Search

The ascending thoracic aorta is designed to withstand biomechanical forces from pulsatile blood. Thoracic aortic aneurysms and acute aortic dissections (TAADs) occur as a result of genetically triggered defects in aortic structure and a dysfunctional response to these forces. Here, we describe mutations in the forkhead transcription factor FOXE3 that predispose mutation-bearing individuals to TAAD. We performed exome sequencing of a large family with multiple members with TAADs and identified a rare variant in FOXE3 with an altered amino acid in the DNA-binding domain (p.Asp153His) that segregated with disease in this family. Additional pathogenic FOXE3 variants were identified in unrelated TAAD families. In mice, Foxe3 deficiency reduced smooth muscle cell (SMC) density and impaired SMC differentiation in the ascending aorta. Foxe3 expression was induced in aortic SMCs after transverse aortic constriction, and Foxe3 deficiency increased SMC apoptosis and ascending aortic rupture with increased aortic pressure. These phenotypes were rescued by inhibiting p53 activity, either by administration of a p53 inhibitor (pifithrin-α), or by crossing Foxe3–/– mice with p53–/– mice. Our data demonstrate that FOXE3 mutations lead to a reduced number of aortic SMCs during development and increased SMC apoptosis in the ascending aorta in response to increased biomechanical forces, thus defining an additional molecular pathway that leads to familial thoracic aortic disease.

Rationale: Mutations in myosin heavy chain ( MYH11 ) cause autosomal dominant inheritance of thoracic aortic aneurysms and dissections. At the same time, rare, nonsynonymous variants in MYH11 that are predicted to disrupt protein function but do not cause inherited aortic disease are common in the general population and the vascular disease risk associated with these variants is unknown. Objective: To determine the consequences of the recurrent MYH11 rare variant, R247C, through functional studies in vitro and analysis of a knock-in mouse model with this specific variant, including assessment of aortic contraction, response to vascular injury, and phenotype of primary aortic smooth muscle cells (SMCs). Methods and Results: The steady state ATPase activity (actin-activated) and the rates of phosphate and ADP release were lower for the R247C mutant myosin than for the wild-type, as was the rate of actin filament sliding in an in vitro motility assay. Myh11 R247C/R247C mice exhibited normal growth, reproduction, and aortic histology but decreased aortic contraction. In response to vascular injury, Myh11 R247C/R247C mice showed significantly increased neointimal formation due to increased SMC proliferation when compared with the wild-type mice. Primary aortic SMCs explanted from the Myh11 R247C/R247C mice were dedifferentiated compared with wild-type SMCs based on increased proliferation and reduced expression of SMC contractile proteins. The mutant SMCs also displayed altered focal adhesions and decreased Rho activation, associated with decreased nuclear localization of myocardin-related transcription factor-A. Exposure of the Myh11 R247C/R247C SMCs to a Rho activator rescued the dedifferentiated phenotype of the SMCs. Conclusions: These results indicate that a rare variant in MYH11 , R247C, alters myosin contractile function and SMC phenotype, leading to increased proliferation in vitro and in response to vascular injury.

Targeting CAR T resistance due to CD19 loss with CD79b-specific CAR T cells in B-cell malignancies Fuliang Chu, JingJing Cao, Jingwei Liu, Xiaoyun Cheng, Swathi Karri, Adithi Reddy, Shao Qing Kuang, Jinsheng Weng, Sattva S. Neelapu Department of Lymphoma and Myeloma, The University of Texas M. D. Anderson Cancer Center. Houston, TX 77030 USA Chimeric antigen receptor (CAR) T cells targeting CD19 are highly effective in B-cell malignancies and two CD19-targteing CAR T-cell therapy products were recently approved by the US FDA for relapsed or refractory B-cell acute lymphoblastic leukemia and/or large B cell lymphoma. In pivotal trials, durable remissions lasting more than 1 year have been observed in ~40-50% of these patients. However, relapse or progression occurs in ~50-60% and a major cause of resistance appears to be due to CD19 antigen loss. Thus, there is an urgent need to develop CAR T-cell therapies against novel targets to further improve outcomes in these patients. CD79b is a pan B-cell linage marker and an important component of the B-cell receptor complex. CD79b is broadly expressed in normal B cells and B-cell malignancies and its expression is usually retained in CD19 negative tumors progressing after CD19-specific CAR T-cell therapy. Here, we report our results with a novel CD79b-specific CAR T cell product in in vitro and in vivo models. We generated five murine monoclonal antibodies against human CD79b by hybridoma technology and demonstrated that they bind specifically to recombinant human CD79b, have high affinity (Kd range of 1.44-18.1 nM), and stain multiple B-cell lymphoma cell lines comparable to the commercial CD79b fluorochrome-labeled antibodies. Next, we cloned the variable regions of the heavy and light chains of the CD79b antibodies, and developed lentiviral constructs for CD79b-specific CARs with CD3z and CD28 costimulatory domains. We demonstrated that the CD79b-CAR lentiviral constructs can be transduced into primary CD4+ and CD8+ T cells from healthy donors to >85% transduction efficiency. We observed that the CD79b-specific CAR T cells but not untransduced T cells had significant cytotoxic activity that was comparable to control CD19-specific CAR T cells against Daudi Burkitt lymphoma and Mino mantle cell lymphoma cell lines. More importantly, CD79b- but not CD19-specific CAR T cells lysed CD19-CD79b+ lymphoma cells. Significant CD107a/b degranulation was also observed in both CD4+ and CD8+ CD79b-specific CAR T cells when they were co-cultured with lymphoma cell lines. Multiplex cytokine analysis of co-culture supernatants revealed predominantly release of IFN-γ. The efficacy of CD79b-specific CAR T cells was also examined in vivo against Mino xenograft models in NSG mice. Luciferase-labeledMino mantle cell lymphoma cell line was injected IV into NSG mice at 2x106 tumor cells/mouse. After 18 days, mice were treated with untransduced primary T cells, CD19-specific CAR, or CD79b-specific CAR T cells via tail vein at 10x106 T cells/mouse. Bioluminescence imaging was used to assess tumor burden. Tumor growth was inhibited and survival was markedly improved in mice treated with CD19- and CD79b-specific CAR T cells but progressive tumor growth was observed in the control group treated with untransduced T cells. Additional studies using CD19-CD79b+ lymphoma cell line xenograft model are ongoing and will be presented at the meeting. In conclusion, these preclinical results indicate that CD79b is a novel target for CAR T-cell therapy and support its evaluation in patients with B-cell malignancies. Importantly, our results suggest that targeting CD79b could be a novel strategy to overcome resistance due to CD19 loss after CD19-specific CAR T-cell therapy. Disclosures No relevant conflicts of interest to declare.

Tuberous sclerosis complex (TSC) is a genetic disorder with pleiotropic manifestations caused by heterozygous mutations in either TSC1 or TSC2. One of the less investigated complications of TSC is the formation of aneurysms of the descending aorta, which are characterized on pathologic examination by smooth muscle cell (SMC) proliferation in the aortic media. SMCs were explanted from Tsc2(+/-) mice to investigate the pathogenesis of aortic aneurysms caused by TSC2 mutations. Tsc2(+/-) SMCs demonstrated increased phosphorylation of mammalian target of rapamycin (mTOR), S6 and p70S6K and increased proliferation rates compared with wild-type (WT) SMCs. Tsc2(+/-) SMCs also had reduced expression of SMC contractile proteins compared with WT SMCs. An inhibitor of mTOR signaling, rapamycin, decreased SMC proliferation and increased contractile protein expression in the Tsc2(+/-) SMCs to levels similar to WT SMCs. Exposure to alpha-elastin fragments also decreased proliferation of Tsc2(+/-) SMCs and increased levels of p27(kip1), but failed to increase expression of contractile proteins. In response to artery injury using a carotid artery ligation model, Tsc2(+/-) mice significantly increased neointima formation compared with the control mice, and the neointima formation was inhibited by treatment with rapamycin. These results demonstrate that Tsc2 haploinsufficiency in SMCs increases proliferation and decreases contractile protein expression and suggest that the increased proliferative potential of the mutant cells may be suppressed in vivo by interaction with elastin. These findings provide insights into the molecular pathogenesis of aortic disease in TSC patients and identify a potential therapeutic target for treatment of this complication of the disease.

Histone deacetylase (HDAC) inhibitors have been shown to induce cell cycle arrest, terminal differentiation, and apoptosis in a broad spectrum of human tumors and animal xenograft models. JNJ-26481585 is a hydroxamic acid derivative, second-generation pan-HDAC inhibitor that has demonstrated high potency in preclinical studies. In the current study, we demonstrated that JNJ-26481585 has antileukemia and molecular activity in leukemia cell lines and primary human leukemia cells. We also observed a synergistic effect between treatment with decitabine and JNJ-26481585. In conclusion, JNJ-26481585 is a potent second-generation pan-HDAC inhibitor with activity in human leukemia, and it is currently in clinical development.

Steroid receptor coactivator-1 (SRC-1) is a coactivator for nuclear hormone receptors such as estrogen and progesterone receptors and certain other transcription factors such as Ets-2 and PEA3. SRC-1 expression in breast cancer is associated with HER2 and c-Myc expression and with reduced disease-free survival. In this study, SRC-1 −/− mice were backcrossed with FVB mice and then cross-bred with MMTV-polyoma middle T antigen (PyMT) mice to investigate the role of SRC-1 in breast cancer. Although mammary tumor initiation and growth were similar in SRC-1 −/− / PyMT and wild-type ( WT )/ PyMT mice, genetic ablation of SRC-1 antagonized PyMT-induced restriction of mammary ductal differentiation and elongation. SRC-1 −/− / PyMT mammary tumors were also more differentiated than WT / PyMT mammary tumors. The intravasation of mammary tumor cells and the frequency and extent of lung metastasis were drastically reduced in SRC-1 −/− / PyMT mice compared with WT / PyMT mice. Metastatic analysis of transplanted WT / PyMT and SRC-1 −/− / PyMT tumors in SRC-1 −/− and WT recipient mice revealed that SRC-1 played an intrinsic role in tumor cell metastasis. Furthermore, SRC-1 was up-regulated during mammary tumor progression. Disruption of SRC-1 inhibited Ets-2-mediated HER2 expression and PyMT-stimulated Akt activation in the mammary tumors. Disruption of SRC-1 also suppressed colony-stimulating factor-1 (CSF-1) expression and reduced macrophage recruitment to the tumor site. These results suggest that SRC-1 specifically promotes metastasis without affecting primary tumor growth. SRC-1 may promote metastasis through mediating Ets-2-mediated HER2 expression and activating CSF-1 expression for macrophage recruitment. Therefore, functional interventions for coactivators like SRC-1 may provide unique approaches to control breast cancer progression and metastasis.

The term epigenetics refers to the study of a number of biochemical modifications of chromatin that have an impact on gene expression regulation. Aberrant epigenetic lesions, in particular DNA methylation of promoter associated CpG islands, are common in acute lymphocytic leukemia (ALL). Recent data from multiple laboratories indicate that several hundred genes, involving dozens of critical molecular pathways, are epigenetically suppressed in ALL. Because these lesions are potentially reversible, the reactivation of these pathways using, for instance, hypomethylating agents may have therapeutic potential in this disease. Furthermore, the analysis of epigenetic alterations in ALL may allow: (1) identification of subsets of patients with poor prognosis when treated with conventional therapy; (2) development of new techniques to evaluate minimal residual disease; (3) better understanding of the differences between pediatric and adult ALL; and (4) new therapeutic interventions by incorporating agents with hypomethylating activity to conventional chemotherapeutic programs. In this review, we describe the role of epigenetic alterations in ALL from a translational perspective.

To investigate if the tumor suppressor properties of p57KIP2 are dependent on its DNA methylation status, we studied the impact of several stress stimuli in leukemic cell lines with different p57KIP2 promoter DNA methylation levels. p57KIP2 reactivation was observed after stimulation with transforming growth factor-beta, other cytokines, high-density culture or serum withdrawal in p57KIP2 promoter unmethylated cells but not in methylated cells. In these cells, p57KIP2 reactivation required the use of a hypomethylating agent or a histone deacetylase inhibitor. Overexpression of p57KIP2 in p57KIP2 promoter methylated leukemic cell lines resulted in cell growth arrest and the induction of apoptosis. In contrast, overexpression of p57KIP2 in partially methylated cells only resulted in a moderate inhibition of cell growth and had no impact on apoptosis. Transduction of unmethylated cells expressing high levels of p57KIP2 with p57KIP2 short hairpin RNA resulted in increased cell proliferation. These results suggest that the tumor suppressive properties of p57KIP2 in leukemia may depend on the intrinsic promoter DNA methylation status of the gene.

Activating signal cointegrator 2 (ASC-2) is a transcriptional coactivator of many nuclear receptors (NRs) and other transcription factors and contains two NR-interacting LXXLL motifs (NR boxes). In the pancreas, ASC-2 is expressed only in the endocrine cells of the islets of Langerhans, but not in the exocrine cells. Thus, we examined the potential role of ASC-2 in insulin secretion from pancreatic beta-cells. Overexpressed ASC-2 increased glucose-elicited insulin secretion, whereas insulin secretion was decreased in islets from ASC-2+/- mice. DN1 and DN2 are two dominant-negative fragments of ASC-2 that contain NR boxes 1 and 2, respectively, and block the interactions of cognate NRs with the endogenous ASC-2. Primary rat islets ectopically expressing DN1 or DN2 exhibited decreased insulin secretion. Furthermore, relative to the wild type, ASC-2+/- mice showed reduced islet mass and number, which correlated with increased apoptosis and decreased proliferation of ASC-2+/- islets. These results suggest that ASC-2 regulates insulin secretion and beta-cell survival and that the regulatory role of ASC-2 in insulin secretion appears to involve, at least in part, its interaction with NRs via its two NR boxes.

Amplified in breast cancer 1 (AIB1; steroid receptor coactivator-3, p/CIP, RAC3, ACTR, TRAM-1, or NCoA-3) is a transcriptional coactivator for nuclear receptors and certain other transcription factors and is a newly defined oncogene overexpressed in human breast cancer. Although the role and molecular mechanism of AIB1 in normal physiology and in breast cancer are currently under intensive investigation, the role of AIB1 in determination of the susceptibility of mammary gland to chemical carcinogens remains uncharacterized. In this study, we used back-crossed FVB wild-type (WT) and AIB1 mutant mice to assess the role of AIB1 in mammary gland development and in carcinogen-induced tumorigenesis. We show that mammary ductal growth was delayed in AIB1−/− mice with FVB strain background, and mammary ductal outgrowths emanating from the AIB1−/− mammary epithelial transplants in WT mice also were attenuated, indicating that the role of AIB1 in mammary ductal growth is a mammary epithelial autonomous function. In mice treated with the chemical carcinogen 7,12-dimethylbenz[a]anthracene (DMBA), AIB1 deficiency protected the mammary gland, but not the skin, from tumorigenesis. AIB1 deficiency suppressed the up-regulation of the insulin receptor substrate (IRS)-1 and IRS-2 and thereby inhibited the activation of Akt, expression of cyclin D1, and cell proliferation. The suppression of these components for insulin-like growth factor-I signaling might be partially responsible for the decreased DMBA-induced mammary tumor initiation and progression in AIB1−/− mice. Our results suggest that AIB1 may serve as a potential target for prevention of carcinogen-induced breast cancer initiation and for treatment of breast cancer progression.

The amplified-in-breast cancer 3 (AIB3) is a nuclear receptor coactivator amplified and overexpressed in human breast cancers. AIB3−/− mice die during gestation, whereas AIB3+/− mice exhibit normal development. Here, we demonstrate that AIB3 protein is mainly located in the nuclei of mammary epithelial cells and tumor cells and its levels are elevated in mammary epithelial cells at middle pregnant stage and in mammary tumor cells. To examine whether AIB3 reduction affects mammary tumorigenesis, we generated wild-type mouse mammary tumor virus/polyoma middle-T (WT/PyMT) and AIB3+/−/PyMT mice. Mammary tumor development in AIB3+/−/PyMT female and male mice was substantially accelerated compared with that in WT/PyMT mice, because of increased cell proliferation in early tumorigenic lesions, including ductal hyperplasia and mammary intraepithelial neoplasia. Tumor formation in nude mice that received premalignant AIB3+/−/PyMT mammary tissue was much faster than in nude mice that received transplants of premalignant WT/PyMT mammary tissue, which indicated that the accelerated tumorigenesis in AIB3+/−/PyMT mammary glands is due to a mammary epithelial autonomous defect. Expression of PyMT, estrogen receptor α and estrogen receptor α-regulated genes was unaffected in AIB3+/−/PyMT mammary glands, which suggests that the acceleration of mammary tumor formation in AIB3+/−/PyMT mice was not a consequence of changes in PyMT expression or in estrogen receptor function. Importantly, the inhibitory effects of peroxisome proliferator-activated receptor γ (PPARγ) and retinoid-X receptor (RXR) ligands on AIB3+/−/PyMT cell proliferation and the transcriptional function of PPARγ in AIB3+/−/PyMT cells were reduced. Thus, AIB3 haplodeficiency may facilitate PyMT-induced tumorigenesis through a partial impairment of PPARγ and RXR function. These results suggest that AIB3 may be a tumor suppressor that is required for the inhibition of cell proliferation by PPARγ and RXR.

Although the amplified in breast cancer 1 (AIB1) coactivator is amplified and overexpressed in breast cancers, its role in mammary carcinogenesis remains unknown. We demonstrate that during mammary development and tumorigenesis, the elevation of AIB1 level and its nuclear localization correlate with normal and transformed mammary epithelial proliferation, whereas its lower expression and cytoplasmic localization correlate with mammary epithelial quiescence and differentiation. In this study, the role of AIB1 in breast tumor initiation, progression, and metastasis was studied by generating AIB1+/+, AIB1+/−, and AIB1−/− mice harboring the mouse mammary tumor virus/v-Ha-ras (ras) transgene that induces breast tumors. Breast tumor incidence was reduced dramatically in the intact AIB1−/−-ras virgin mice and inhibited completely in the ovariectomized AIB1−/−-ras mice. Breast tumor latency was delayed significantly in AIB1−/−-ras virgin mice with natural estrous cycles, multiparous mice with cyclically elevated reproductive hormones, and virgin mice bearing pituitary isografts with persistently elevated hormones. Although AIB1 deficiency significantly suppressed mammary tumorigenesis under all of the concentrations of ovarian hormones, it did not affect the promotional role of ovarian hormones on mammary tumorigenesis, suggesting that AIB1 and ovarian hormones contribute to mammary carcinogenesis through different pathways. AIB1 deficiency did not alter the expression of estrogen and progesterone-responsive genes in the mammary gland, but it caused partial resistance to the insulin-like growth factor I because of a significant reduction in the insulin receptor substrates. The impaired insulin-like growth factor I pathway in AIB1−/−-ras mammary epithelium and tumor cells was responsible in part for the suppression of mammary tumorigenesis and metastasis caused by inhibition of cell proliferation and migration. These results suggest that a more effective strategy to control breast cancer is to target AIB1-mediated and ovarian hormone-initiated pathways.

The amplified in breast cancer-3 (AIB3, ASC-2, RAP250, PRIP, TRBP, NRC, or NcoA6) gene is characterized as a cancer-amplified transcriptional coactivator for nuclear receptors, which include the peroxisome proliferator-activated receptor gamma (PPARgamma). To assess its biological function, we deleted the AIB3 gene in mice by homologous recombination. AIB3(+/-) mice are developmentally normal and fertile. AIB3(-/-) embryos exhibit growth restriction and lethality during 9.75-11.5 days postconception. The embryonic lethality is probably attributed to defects in the development of the placental vascular network and cardiac hypoplasia. These defects include the failure of labyrinthine development, the dilation of maternal blood sinuses, the massive erythrophagocytosis by trophoblasts, the alteration of trophoblast populations, and the lower proliferation of myocardium, which are similar to those encountered in mice lacking PPARgamma or the PPARgamma-binding protein (PBP, TRAP220, or DRIP205). In addition, the transcriptional activities of PPARgamma are significantly affected in mouse embryonic fibroblasts lacking AIB3. These results suggest that AIB3 is required for PPARgamma function in placental development and for normal heart development. These results also indicate that the biological function of AIB3 is not redundant with other classes of nuclear receptor coactivators such as PBP and members of the steroid receptor coactivator family.

A large east Texas family with autosomal dominant inheritance of a novel bleeding disorder has been identified. The disorder is characterized clinically by easy bruising, life-threatening bleeding with trauma or surgery, and menorrhagia in affected women. Laboratory studies demonstrated prolongation of the prothrombin time and activated partial thromboplastin time in affected individuals. Paradoxically, assays of known coagulation factors are all within normal limits. To determine the molecular basis of this disease, a candidate gene linkage analysis in this kindred was done. Initially it was hypothesized that the cause of the disease in this family could be an antithrombin III (AT3) mutation that resulted in a constitutively active AT3 in the absence of heparin binding. Linkage studies using DNA from the family and an intragenic polymorphic marker within the AT3 gene showed that the disease mapped to this locus. The coding region and intron/exon junctions of AT3were sequenced using the proband's DNA, but this analysis failed to identify a mutation. Additional family members were recruited for the study, and 16 polymorphic markers around the AT3 gene were analyzed. Using 2 recombinants, the critical interval for the defective gene was narrowed to approximately 1.5 Mb, centromeric toAT3. The factor V (FV) gene was mapped into the disease interval and sequenced; there were no mutations found. Elucidation of the genetic defect causing the bleeding disorder in this family may reveal a novel protein involved in the coagulation cascade.

Objective— Although hypertension is the most common risk factor for thoracic aortic diseases, it is not understood how increased pressures on the ascending aorta lead to aortic aneurysms. We investigated the role of angiotensin II type 1 receptor activation in ascending aortic remodeling in response to increased biomechanical forces using a transverse aortic constriction (TAC) mouse model. Approach and Results— Two weeks after TAC, the increased biomechanical pressures led to ascending aortic dilatation and thickening of the medial and adventitial layers of the aorta. There was significant adventitial hyperplasia and inflammatory responses in TAC ascending aortas were accompanied by increased adventitial collagen, elevated inflammatory and proliferative markers, and increased cell density attributable to accumulation of myofibroblasts and macrophages. Treatment with losartan significantly blocked TAC-induced vascular inflammation and macrophage accumulation. However, losartan only partially prevented TAC-induced adventitial hyperplasia, collagen accumulation, and ascending aortic dilatation. Increased Tgfb2 expression and phosphorylated-Smad2 staining in the medial layer of TAC ascending aortas were effectively blocked with losartan. In contrast, the increased Tgfb1 expression and adventitial phospho-Smad2 staining were only partially attenuated by losartan. In addition, losartan significantly blocked extracellular signal–regulated kinase activation and reactive oxygen species production in the TAC ascending aorta. Conclusions— Inhibition of the angiotensin II type 1 receptor using losartan significantly attenuated the vascular remodeling associated with TAC but did not completely block the increased transforming growth factor-β1 expression, adventitial Smad2 signaling, and collagen accumulation. These results help to delineate the aortic transforming growth factor-β signaling that is dependent and independent of the angiotensin II type 1 receptor after TAC.

Thoracic aortic aneurysms and dissections (TAAD) affect more than 30,000 Americans annually. TAAD can be inherited due to mutations in a number of genes, including MYH11, which encodes the smooth muscle myosin heavy chain. In non-familial TAAD patients, hypertension is the most common risk factor, but genetic contributors have not been explored. Exome sequencing has identified non-synonymous variants of unknown significance in MYH11 in the population, and these variants are enriched in TAAD patients without a family history. The goal of this study was to determine if rare MYH11 variants contribute to TAAD. A knock-in mouse model of one recurrent rare variant, Myh11 R247C, shows no structural or pathologic abnormalities of the aorta, but does have decreased aortic contractility. We sought to determine if the Myh11 R247C allele could modify aortic disease due to another gene mutation. The Myh11R247C allele was bred into Acta2-/- mice, which develop aortic aneurysms, and into Acta2+/- mice, which do not. In both cases, the R247C allele significantly increases aortic diameter and accelerates elastin fragmentation and proteoglycan deposition; however the aneurysms do not progress to aortic dissection. Treatment of Myh11R247C/R247C mice with a combination of L-NAME and high salt diet induced a sustained increase in systolic blood pressure from 130mmHg to 180mmHg. Approximately 25% of Myh11R247C/R247C mice on treatment died spontaneously with evidence of aortic dissections at necropsy, but without aortic dilation. The surviving mice also show no aneurysm formation. Aortic pathology shows significant fragmentation and thinning of elastin fibers, medial thickening, and a unique pattern of proteoglycan deposition along the elastin layers in the hypertensive Myh11R247C/R247C mice. These data indicate that the Myh11R247C allele in mice increases severity of Acta2-/- associated aortic aneurysms and induces aortic disease when added to a known risk factor for TAAD, hypertension. Therefore, patients with the Myh11R247C rare variant and a disease-causing mutation may have earlier disease onset and increased severity; co-occurrence of the Myh11R247C allele in individuals with other benign genetic variants or risk factors like hypertension may induce TAAD.

Aberrant DNA promoter methylation with associated gene silencing is a common epigenetic abnormality in acute lymphoblastic leukaemia (ALL) and is associated with poor survival. We have identified a family of transmembrane tyrosine phosphatase proteins as targets of hypermethylation in ALL and high-grade B cell lymphoma and demonstrated that this abnormal methylation correlates with transcript expression. PTPRG was methylated in 63% of ALL samples, PTPRK in 47%, PTPRM in 64% and PTPRO in 54% of cases, with most ALL samples containing methylation at multiple phosphatase loci. PTPRK promoter methylation was associated with a decreased overall survival in the cohort. Restoration of PTPRK transcript levels in leukaemia cells, where phosphatase transcript was silenced, reduced cell proliferation, inhibited colony formation and increased sensitivity to cytotoxic chemotherapy. These biological changes were associated with a reduction in levels of phosphorylated Erk1/2, Akt, STAT3 and STAT5 suggesting functional phosphatase activity after transcript re-expression. Methylation of the phosphatase promoters was reversible with decitabine and a histone deacetylase inhibitor, suggesting that PTPRK-mediated cell signalling pathways may be targeted with epigenetic therapies in lymphoid malignancy.

Thoracic aortic aneurysms and dissections (TAAD) affect more than 30,000 Americans annually. One-fifth of TAAD patients have a first-degree relative with the disease, suggesting a genetic component to its pathogenesis. Missense mutations in a number of genes lead to TAAD, including MYH11 ,which encodes the smooth muscle isoform of myosin heavy chain. However, potential genetic contributors in the four-fifths of patients without affected relatives have not been explored. Variants of unknown significance in MYH11 are prevalent in the population, and are enriched in patients with TAAD and other vascular diseases. The goal of this study was to evaluate one of these variants as a potential contributor to TAAD. A knock-in mouse model of the Myh11 R247C rare variant was generated, and these mice survive and reproduce normally. They have no structural abnormalities of the aorta or signs of aortic disease, but do have decreased aortic contractility. Myh11 R247C/R247C mice also have increased neointimal proliferation following carotid ligation and increased proliferation of vascular smooth muscle cells (SMCs) in vitro. Myh11 R247C/R247C SMCs have decreased contractile gene and protein expression and are dedifferentiated. In fibroblasts, myosin force generation is required for maturation of focal adhesions, and enhancers of RhoA activity replace enhancers of Rac1 activity as maturation occurs. Consistent with these previous findings, adhesions are smaller in Myh11 R247C/R247C SMCs, and there is increased Rac1 and focal adhesion kinase (FAK) activation with decreased RhoA activation. A RhoA activator (CN03) rescues the dedifferentiated phenotype of Myh11 R247C/R247C SMCs, and FAK inhibition reduces proliferation. Since this rare variant occurs in the general population, we sought to determine if it acts as a modifier gene for aortic disease. The Myh11 R247C allele was bred into Acta2 -/- mice, which develop aortic aneurysms, and into Acta2 +/- mice, which do not. In both cases, the presence of the R247C allele increases aortic diameter. These preliminary data suggest that the MYH11 R247C rare variant may be a genetic contributor to TAAD in patients without an inherited mutation, or may affect the clinical presentation of TAAD in patients with Mendelian disease.

The Notch pathway can have both oncogenic and tumor suppressor roles, depending on cell context. For example, Notch signaling promotes T cell differentiation and is leukemogenic in T cells, whereas it inhibits early B cell differentiation and acts as a tumor suppressor in B cell leukemia where it induces growth arrest and apoptosis. The regulatory mechanisms that contribute to these opposing roles are not understood. Aberrant promoter DNA methylation and histone modifications are associated with silencing of tumor suppressor genes and have been implicated in leukemogenesis. Using methylated CpG island amplification (MCA)/DNA promoter microarray, we identified Notch3 and Hes5 as hypermethylated in human B cell acute lymphoblastic leukemia (ALL). We investigated the methylation status of other Notch pathway genes by bisulfite pyrosequencing. Notch3, JAG1, Hes2, Hes4 and Hes5 were frequently hypermethylated in B leukemia cell lines and primary B-ALL, in contrast to T-ALL cell lines and patient samples. Aberrant methylation of Notch3 and Hes5 in B-ALL was associated with gene silencing and was accompanied by decrease of H3K4 trimethylation and H3K9 acetylation and gain of H3K9 trimethylation and H3K27 trimethylation. 5-aza-2′-deoxycytidine treatment restored Hes5 expression and decreased promoter hypermethylation in most leukemia cell lines and primary B-ALL samples. Restoration of Hes5 expression by lentiviral transduction resulted in growth arrest and apoptosis in Hes5 negative B-ALL cells but not in Hes5 expressing T-ALL cells. These data suggest that epigenetic modifications are implicated in silencing of tumor suppressor of Notch/Hes pathway in B-ALL.

Chromosomal deletions or reciprocal duplications of the 16p13.1 region have been implicated in a variety of neuropsychiatric disorders such as autism, schizophrenia, epilepsies, and attention-deficit hyperactivity disorder (ADHD). In this study, we investigated the association of recurrent genomic copy number variants (CNVs) with thoracic aortic aneurysms and dissections (TAAD). By using SNP arrays to screen and comparative genomic hybridization microarrays to validate, we identified 16p13.1 duplications in 8 out of 765 patients of European descent with adult-onset TAAD compared with 4 of 4,569 controls matched for ethnicity (P = 5.0×10−5, OR = 12.2). The findings were replicated in an independent cohort of 467 patients of European descent with TAAD (P = 0.005, OR = 14.7). Patients with 16p13.1 duplications were more likely to harbor a second rare CNV (P = 0.012) and to present with aortic dissections (P = 0.010) than patients without duplications. Duplications of 16p13.1 were identified in 2 of 130 patients with familial TAAD, but the duplications did not segregate with TAAD in the families. MYH11, a gene known to predispose to TAAD, lies in the duplicated region of 16p13.1, and increased MYH11 expression was found in aortic tissues from TAAD patients with 16p13.1 duplications compared with control aortas. These data suggest chromosome 16p13.1 duplications confer a risk for TAAD in addition to the established risk for neuropsychiatric disorders. It also indicates that recurrent CNVs may predispose to disorders involving more than one organ system, an observation critical to the understanding of the role of recurrent CNVs in human disease and a finding that may be common to other recurrent CNVs involving multiple genes., Author Summary Thoracic aortic aneurysms and acute aortic dissections (TAAD) have ranked as high as the fifteenth leading cause of death in the United States. TAAD can be inherited in families in an autosomal dominant manner, and mutations in ACTA2 and MYH11, genes encoding two major components of the smooth muscle contractile unit, are responsible for approximately 15% of familial TAAD. However, the majority of patients with TAAD do not have an identified syndrome or family history of aortic disease, and genetic factors predisposing to these sporadic cases have not been identified. To determine whether recurrent genomic copy number variants (CNVs) contribute to TAAD pathogenesis, we screened 765 patients with adult-onset TAAD for CNVs and identified recurrent 16p13.1 duplications in 1% of TAAD cases compared with 0.09% of controls. The 16p13.1 duplication involves 9 genes, including MYH11. This recurrent duplication of 16p13.1 has also been determined to be associated with neuropsychiatric conditions, specifically schizophrenia and attention-deficit hyperactivity disorder. Our study suggests that recurrent duplications of 16p13.1 confer a risk for both neuropsychiatric diseases and TAAD, a finding that may be common to other recurrent CNVs involving multiple genes.

We performed a genome-wide analysis of aberrant DNA methylation in chronic lymphocytic leukemia (CLL) using methylated CpG island amplification (MCA) coupled with a promoter microarray. We identified 280 potential targets of aberrant DNA methylation in CLL. These genes were located more frequently in chromosomes 19 (16%, p = 0.001), 16 (11%, p = 0.001), 17 (10%, p = 0.02) and 11 (9%, p = 0.02) and could be grouped in several functional networks. Methylation status was confirmed for 22 of these genes (SOX11, DLX1, FAM62C, SOX14, RSPO1, ADCY5, HAND2, SPOCK, MLL, ING1, PRIMA1, BCL11B, LTBP2, BNC1, NR2F2, SALL1, GALGT2, LHX1, DLX4, KLK10, TFAP2 and APP) in 78 CLL patients by pyrosequencing. As a proof of principle, we analyzed the expression of 2 genes, PRIMA1 and APP, in primary cells and of GALGT2, TFAP2C and PRIMA1 in leukemia cells. There was an inverse association between methylation and gene expression. This could be reversed by treatment with 5-aza-2′-deoxycytidine in cell lines. Treatment in a clinical trial with 5-azacitidine resulted in decreased methylation of LINE, DLX4 and SALL1 in the peripheral blood B-cells of patients with CLL. IgVH mutational status or ZAP-70 expression were not associated with specific methylation profiles. By multivariate analysis, methylation of LINE and APP was associated with shorter overall survival (p = 0.045 and 0.0035, respectively). This study demonstrates that aberrant DNA methylation is common and has potential prognostic and therapeutic value in CLL.

Eph receptors and their ephrin ligands are involved in normal hematopoietic development and tumorigenesis. Using methylated CpG island amplification/DNA promoter microarray, we identified several EPH receptor and EPHRIN genes as potential hypermethylation targets in acute lymphoblastic leukemia (ALL). We subsequently studied the DNA methylation status of the Eph/ephrin family by bisulfite pyrosequencing. Hypermethylation of EPHA2, -A4, -A5, -A6, -A7, -A10, EPHB1, -B2, -B3, -B4, EFNA1, -A3, -A5, and EFNB1 and -B2 genes was detected in leukemia cell lines and primary ALL bone marrow samples. Expression analysis of EPHB4, EFNB2, and EFNA5 genes demonstrated that DNA methylation was associated with gene silencing. We cloned the promoter region of EPHB4 and demonstrated that promoter hypermethylation can result in EPHB4 transcriptional silencing. Restoration of EPHB4 expression by lentiviral transduction resulted in reduced proliferation and apoptotic cell death in Raji cells in which EPHB4 is methylated and silenced. Finally, we demonstrated that phosphorylated Akt is down-regulated in Raji cells transduced with EPHB4. These results suggest that epigenetic silencing by hypermethylation of EPH/EPHRIN family genes contributes to ALL pathogenesis and that EPHB4 can function as a tumor suppressor in ALL.

Marfan syndrome (MFS) is an autosomal dominant condition with pleiotropic manifestations involving the skeletal, ocular, and cardiovascular systems. The diagnosis is based primarily on clinical involvement of these and other systems, referred to as the Ghent criteria. We have identified three Hispanic families from Mexico with cardiovascular and ocular manifestations due to novel FBN1 mutations but with paucity of skeletal features. The largest family, hMFS001, had a frameshift mutation in exon 24 (3075delC) identified as the cause of aortic disease in the family. Assessment of eight affected adults revealed no major skeletal manifestation of MFS. Family hMFS002 had a missense mutation (R1530C) in exon 37. Four members fulfilled the criteria for ocular and cardiovascular phenotype but lacked skeletal manifestations. Family hMFS003 had two consecutive missense FBN1 mutations (C515W and R516G) in exon 12. Eight members fulfilled the ocular criteria for MFS and two members had major cardiovascular manifestations, however none of them met criteria for skeletal system. These data suggest that individuals of Hispanic descent with FBN1 mutations may not manifest skeletal features of the MFS to the same extent as Caucasians. We recommend that echocardiogram, ocular examination and FBN1 molecular testing be considered for any patients with possible MFS even in the absence of skeletal features, including Hispanic patients.

We performed a genome-wide analysis of promoter associated CpG island methylation using methylated CpG island amplification (MCA) coupled to representational differential analysis (RDA) or a DNA promoter microarray in acute lymphoblastic leukemia (ALL). We identified 65 potential targets of methylation with the MCA/RDA approach, and 404 with the MCA/array. Thirty-six (77%) of the genes identified by MCA/RDA were shared by the MCA/array approach. Chromosomal location of these genes was evenly distributed in all autosomes. Functionally, 303 of these genes clustered in 18 molecular pathways. Of the 36 shared genes, 31 were validated and 26 were confirmed as being hypermethylated in leukemia cell lines. Expression analysis of eight of these genes was epigenetically modulated by hypomethylating agents and/or HDAC inhibitors in leukemia cell lines. Subsequently, DNA methylation of 15 of these genes (GIPC2, RSPO1, MAGI1, CAST1, ADCY5, HSPA4L, OCLN, EFNA5, MSX2, GFPT2, GNA14, SALL1, MYO5B, ZNF382 and MN1) was validated in primary ALL samples. Patients with methylation of multiple CpG islands had a worse overall survival. This is the largest published list of potential methylation target genes in human leukemia offering the possibility of performing rational unbiased methylation studies in ALL.

Generation and characterization of knockout mice from targeted embryonic stem (ES) cells have become one of the most powerful approaches to study gene function in vivo. However, experiments to identify targeted ES clones can be both labor-intensive and expensive when the targeting efficiency is low. Using the steroid receptor coactivator-3 (SRC-3) gene as a model, we have developed a rapid and cost-effective method for identification of targeted ES clones. Specifically, a promoterless LacZ sequence was fused to the 5'-coding sequence of SRC-3 in the targeting vector. After homologous recombination in ES cells, LacZ expression was regulated by the endogenous gene promoter. In cases of random insertions the beta-galactosidase would more likely not be produced due to lacking promoter or missing amino acid-reading frame. Accordingly, targeted ES clones were enriched more than 30 times in the population of blue clones positive to X-gal staining. Therefore, targeted ES clones can be selected quickly and economically by X-gal staining in large scale followed by Southern blot analysis on small number of blue clones if the gene of interest is expressed in ES cells. This strategy is particularly useful when the targeting efficiency is low and a reporter such as LacZ or GFP for mouse gene expression is desired.

Although the amplified in breast cancer 1 (AIB1) coactivator is amplified and overexpressed in breast cancers, its role in mammary carcinogenesis remains unknown. We demonstrate that during mammary development and tumorigenesis, the elevation of AIB1 level and its nuclear localization correlate with normal and transformed mammary epithelial proliferation, whereas its lower expression and cytoplasmic localization correlate with mammary epithelial quiescence and differentiation. In this study, the role of AIB1 in breast tumor initiation, progression, and metastasis was studied by generating AIB1(+/+), AIB1(+/-), and AIB1(-/-) mice harboring the mouse mammary tumor virus/v-Ha-ras (ras) transgene that induces breast tumors. Breast tumor incidence was reduced dramatically in the intact AIB1(-/-)-ras virgin mice and inhibited completely in the ovariectomized AIB1(-/-)-ras mice. Breast tumor latency was delayed significantly in AIB1(-/-)-ras virgin mice with natural estrous cycles, multiparous mice with cyclically elevated reproductive hormones, and virgin mice bearing pituitary isografts with persistently elevated hormones. Although AIB1 deficiency significantly suppressed mammary tumorigenesis under all of the concentrations of ovarian hormones, it did not affect the promotional role of ovarian hormones on mammary tumorigenesis, suggesting that AIB1 and ovarian hormones contribute to mammary carcinogenesis through different pathways. AIB1 deficiency did not alter the expression of estrogen and progesterone-responsive genes in the mammary gland, but it caused partial resistance to the insulin-like growth factor I because of a significant reduction in the insulin receptor substrates. The impaired insulin-like growth factor I pathway in AIB1(-/-)-ras mammary epithelium and tumor cells was responsible in part for the suppression of mammary tumorigenesis and metastasis caused by inhibition of cell proliferation and migration. These results suggest that a more effective strategy to control breast cancer is to target AIB1-mediated and ovarian hormone-initiated pathways.

Nuclear hormone receptors are ligand-dependent transcription factors that require coactivators to regulate target gene expression. The steroid receptor coactivator-3 (SRC-3), also known as p/CIP, RAC3, AIB1, ACTR and TRAM-1, is a cancer-amplified coactivator in the SRC gene family that also contains SRC-1 and TIF2/GRIP1. SRC-3 interacts with nuclear receptors and certain other transcription factors, recruits histone acetyltransferases and methyltransferases for chromatin remodeling and facilitates target gene transcription. Accumulated results from both ex vivo and animal model studies indicate that SRC-3 plays important roles in many biological processes involving cell proliferation, cell migration, cell differentiation, somatic growth, sexual maturation, female reproductive function, vasoprotection and breast cancer. This article summarizes our current knowledge about SRC-3 under the following topics: molecular cloning and characterization; molecular structure and functional mechanisms; SRC-3 as a molecular target of growth factors and cytokines; organization and expression of the SRC-3 gene; generation and characterization of SRC-3 knockout mice; role of SRC-3 in the vasoprotective effects of estrogen; role of SRC-3 in cell migration, proliferation and cancers.

Transcriptional activities of nuclear receptors are modulated by coactivators and corepressors. The amplified in breast cancer-3 protein (AIB3, also known as ASC-2, RAP250, PRIP, TRBP, and NCR) is a newly identified nuclear receptor coactivator that is amplified and overexpressed in breast cancers. This study aims to investigate the spatial expression of AIB3 mRNA and protein in various murine tissues. Quantitative measurements revealed that the concentrations of AIB3 mRNA differ substantially in different tissues in a descending order from the following: testis, brain, thymus, white fat, pituitary, ovary, adrenal gland, lung, uterus, kidney, heart, skeletal muscle, liver, and virgin mammary gland. The AIB3 mRNA level in the testis is 165-fold higher than that in the virgin mammary gland. Specific antiserum was generated and used to map the distribution of AIB3 protein by immunohistochemistry. Although AIB3 protein was detected in many tissues, the AIB3 immunoreactivities varied significantly from cell type to cell type. High levels of AIB3 immunoreactivity were observed in hormone target cells including the testicular Sertoli cells, follicular granulosa cells, and epithelial cells of the prostate, uterus, mammary gland, and kidney tubules. Medium and low levels of AIB3 immunoreactivities were also detected in a variety of other cell types. These results demonstrate that AIB3 mRNA and protein are preferentially expressed in specific cell types, suggesting that AIB3 may support the function of nuclear receptors in a cell type-specific manner.

Background —Aneurysms and dissections affecting the ascending aorta are associated primarily with degeneration of the aortic media, called medial necrosis. Families identified with dominant inheritance of thoracic aortic aneurysms and dissections (TAA/dissections) indicate that single gene mutations can cause medial necrosis in the absence of an associated syndrome. Methods and Results —Fifteen families were identified with multiple members with TAAs/dissections. DNA from affected members from 2 of the families was used for a genome-wide search for the location of the defective gene by use of random polymorphic markers. The data were analyzed by the affected-pedigree-member method of linkage analysis. This analysis revealed 3 chromosomal loci with multiple markers demonstrating evidence of linkage to the phenotype. Linkage analysis using further markers in these regions and DNA from 15 families confirmed linkage of some of the families to 5q13-14. Genetic heterogeneity for the condition was confirmed by a heterogeneity test. Data from 9 families with the highest conditional probability of being linked to 5q were used to calculate the pairwise and multipoint logarithm of the odds (LOD) scores, with a maximum LOD of 4.74, with no recombination being obtained for the marker D5S2029 . In 6 families, the phenotype was not linked to the 5q locus. Conclusions —A major locus for familial TAAs and dissections maps to 5q13-14, with the majority (9 of 15) of the families identified demonstrating evidence of linkage to this locus. The condition is genetically heterogeneous, with 6 families not demonstrating evidence of linkage to any loci previously associated with aneurysm formation.

The exons 13, 16, 21 and 23 of cardiac beta-myosin heavy chain (MHC) gene from 32 Chinese patients with hypertrophic cardiomyopathy were analyzed by the polymerase chain reaction and the DNA single strand conformation polymorphism (PCR-SSCP) procedure. The results showed an altered SSCP in exon 13 of one patient. Sequencing analysis revealed that the patient had a G to T transversion in codon 383, resulting in the substitution of Lys by Asn. The missense mutation was also confirmed by Southern blot hybridization with an allele-specific oligonucleotide probe. Because it was found at a residue highly conserved through evolution, this mutation is likely to be the cause of hypertrophic cardiomyopathy in the patient. Because her parents and child were neither clinically nor genetically affected, it was concluded that the mutation in this patient arose de novo and was not passed to her child. This is the first report of a mutant cardiac beta-MHC gene in the Chinese population. Also, it is a novel missense mutation of the cardiac beta-MHC gene.

Two types of markers, namely the clone-specific markers including T-cell receptor (TCR) gamma, TCR delta, and Ig heavy-chain (IgH) gene rearrangements, and malignancy-specific fusion gene mRNA such as SIL-TAL-1, BCR-ABL, and HRX-partner genes, were investigated by molecular biology techniques in 65 Chinese patients with acute lymphoblastic leukemia (ALL). In combination, these markers were informative among 96% of patients. Minimal residual disease (MRD) was followed up in 23 of these patients with available materials over a period varying from 8 to 54 months with at least one leukemia-specific probe. In most children, MRD was decreased continuously to an ultimately undetectable level within 6 to 12 months after remission induction therapy. One patient exhibited low-level residual leukemic cells for 4 years before the MRD turned negative. Another patient remained in complete remission for 45 months, although a positive signal was detected at 34 months using TCR delta probe, but was negative with a TCR gamma marker which was positive at presentation. In three patients who relapsed, MRD either persisted through the clinical course or became positive and eventually increased 3-11 months before clinical relapse. These data suggested that the combined use of multiple gene markers is a valuable tool for the PCR-based MRD detection, since it can cover most ALL patients. Furthermore, long-term follow-up of MRD is helpful for determining the dosage as well as the period of maintenance chemotherapy and for predicting impending relapse.

Abstract 2030 Poster Board II-7 Aberrant DNA methylation of multiple promoter associated CpG islands is frequent in primary ALL and predicts for poor prognosis in adult and pediatric disease. Treatment of ALL cell lines with the hypomethylating agent decitabine results in induction of global and gene specific hypomethylation, reactivation of epigenetically silenced genes and induction of apoptosis at low concentrations and prolonged exposures (Leuk Res 2005;29:739-48). Prior studies of decitabine in myeloid leukemias indicated that induction of global and gene specific hypomethylation using a 5-day schedule of decitabine is transient peaking 7 to 10 days after initiation of therapy. In view of the proliferative nature of ALL and in vitro modeling results, we designed a phase 1 study of decitabine administered daily x 5 every other week in patients with relapsed or refractory ALL. The main objective of the study is to determine the safety, activity, pharmacodynamic effects and optimal dose (based on clinical activity, toxicity profile and hypomethylating properties) of decitabine in relapsed refractory ALL. The study design follows a standard “3+3” rule with an expansion cohort of N=10 patients at the optimal dose. Patients of any age with relapsed refractory ALL are elegible regardless of performance status or organ function. Initial dose level of decitabine was 10 mg/m2 IV infused over 1 hour daily x 5 days every other week with courses of therapy repeated every 28 days. Use of steroids was allowed during the first course of therapy at the discretion of treating physician. 23 patients have been treated in 7 dose levels (10, 20, 40, 60, 80, 100 and 120 mg/m2 IV QD x 5 every other week). Cumulative doses per course ranged from 100 to 1200 mg/m2. Patient characteristics are: median age 36 years (range 8-67), median WBC 5.3 (range 0.2 to 97), median % peripheral blasts 23% (0-97), cytogenetics diploid in 4 (17%), Ph + 2 (8%), complex 17 (73%), phenotype preB/B in 15 (65%). Median number of prior therapies was 3 (range 1 to 7). No severe drug related grade 3 or 4 toxicity was observed at any dose level. Frequent toxicities included diarrhea, fatigue and liver function abnormalities that were limited and probably related to disease. Overall response rate was 23% (6 pts) including 1 CRp (complete remission with incomplete platelet recovery) and 5 complete marrow responses (blasts less than 5%). All responses lasted at least 4 weeks. Responses were observed at multiple dose leves (#1, 2, 4, 5, 7). Global and gene specific methylation was analyzed on days 0, 2,5, 14,16,19 and 28 of cycle 1. Samples were collected from 18 consenting patients. Global methylation was analyzed using the LINE bisulfite pyrosequencing assay. Median day 0 methylation was 63%, declined to 55% (p=0.01) on day 14 and increased to 61% on day 28. The most effective dose in inducing global hypomethylation was 60 mg/m2 : 61% baseline to 21% on day 28. The following genes were analyzed for gene specific methylation: p73, p15, p15, HES5, Notch3 and Jag1. Induction of hypomethylation was observed in informative patients, a process associated with gene expression reactivation. The analysis is not powered to detect association between response and hypomethylating effect. Finally, depletion of DNMT1 was measured using a Western blot assay. Depletion was only observed in 1 patient treated at 60 mg/m2 that had achieved a response. In summary, single agent decitabine is safe at higher doses than used in myeloid leukemias with clinical activity in patients with advanced refractory relapsed ALL. Of importance, hypomethylating effect is observed at cumulative doses of up to 1200 mg/m2 with a maximal effect at 600 mg/m2, doses that are considered cytotoxic in myeloid leukemias. The study continues at the expansion cohort of 60 mg/m2 IV QD x 5 every other week, the dose considered to be optimal based on toxicity, response and hypomethylating effects. Two patients have been treated but are early for assessment. A parallel study of decitabine combined with hyperCVAD is ongoing in patients that do not respond or progress after single agent decitabine. The activity of decitabine should be tested in patients in first relapse ALL. Disclosures: Off Label Use: Decitabine is not approved for treatment of ALL.

Abstract 982 Poster Board I-4 Recently,Mulligan et al have reported on the strong relationship between deletion of IKZF1 and poor prognosis in pediatric acute lymphocytic leukemia (ALL) (NEJM 2009;360:470-80). This study is of significant importance as it may allow for the identification of children with poor prognosis disease not currently identifiable with standard clinical or molecular assays. Aberrant DNA methylation consists on the addition of a methyl group to a cytsosine (C) when it is followed by a guanine (G) in so-called CpG sites. Methylation of CpG rich areas (CpG islands) in the proximity of gene promoters is associated with gene silencing and is considered a functional equivalent to the physical inactivation of genes via deletions or inactivating mutations. Aberrant DNA methylation is very frequent in both adult and pediatric ALL. Indeed, CDKN2A and 2B, two genes known to be frequently methylated in ALL were also found to be deleted in Mullighan's study. Furthermore, CDKN2A has been shown to be both methylated and deleted in patients with hematological malignancies5. Therefore it is possible that aberrant methylation of IKZF1 could provide a functional alternative to its deletion in both adult and pediatric ALL. To study this issue, we analyzed the frequency of IKZF1 methylation in ALL. First using BLAT database (http://genome.brc.mcw.edu/cgi-bin/hgBlat), we established that IKZF1 contains a CpG island in the proximity of its promoter. Subsequently, we designed a set of primers for bisulfite pyrosequencing analysis of IKZF1 methylation (forward primer sequence was GTTATTGTGAAAGAAAGTTGGGAAGAG in positions -116 to -89 from the transcription start site; reverse primer was CCTCCCCCCCAAACTAAAATAC in position +29 to +7 from the start site; and the sequencing primer was AGTTAGTAGGATATTTTAATAAGTG from -78 to -53). Annealing temperature was 59 °C. Conditions for bisulfite conversion of DNA and pyrosequencing have been previously reported. Using these conditions and primers, we first analyzed a battery of 21 leukemia cell lines (Molt4, Jurkat, PEER, T-ALL1, CEM, J-TAG, B-JAB, RS4, ALL1, REH, Raji, Ramos, K562, BV173, HL60, NB4, THP1, U937, OCI-AML3, HEL, KBM5R) of different origins. As negative controls, we used DNA extracted from peripheral blood mononuclear cells from healthy donors and as positive controls SssI treated DNA. None of the cell lines or controls had evidence of DNA methylation of IKZF1 (median 1.53%, range 0.94 to 1.76). By convention, a sample is considered to be methylated if the percent of methylation is above 10 to 15%. Despite the fact that it is extremely unlikely to find DNA methylation in absence of evidence of methylation in cell lines, we decided to analyze the methylation status of IKZF1 in two different cohorts of patients with ALL. The first cohort consisted of a group of pediatric patients (N=20) previously reported by us (Leuk Res 2005;29:881-5). Median methylation was 2.8% (range 1.5 to 11.4). The second cohort of consisted of 17 patients. Median age was 33 years (range 8 to 66); 12 patients (70%) had pre-B/B phenotype, 4 (23%) were female and 14 (82%) had complex cytogenetics. Median methylation was 1.3%, range 0.38 to 2.3%. Our data indicates that functional inactivation of IKZF1 via aberrant DNA methylation is probably a very rare phenomenon in ALL. This data has implications for our understanding of the prognostic role of IZFZ1 in ALL and for future testing of IKZF1 inactivation in this disease. Disclosures: No relevant conflicts of interest to declare.

The Notch signaling pathway has been implicated in multiple functions during normal hemato-lymphoid development. It also plays critical roles in T-cell leukemogenesis through influencing T-cell proliferation, differentiation and survival. In contrast, we have previously reported a tumor suppressor role in B-cell leukemias, where Notch signaling leads to growth inhibition and apoptosis. The Notch target genes Hairy/Enhancer of Split (HES1-7) encode transcriptional repressors with basic helix-loop-helix (bHLH) domains. Functional and phenotypic analyses of some of the HES family members have been reported, however, expression and epigenetic regulation of the HES family in leukemia is largely unknown. Using Methylated CpG Island Amplification (MCA) / DNA promoter microarray, we identified several HES family genes as hypermethylated in B cell acute lymphoblastic leukemia (B ALL). We further investigated the comprehensive methylation profiles of HES family genes in a panel of leukemia cell lines and ALL patient samples by bisulfite pyrosequencing. Aberrant DNA methylation of HES2, HES4, HES5 and HES6 was detected in most B ALL cell lines including B-JAB, RS4:11, REH, Raji and Ramos but not in normal B cell controls. In contrast, in T cell leukemia cell lines such as Molt4, PEER, T-ALL1 and J-TAG, these genes were generally unmethylated. In B ALL patient samples, the frequencies of DNA methylation in the promoter regions of these genes were 25% for HES2, 50% for HES4, 76% for HES5 and 71% for HES6. Expression analysis of HES4, HES5 and HES6 in leukemia cell lines by real-time PCR further confirmed methylation associated gene silencing. Treatment of methylated/silenced cell lines with DNA methyltransferase inhibitor 5’-aza-2’-deoxycytidine resulted in HES gene re-expression. Finally, forced re-expression of HES5 and HES6 in methylation silenced Rs4 and REH cell lines inhibited cell growth. These results suggest that the Notch/HES signaling pathway is epigenetically-inactivated in B ALL. These data support the role of the HES family as tumor suppressors in pre-B ALL and establish epigenetic modulation as a novel mechanism of Notch pathway regulation. We anticipate that therapies capable of activating Notch/HES signaling may have therapeutic potential in B cell leukemias.

Background: Aberrant DNA methylation of multiple promoter associated CpG islands is very prevalent phenomenon in human leukemias. Data from several laboratories indicate that methylation profiling allows the identification of leukemia patients with different prognosis. It is now accepted that human leukemias are characterized by the methylation of multiple promoter CpG islands involving multiple epigenetically dyregulated molecular pathways. Little is known in terms of the molecular epigenetic heterogeneity of different lymphoid malignancies. The identification of specific molecular pathways shared by phenotypic/genetic distinct types of leukemias may provide important understanding of critical molecular pathways in leukemia. Aims: To compare the genome-wide methylation profiles of ALL and CLL. To do so, we have used a genome wide methylation assay combining MCA (Methylated CpG island Amplification) with the Agilent promoter CpG array. This allows the identification simultaneously of hundreds of abnormally methylated CpG islands. The aim was to identify common epigenetically regulated pathways shared by both disorders. Results: We identified 280 promoter CpG islands differentially methylated in CLL and 405 protomer CpG island differentially methylated in ALL. Of all these genes, 47 (7.4%) of them were commonly methylated in both ALL and CLL. We then characterized the methylation profiles of these 47 genes in a cohort of ALL (N=24) and CLL (N=78) patient samples and tried to identify common molecular pathway(s) that are epigenetically deregulated in ALL and CLL. We also performed interaction pathway and functional analysis of these 47 genes using the online Ingenuity Pathway Analysis tools. The initial analysis divided these genes into 8 functional networks, with major functions involving cancer, cell growth and differentiation, and tissue development. We validated 18 of these 47 genes (NR2F2, SOX14, SOX11, DLX1, DLX4, FAM62C, BLC11B, KLK10, PRIMA1, HAND2, BNC1, SPOCK, COL2A, GPC6, SSTR1, PEG10, BASP1, CYP1B1) in human leukemia cell lines (N=22), CLL patient samples (N=78), ALL patient samples (N=24) and normal CD19+ B-cells (NBCs) from healthy controls (N=10). All of the 18 genes with the exception of BNC1 have higher level of methylation in leukemia cell lines, CLL and ALL patients than NBCs. For some of these genes, the level of methyation was usually higher in ALL than CLL patients (NR2F2, p=0.03; SOX14, p=0.0005; DLX4, p=0.0001; FAM62C, p=0.0003; KLK10, p=0.039; PRIMA1, p=0.0001; HAND2, p=0.0001; BNC1, p=0.003; BASP1, p=0.0001; CYP1B1, p=0.0001). Conclusions: The current study identified 47 promoter CpG islands that are commonly methylated in both ALL and CLL using MCA-microarray technique. This information will help target on common molecular pathway(s) that are epigenetically deregulated in the pathogenesis of ALL and CLL. The correlation between methylation profile of these genes and prognosis, survival in lymphoid leukemia needs to be further evaluated in a larger number of patients.

Histone deacetylase (HDAC) inhibitors are being developed clinically for the treatment of leukemia. Because HDACs are composed of a large number of different proteins, and substrate specificity may differ among different HDAC inhibitors, it is important to understand if human leukemias are characterized by specific HDAC expression patterns. To study this, we have analyzed using real-time PCR and Western blots, all major class I and II HDACs in normal marrow controls (N=13, including 10 CD19+ B cell specimens), leukemia cell lines (N=25), samples from patients with AML (N=6), MDS (N=12), CLL (N=10) and human samples (N=6) obtained pretreatment and sequentially from patients with leukemia treated with two different phase I clinical trials of HDAC inhibitors: MGCD0103 and vorinostat. In general, normal controls were characterized by low levels of HDACs 1 to 10, although normal CD19+ B cells exhibited a significant increased expression of HDAC1 and 5. In leukemia cell lines, HDAC 1, 2 and 3 were expressed at higher levels than 4 to 10 but there were no differences between leukemia cell lines and normal controls or B cells. HDAC mRNA expression was not modified by cell proliferation or treatment with HDAC inhibitors. No specific HDAC expression profiles were detected in primary human AML or MDS samples. In contrast, CLL primary samples were characterized by an overexpression of HDAC 1,3,5 and 10, although this pattern was not significantly different than that of normal CD19+ B cells. Sequential analysis of human samples obtained from patients treated with two different HDAC inhibitors, vorinostat or MGCD0103 on two different clinical trials, did not affect expression profiles in patients with MDS or AML. Overall, mRNA expression results correlated with protein levels. In summary, our results indicate that AML or MDS are not characterized by a leukemia specific HDAC expression profile but that B cells and B cell leukemia are characterized by a significant overexpression of HDAC 1. This could explain the activity observed with HDAC inhibitors in B cell malignancies and serve as the bases for clinical studies of HDAC inhibitors in CLL.

The Eph (erythroprotein-producing hepatoma amplified sequence) family receptor tyrosine kinases and their ephrin ligands (ephrins) are involved in a variety of functions in normal cell development and cancer. We have identified several members of this family as potential targets of aberrant DNA methylation using Methylated CpG Island Amplification (MCA) / DNA promoter microarray technology. This is of importance as there are no prior reports of potential Eph receptor or Ephrin epigenetic inactivation in human leukemia. To further investigate the role of Eph receptor and ephrin family genes in leukemia, we have analyzed their DNA methylation status in a panel of 23 leukemia cell lines and 65 primary ALL patient samples. Aberrant DNA methylation of 9 of these genes (EPHA4, EPHA5, EPHA6, EPHB2, EPHB3, EPHB4, EphrinA5, Ephrin B2, and EphrinB3) was detected in multiple leukemia cell lines but not in normal samples by bisulfite pyrosequencing. In ALL patient samples, the frequencies of DNA methylation detected in the promoter regions of these genes ranged from 23% to 87% for EPHA4, EPHA5, EPHA6, EPHB2, EPHB3, EPHB4, EphrinA5, Ephrin B2, and EphrinB3. Expression analysis of 3 of these genes (EPHA5, EPHB4 and Ephrin B2) in leukemia cell lines by real-time PCR further confirmed methylation associated gene silencing. Treatment of methylated/silenced cell lines with DNA methyltransferase inhibitor 5′-aza-2′-deoxycytidine resulted in gene re-expression. Forced overexpression of EPHB4 using a lentivirus transduction system in Raji cell lines resulted in decreased cell proliferation and adhesion-independent cell growth, as well as in an increase in staurosporine induction of apoptosis. In addition, EPHB4 overexpression resulted in a significant downregulation of phosphorylated Akt pathway but had no effect on mitogen-activated protein kinase pathway. In summary, we describe for the first time the epigenetic suppression of Ephrin receptors and their ligands in human leukemia, indicating that these genes may be potential tumor suppressors in leukemia. Targeting of these pathways may result in the development of new potential therapies and biomarkers for patients with ALL.

Aberrant DNA methylation is a common molecular feature of both pediatric and adult ALL. Specific methylation patterns predict for poor prognosis (Shen et al Blood 2004), and reactivation of epigenetically inactivated molecular pathways results in induction of leukemia cell death (Kuang et al. Oncogene 2007). Until now most studies of methylation in ALL have been based on arbitrary gene selection methods. To overcome this limitation and to study hundreds of promoter CpG islands simultaneously, we have developed a method that combines MCA (Methylated CpG Island Amplification) with either RDA (Representational Difference Analysis) or the Agilent Promoter Microarray platform. With these methods differentially methylated DNA treated with bisulfite is generated after mixing tester DNA (in our case DNA from de novo refractory Ph negative and MLL negative ALL patients) with driver DNA (normal B cell controls) and using specific restriction enzymes and several rounds of PCR. DNA fragments thus generated are either cloned (RDA) or labeled and spotted on the Agilent Array. Using this technology, that can potentially interrogate up to 17K promoters, we have identified 932 promoters targets of aberrant DNA methylation in poor risk ALL from patients that cannot be currently identified by standard molecular methods (Ph and MLL negative). The genes associated with these promoters are distributed through the human genome but an overrepresentation of methylated promoters located in chromosomes 3, 9, 11 and 19 was detected. Using molecular pathway clustering analysis, 404 of these genes are grouped together in 29 specific functional pathways. We have validated the methylation of 31 of these 923 genes by bisulfite pyrosequencing. Of these, 27 (87%) were confirmed to be hypermethylated in 23 human leukemia cell lines but not in normal controls (N=15). Methylation status analysis of these 27 genes allowed for the segregation of T cell versus B cell leukemia cell lines. Fifteen of these genes (GIPC2, RSPO1, MAGI1, CAST1, ADCY5, HSPA4L, OCLN, EFNA5, MSX2, GFPT2, GNA14, SALL1, MYO5B, ZNF382 and MN1) were also frequently hypermethylated in primary ALL samples. Expression analysis of 6 of these genes (GIPC2, MAGI1, ADCY5, HSPA4L, OCLN and GNA14) in leukemia cell lines further confirmed methylation associated gene silencing. Treatment of methylated/silenced cell lines with 5′-aza-2′-deoxycytidine and trichostatin A resulted in gene re-expression, further confirming the role of DNA methylation in their silencing. In summary, we have identified in excess of 900 targets of aberrant DNA methylation in ALL. The study of the epigenetically suppressed pathways represented by these genes should allow us to further understand the molecular pathogenesis of ALL and develop new prognostic biomarkers for patients with Ph and MLL negative disease.

Aberrant DNA methylation of multiple promoter associated CpG islands is a very prevalent phenomenon in human leukemias. Data from our laboratory indicates that methylation profiling allows the identification of leukemia patients with different risk and prognosis. Despite the advances in the understanding of the molecular biology of CLL, few studies of DNA methylation have been performed in CLL. In the current study, we have developed a new assay combining MCA (Methylated CpG island Amplification) with the Agilent promoter CpG array to identify simultaneously hundreds of abnormally methylated CpG islands in CLL. To perform this, we compared DNA from two CLL patients with 17p del (tester) with that of CD19+ B cells from two age-matched controls (driver). We identified 280 promoter CpG islands differentially methylated in CLL compared to normal controls. Most of these genes are located on chromosomes 19 (16%), 16 (11%), 17 (10%) and 11 (9%). We also performed interaction pathway and functional analysis of these 280 genes using the online Ingenuity Pathway Analysis tools. The initial analysis divided these genes into 25 functional networks, with the majority of genes fall into top 10 networks. The major functions of genes in these interaction networks involve cancer, organ development, cell death, drug metabolism, DNA replication and repair. We validated 22 of these genes (ADCY5, R-spondin1, LHX1, GALGT2, TFAP2C, ING1, SOX11, SOX14, SALL1, LTBP2, APP, DXL1, DLX4, KLK10, BCL11B, NR2F2, FAM62T, HAND2, BNC1, SPOCK, Prima1 and MLL1) in samples from 78 CLL patients and 10 age-matched normal controls. The characteristics of the 78 patients are: median age 59 (range 39–79), male 70%, Rai stage 0–II/III–IV (83%/17%), IgVH unmutated 49%, ZAP-70 positive 33%. Our results indicate that most of the genes identified by the array are frequently hypermethylated in CLL patients compared with healthy controls. Methylation frequency ranged from 20%–100% in CLL patients. Expression analysis of four selected genes (LHX1, GALGT2, TFAP2C and Prima1) in human leukemia cell lines and CLL patient samples by real-time PCR further confirmed methylation associated gene silencing, and treatment of these cell lines with hypomethylating agent 5-aza-2′-deoxycitidine with or without the HDAC inhibitor Trichostatin A resulted in gene re-expression and induction of DNA hypomethylation. We also analyzed the association of methylation status of these genes with IgVH mutation status, ZAP70 expression and patient survival. Unmutated IgVH was associated with increased methylation levels of LINE (p20%) was associated with increased methylation levels of LINE (p

p57KIP2 is a cyclin-dependent kinase inhibitor with a role in the regulation of cell cycle progression, proliferation, differentiation, and development. Disruption any of these biological processes could result in malignant transformation. We have previously reported that epigenetic inactivation of p57KIP2 by aberrant DNA methylation is associated with a worse prognosis in patients with adult acute lymphocytic leukemia (Blood2003;101:4131–6 and JCO2005;23:3932–9). To further study the role of p57KIP2 in human leukemia we have developed several knock-in and knock-down cellular models of p57KIP2 in human leukemia cell lines. First, we established the methylation/expression patterns of p57KIP2 in 21 leukemia cell lines of both myeloid and lymphoid origin and of different phenotypes. We found that p57KIP2 was methylated and silenced in all except 6 (28%) cell lines. Methylation of the p57KIP2 promoter region correlated with gene silencing, and lack of protein expression, and treatment of methylated/silenced cell lines with a 5-aza-2′-deoxycytidine (DAC), a demethylating agent, resulted in p57KIP2 gene and protein re-expression. In unmethylated p57KIP2 cell lines, p57KIP2 mRNA was rapidly up-regulated by stimulation by growth-inhibitory signals such as TNF alpha, LPS and TGF beta, and when cell-cycle progression was arrested. In contrast, treatment with dexamethasone, DAC or the histone deacetylase inhibitor SAHA did not have such an effect. The reverse was observed in methylated cell lines. Transient transfection of p57KIP2 in silenced cell lines resulted in cell-cycle arrest at the G0/G1 phase. Stable transfection of p57KIP2 using a lentivirus system in Raji cells, in which p57kip2 is methylated and silenced, resulted in the induction of apoptosis and the suppression of cell growth in soft agar. Stable transfection of p57KIP2 in Jurkat cells, in which p57KIP2 is unmethylated and expressed, resulted in partial inhibition of cell growth, and increased susceptibility to the induction of apoptosis by staurosporine. Knock-down of p57KIP2 using an shRNA lentivirus in K562 cells, in which p57kip2 is not methylated and is expressed, promoted cell growth and proliferation in soft agar. These studies provide evidence that p57KIP2 has the properties of a bona fide tumor suppressor gene in human leukemia and provide further weight to the notion that p57KIP2 has an important role in human leukomogenesis.