy to neck surgery. Twenty sixty patients required unilateral partial/total arytenoidectomy. The results of treatment were evaluated by questionnaire including dyspnoea, dysphonia and dysphagia. Result: All patients whose bilateral vocal paralysis were resulted from thyroid gland surgery. Dysponea occurred immediately after thyroidectomy surgery in 14 cases (46.7%), and 2 years later after thyroidectomy in 13 cases (43.3%), 8 years later in 3 cases (10.0%). There was one (3.3%) patient without tracheotomy. The duration of tracheotomy/arytenoidectomy to neck surgery was significantly correlated with duration of tracheotomy/arytenoidectomy to dyspnoea appearance ( r =0.879, P <0.05), not correlated with duration of thyroid surgery to dyspnoea appearance. There is significantly negative correlation between degree of dyspnoea and duration of tracheotomy/arytenoidectomy to neck surgery ( r =0.452, P <0.05). Twenty six patients appeared dyspnoea and underwent CO₂ laser arytenoidectomy after thyoidectomy 0.5-23 years. Five patients did unilateral total arytenoidectomy and 21 patients did unilateral partial arytenoidectomy. After 12-96 months following up, dyspnoea improved in 24 patients, no improved in 2 patients. Dysphonia improved and remained in 17 patients, being worse mildly in 8 patients and obviously in one patient. Dysphagia improved and remained in 24 patients, being worse in 2 patients. There was no difference between total and partial arytenoidectomy in dyspnoea, dysphonia and dysphagia. Conclusion: The morbidity of dyspnoea was correlated with time after neck surgery. It was rarely necessary to take tracheotomy immediately in bilateral vocal fords paralysis patients after neck surgery. The severer degree of dyspnoea led to shorter duration between neck surgery and tracheotomy/arytenoidectomy. There was obvious improvement after arytenoidectomy in dyspnoea, no significant change in dysphonia and dysphagia. The effect of total arytenoidectomy on bilateral vocal paralysis was similar to partial arytenoidectomy., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Editorial Department of Journal of Clinical Otorhinolaryngology Head and Neck Surgery.)

Aim: To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia, located in the northwest part of China., Methods: A stratified, randomized sampling procedure was employed in the study, including urban and rural area of all age group. Visual acuity, anterior segment and ocular fundus were checked. Related factor of corneal disease, including age, gender, education status, ethnic group, location and occupation, were identified according to uniform customized protocol. An eye was defined to be corneal blindness if the visual acuity was <20/400 due to a corneal disease., Results: Three thousand individuals (1290 from urban area and 1710 from rural area) participated in the investigation, with a response rate of 80.380%. The prevalence of corneal blindness was 0.023% in both eyes and 0.733% in at least one eye. The blindness in at least one eye with varied causes was present in 106 participants (3.533%) and in bilateral eyes in 34 participants (1.133%). The corneal diseases accounted for 20.754% of blindness in at least one eye and 20.588% of bilateral blindness. The prevalence of corneal disease was higher in older and Han ethnic group, especially those who occupied in agriculture and outdoor work. People with corneal blindness were more likely to be older and lower education. Rural population were more likely to suffer from bilateral corneal blindness than the urban population in ≥59-year group (χ (2)=6.716, P=0.019). Infectious, trauma and immune corneal disease were the three leading causes of corneal disease. Trauma corneal disease was more likely leading to blindness in one eye. However, infectious and immune corneal diseases make more contribution to the bilateral corneal blindness., Conclusion: Corneal blindness is a significant burden of in Ningxia population, encompassing a variety of corneal infections and trauma; the majority of those were avoidable. Health promotion strategies and good hygienic conditions have to be developed.

Aim: To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations., Methods: Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations., Results: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls., Conclusion: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

Three coordination polymers {[Co2(AQTC)(H2O)6]·6H2O}n (1), {[M2(AQTC)(bpym)(H2O)6]·6H2O}n (M = Co(2), Ni(3)) have been synthesized and structurally characterized, where H4AQTC is anthraquinone-1,4,5,8-tetracarboxylic acid and bpym is 2,2'-bipyrimidine. Complex 1 features a 3-D structure, where layers of Co2(AQTC) are cross-linked by Co-H2O chains. Complexes 2 and 3 are isostructural and display 1-D chain structures. The chains are connected through hydrogen-bonding interactions to form 3-D supramolecular structures. Magnetic properties of these complexes are investigated. Compound 1 shows canted antiferromagnetism and slow relaxation below 4.0 K. For complexes 2 and 3, dominant antiferromagnetic interactions are observed. The luminescent properties of the three complexes are investigated as well.

By means of first-principles calculations combined with the tight-binding approximation, the strain-induced semiconductor-semimetal transition in graphdiyne is discovered. It is shown that the band gap of graphdiyne increases from 0.47 eV to 1.39 eV with increasing the biaxial tensile strain, while the band gap decreases from 0.47 eV to nearly zero with increasing the uniaxial tensile strain, and Dirac cone-like electronic structures are observed. The uniaxial strain-induced changes of the electronic structures of graphdiyne come from the breaking of geometrical symmetry that lifts the degeneracy of energy bands. The properties of graphdiyne under strains are found to differ remarkably from that of graphene.

The title complex, {[Co2(C18H4O10)(C14H14N4)2]·2H2O} n was synthesized from CoCl2·6H2O, 9,10-dioxo-9,10-dihydro-anthracene-1,4,5,8-tetra-carb-oxy-lic acid (H4AQTC) and 1,2-bis-[(1H-imidazol-1-yl)meth-yl]benzene (o-bix) in water. The anthraquinone unit is located about a crystallographic center of inversion. Each asymmetric unit therefore contains one Co(II) atom and one o-bix ligand, as well as half an AQTC(4-) ligand and an additional solvent water mol-ecule. The Co(II) ions are tetra-hedrally surrounded by two O atoms from two AQTC(4-) anions and by two N atoms from two o-bix ligands, forming a two-dimensional coordination polymer. The solvent water mol-ecules are connected to the carboxyl-ate groups by O-H⋯O hydrogen bonds. Additional weak C-H⋯O hydrogen bonds are observed in the crystal structure.

Objective: To analyse the mode of inheritance and clinical characteristics of retinitis pigmentosa (RP) patients with consanguineous marriage., Methods: RP patients were recruited for this study in Ningxia Eye Hospital from September 2009 to July 2011. All patients received complete ophthalmic examination. The mode of inheritance were determined based on family history and marriage history. Clinical features were characterized by complete ophthalmic examinations including visual acuity, macular OCT, visual field and electroretinogram (ERG)., Results: A total of 143 individuals with RP (33 families) were recruited. Based on analysis of family history and marriage history, 20 RP families (23 patients) had consanguineous marriage history accounted for 60.6% RP families (16.1% RP patients). There were 4 patients (from 4 families) diagnosed as Usher syndrome. In 20 RP families with consanguineous marriage history, 7 families (35.0%) were Hui ethnicity and 13 families (65%) were Han ethnicity. The marriages of 15 families were between first cousins and 3 families were between second cousins, only 2 families were between half cousins matrimony. Of 23 RP patients, 12 were males and 11 were females. The average age of onset was 11.4 ± 6.8 years and the average age of recruitment was (32.0 ± 13.5) years. The best-corrected visual acuity was less than 0.6 in 78.2% patients. According to the features of the fundus, 13 patients were classical retinitis pigmentosa and 10 patients were retinitis pigmentosa sine pigmento. Visual field examination showed that all patients had varying degrees of peripheral visual field defect. Retinal neuroepithelial layer of macular and peripheral retina became thinner and retinal photoreceptors were disappeared. The average thickness of macular fovea was (186.1 ± 78.7) µm on right eyes and (187.4 ± 76.3) µm on left eyes., Conclusions: The incidence of RP with consanguineous marriages was high in Ningxia Region. The mode of inheritance of RP patients with consanguinity is autosomal recessive. The common marriage pattern of consanguinity is between first cousins. The age of onset is early and the ocular fundus changes of some patients are atypical, this should be paid attention clinically.

Aim: To assess the visual outcomes and possible risk factors associated with axis alignment and rotational stability after implantation of Toric implantable collamer lens (TICL) for the correction of high myopic astigmatism., Methods: In this prospective, nonrandomized clinical study, 54 consecutive eyes of 29 patients with high myopic astigmatism received TICL implantation. To evaluate postoperative axis deviation from the intended axis, a digital anterior segment photograph was taken. The ultrasound biomicroscopy(UBM) was used to observe footplate-position., Results: After mean follow-up of 8.6 months, mean manifest refractive cylinder (MRC) decreased 79.3% from (-1.88±1.49)D preoperatively to (0.39±0.61)D postoperatively. MRC within 1.00 D occurred in 68.5% (37/54) of eyes, whereas 48.1% (26/54) had MRC within 0.50 D. Mean manifest refraction spherical equivalent (MRSE) changed from (-12.08±4.22)D preoperatively to (-0.41±0.61)D postoperatively. Uncorrected binocular vision of 20/20 or better occurred in 72.2% (39/54) of patients compared with binocular best-corrected visual acuity (BCVA) of 20/20 or better in 44.4% (24/54) preoperatively. The mean difference between intended and achieved TICL axes was (6.96±8.37)°. Footplates of TICLs were in the ciliary sulcus in 22 eyes (46.3%), below the ciliary sulcus in 32 eyes (53.7%). The angle of TICL rotation had significant correlation with the footplates-position (t=2.127; P=0.045) and the postoperative TICL vaulting (r=-0.516; P=0.000)., Conclusion: The results of our study further support the safety, efficacy and predictability of TICL for the correct high myopic astigmatism. The footplate-position of TICL and vault value should be taken into consideration as two possible risks factors for TICL rotation.

Objective: To screen the mutation in the RPGR gene in a large Chinese family with X-linked recessive retinitis pigmentosa (RP) and to describe the phenotype in affected males and female carriers., Methods: Ophthalmic examinations were performed in 77 family members of a RP pedigree to identify affected individuals. Polymerase chain reaction (PCR) and direct sequencing were used for screening of mutations in RPGR gene exon ORF15., Results: Mutation screening demonstrated a novel mutation, g.ORF15 + 577&#95;578delAG, which caused an open reading frameshift and resulted in premature truncation of the RPGR protein. This mutation was detected in 8 affected male individuals and 14 obligate female carriers in this family and was found to segregate with the phenotype in this family. This mutation led to a severe RP phenotype in male affected individuals with some variability in the age of onset of night blindness and loss of visual acuity, but was recessive in female carriers without a RP phenotype. However the most striking phenotypic feature in female carriers in this pedigree was moderate to high myopia with refractive error ranging from -5.00 D to -22.00 D in 14 female carriers., Conclusions: This novel mutation in RPGR ORF15 causes serious RP phenotype in males and no RP phenotype in female carriers. Moderate to high myopia was a particular feature for female carriers in this pedigree. Our finding expands the spectrum of RPGR mutations causing RP and phenotypic spectrum of the disease in Chinese family, which is useful for further genetic consultation and genetic diagnosis.

A structurally stable crystalline carbon allotrope is predicted by means of the first-principles calculations. This allotrope can be derived by substituting each atom in diamond with a carbon tetrahedron, and possesses the same space group Fd3m as diamond, which is thus coined as T-carbon. The calculations on geometrical, vibrational, and electronic properties reveal that T-carbon, with a considerable structural stability and a much lower density 1.50  g/cm3, is a semiconductor with a direct band gap about 3.0 eV, and has a Vickers hardness 61.1 GPa lower than diamond but comparable with cubic boron nitride. Such a form of carbon, once obtained, would have wide applications in photocatalysis, adsorption, hydrogen storage, and aerospace materials.

Objective: To investigate the activity of bilateral posterior cricoarytenoid muscle satellite cell after denervation or reinnervation with ansa cervicalis., Methods: Twenty four dogs were randomly divided into 3 groups. The bilateral laryngeal recurrent nerves were cut in group one in all dogs. The bilateral laryngeal recurrent nerves were anastomosed with ansa cervicalis after incision in group two in all dogs. The dogs in group three were used as control. Nine weeks after surgery, the electromyography was used to test the regeneration of the nerve. The posterior cricoarytenoid muscles biopsy were collected. The expression of mRNA of Myogenin, Myf5, and Pax7 was assayed by realtime RT-PCR after total RNA isolation., Results: Two dogs died after surgery in incision and anastomose group. The electromyography suggested that the RLN of all dogs had denervated in the incision group and had reinnervated in the anastomose group after 9 weeks. Myogenin mRNA from RLN incision dogs PCA muscles had greater expression versus controls (Z = 1.42, P < 0.01) or anastomosed dogs (Z = 1.38, P < 0.01). Myf5 mRNA expression from RLN incision dogs PCA muscles had significant increase versus control dogs (Z = 1.66, P < 0.01) or anastomosed dogs (Z = 1.69, P < 0.01). Pax7 mRNA expression from RNL incision dogs had significant increase compared with control (Z = 1.66, P < 0.01) or anastomosed animals (Z = 1.42, P < 0.05). There was no significant difference in Myogenin (Z = 1.34, P > 0.05), Myf5 (Z = 0.54, P > 0.05) and Pax (Z = 0.54, P > 0.05) mRNA expression between controls and anastomosed animals., Conclusions: The bilateral denervation of RLN cause significantly increasing in dog PCA muscle satellite cell proliferation and differentiation. The bilateral reinnervation of RLN cause PCA muscle satellite cell come back nonproliferative, quiescent state in dog.

Objective: The purpose of this study was to investigate the prognostic factors associated with mortality in critically ill tuberculosis patients, and therefore to provide information for the early diagnosis and treatment of the disease., Methods: The clinical data of 62 patients with tuberculosis, who were admitted to the intensive care unit (ICU) of Integrated Chinese and Western Medicine Hospital of Zhejiang Province between June 2008 and Feb 2010, were analyzed retrospectively, with the admission date as a start point and the transferring out of ICU date or death date in the ICU as an end point. Forty-eight patients were males and 14 were females, and the patient's age ranging from 20 to years (63 ± 4) years. In addition, these patients were divided into the survival (33 cases) and the death groups (29 cases). A total of 19 factors including age, sex, respiratory failure types, mechanical ventilation, infection, anti-tuberculous drug resistance, chemotherapy, clinical complications, critical illness score, liver damage, were analyzed for a single risk factor by the univariate model, and calculated for the independent death risk factors using the Cox logistic regression multivariate model. The cumulative survival rate based on the Kaplan-Meier survival model was calculated., Results: The mortality was associated with 4 independent factors: fungal infection (HR = 3.44, 95%CI = 1.23 - 9.62), type II respiratory failure (HR = 4.03, 95%CI = 1.56 - 10.38), liver damage (HR = 3.96, 95%CI = 1.30 - 12.10) and elevated APACHEII score (> 25) (HR = 4.91, 95%CI = 1.99 - 12.11). These factors significantly (χ(2) = 5.53 - 11.88, all P < 0.05) increased the in-hospital mortality and decreased the hospital cumulative survival rate (χ(2) = 4.43 - 22.68, all P < 0.05)., Conclusion: The high mortality of tuberculosis patients admitted to ICU was associated with fungal infection, type II respiratory failure, liver damage, and elevated APACHE II score (> 25).

Objective: To research the Mn(2+) toxicity in vivo rabbit retina. Mn(2+) is used as a tracer in MRI., Methods: It was an experimental study. Sixty pigmented rabbits (120 eyes) were divided into 5 groups randomly. Manganese chloride solution 25 µl of 10, 15, 20, 30, 40 mmol/L were injected intravitreally in one eye of each rabbit respectively as 5 experimental groups (n = 12). The saline (0.9%) 25 µl was injected intravitreally in other eye of each rabbit as control group (60 eyes). After intravitreal injections, all eyes were examined by color fundus camera, fluorescein angiography, flash electroretinography, light microscopy, and transmission electron microscopy on the 0(th), 7(th), and 28(th) day., Results: On the 7(th) day after intravitreal injection, the average of the F-ERG b-wave amplitude was reduced significantly from 337 µV to 189 µV in the group of 15 mmol/L (F = 20.43, P < 0.05), but the amplitude was returned to normal on the 28(th) day. On the 7(th) day after intravitreal injections, the F-ERG b-wave amplitude was reduced significantly in the group of ≥ 20 mmol/L, and the amplitude was not returned to normal on the 28(th) day. There were abnormal changes in the structure of the retina in ≥ 20 mmol/L group at difference time after intravitreal injections., Conclusion: MnCl(2) as a tracer in vivo optic nerve, the concentration of ≤ 15 mmol/L caused only reversible changes in retinal function; The concentration of ≥ 20 mmol/L appears, damages in retinal function and morphology appeared.

Based on ab initio calculations, we have studied the geometrical, electronic properties and chemical bonding of boron fullerenes B(32+8k) (0 < or = k < or = 7) with four-membered rings and B(32) solid phases. The relative energies and the energy gaps between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) have been calculated, showing that the stabilities grow with the increase of fullerene size, where the smallest cage B(32) bears the largest HOMO-LUMO gap. The frontier orbitals of B(32+8k) show some similarities with those of the corresponding carbon fullerenes C(24+6k), implying that they may have similar chemical properties. It is found that B(32) cages can condense to form solid phases of simple cubic (sc), face-centered cubic (fcc), body-centered cubic (bcc), and body-centered tetragonal (bct) structures, where the bct phase is observed to be the most stable. Electronic structure calculations reveal that the sc, fcc and bcc phases of B(32) solids are metallic, but the bct phase is a semimetal.

A proliferation-inducing ligand (APRIL) is a novel member of the tumor necrosis factor (TNF) family, which is involved in immune regulation. In this study, the cDNA of dog APRIL (dAPRIL) was amplified from dog spleen by RT-PCR. The open reading frame (ORF) of dAPRIL encodes a protein of 250-amino acid, containing a predicted transmembrane domain and a putative furin protease cleavage site like other mammalian APRILs. The amino acid identities between biologically soluble dAPRIL and its pig, human, rabbit and mouse counterparts are 91%, 86%, 88% and 86%, respectively, dramatically higher than most other known cytokines. The result of real-time PCR revealed that dAPRIL is expressed in various tissues and is elevated in thymus and spleen. Recombinant soluble dAPRIL (dsAPRIL) fused with NusA.tag was efficiently produced in Origami B (DE3) pLysS expression host strain. In vitro, purified dsAPRIL was able to co-stimulate the proliferation of dog splenic B cells in response to anti-IgM. These findings indicate that dAPRIL plays an important role in survival/proliferation of dog B cells and provide the basis for investigation on the roles of APRIL in this important domestic species.

Aim: To investigate the in-vitro activation of cytotoxic T lymphocytes (CTLs) by fusion of mouse hepatocellular carcinoma (HCC) cells and lymphotactin gene-modified dendritic cells (DCs)., Methods: Lymphotactin gene modified DCs (DCLptn) were prepared by lymphotactin recombinant adenovirus transduction of mature DCs which differentiated from mouse bone marrow cells by stimulation with granulocyte/macrophage colony-stimulating factor (GM-CSF), interleukin-4 (IL-4) and tumor necrosis factor alpha (TNF-alpha). DCLptn and H22 fusion was prepared using 50% PEG. Lymphotactin gene and protein expression levels were measured by RT-PCR and ELISA, respectively. Lymphotactin chemotactic responses were examined by in-vitro chemotaxis assay. In-vitro activation of CTLs by DCLptn/H22 fusion was measured by detecting CD25 expression and cytokine production after autologous T cell stimulation. Cytotoxic function of activated T lymphocytes stimulated with DCLptn/H22 cells was determined by LDH cytotoxicity assay., Results: Lymphotactin gene could be efficiently transduced to DCs by adenovirus vector and showed an effective biological activity. After fusion, the hybrid DCLptn/H22 cells acquired the phenotypes of both DCLptn and H22 cells. In T cell proliferation assay, flow cytometry showed a very high CD25 expression, and cytokine release assay showed a significantly higher concentration of IFN-gamma and IL-2 in DCLptn/H22 group than in DCLptn, DCLptn+H22, DC/H22 or H22 groups. Cytotoxicity assay revealed that T cells derived from DCLptn/H22 group had much higher anti-tumor activity than those derived from DCLptn, H22, DCLptn+H22, DC/H22 groups., Conclusion: Lymphotactin gene-modified dendritoma induces T-cell proliferation and strong CTL reaction against allogenic HCC cells. Immunization-engineered fusion hybrid vaccine is an attractive strategy in prevention and treatment of HCC metastases.