Search

In this study, three pairs of pseudotetrahedral C2-symmetrical bis[(S or R)-N-1-(phenyl)ethyl-(2,4-X1,X2-salicylaldiminato-κ2N,O)]-Δ/Λ-nickel(II), Δ/Λ-NiSL1–3 or Λ/Δ-NiRL1–3 (X1, X2 = Cl, Cl; Br, Br; Cl, Br) with Δ- or Λ-chirality induction at-metal were synthesized, respectively. X-ray molecular structures showed the formation of a N2O2-chromophore around nickel(II) from two molecules of Schiff bases in a pseudotetrahedral geometry. The structural analysis further suggested the isolation of opposite configured Δ-Ni and Λ-Ni diastereomers for S- and R-HL1–3 Schiff base ligands in an enantiopure crystal, resulting from diastereoselection and chirality induction at-metal. The gas-phase optimized structures for Δ-NiSL1–3 or Λ-NiRL1–3 are also slightly more stable by 0.10–1.70 kcal mol−1. Electronic circular dichroism (ECD) spectra showed expected mirror-image relationships with opposite Cotton effects, confirming the enantiopurity or enantiomeric excess of NiRL1–3 and NiSL1–3 complexes in solutions. Combined analyses of experimental and simulated ECD spectra suggested diastereomeric excess of Δ-NiSL1–3 or Λ-NiRL1–3 in solutions, demonstrating the preservation of chirality induction at-metal alike in solid or gas phases. The analysis of supramolecular packing explored several kinds of intermolecular interactions with the strongest one for halogen⋯oxygen atoms and only halogen at the para-position of salicylaldehyde is involved in these interactions with Br⋯O > Cl⋯O. Hirshfeld surface analysis also supported such kind of interactions at a distance shorter than the sum of the van der Waals radii. The non-covalent interaction (NCI) indices explored the presence of weak attractive interactions resulting from the halogen atoms of the respective structures. The experimental and simulated PXRD patterns revealed a fair matching, confirming the phase purity of bulk crystal samples of these complexes. [ABSTRACT FROM AUTHOR]

Reactions of enantiopure (S or R)-N-1-(phenyl)ethyl-2,4-X1,X2-salicylaldimine (S-H or R-H; X1, X2 = dihalogen) with Zn(II)-nitrate give bis[(S or R)-N-1-(phenyl)ethyl-2,4-X1,X2-salicylaldiminato-κ2N,O]-zinc(II), (Δ-ZnS or Λ-ZnR) with Δ/Λ-chirality induction at-metal in the C2-symmetric molecules. EI-mass spectra show parent ion peaks. X-ray structures indicate that two phenolate-oxygen and two imine-nitrogen atoms from two molecules of the Schiff bases coordinate to the Zn(II) ion in a pseudotetrahedral geometry. Structural analyses give evidence that the S- or R-ligand chirality gives only one diastereomer Δ-ZnS or Λ-ZnR in an enantiopure crystal. Gas-phase optimized structures suggest that the Δ-ZnS or Λ-ZnR diastereomers are slightly more stable than Λ-ZnS or Δ-ZnR by 1–2 kcal mol−1. The intramolecular interactions were analyzed with the Independent Gradient Model (IGM) using the program Multiwfn on the optimized structures and also indicate the diastereomeric preference of Δ-ZnS1 over Λ-ZnS1 (or Λ-ZnR1 over Δ-ZnR1). Variable time and temperature 1H NMR spectra support the presence of only one diastereomer Λ-ZnR or Δ-ZnS in the bulk samples, backed by the simulated spectra which exhibit no diastereomerization in solution. In contrast, the reported Zn(II)-(R or S)-salicylaldiminato/naphthaldiminato complexes show a diastereomeric mixture of both Δ- and Λ-forms and a Δ Λ equilibrium in solution. Electronic circular dichroism (ECD) spectra in solution display expected mirror-image relationships for the (S or R)-Schiff base ligands and the (S or R)-ligated complexes. Combined analyses of experimental and simulated ECD spectra further support the notion of diastereomeric excess of Δ-ZnS or Λ-ZnR in solution. The overall results thus suggest the preservation of chirality at-zinc induced by S- or R-ligands in a solid or solution. Supramolecular packing analyses explore different kinds of intermolecular interactions with the strongest one for X⋯O. Only the halogen atom in the para position is involved in these interactions with Br⋯O > Cl⋯O. Hirshfeld surface analyses also support these interactions between two molecules at a distance shorter than the sum of the vdW radii. Comparison of the experimental and simulated PXRD patterns from the single-crystal X-ray structures shows a good matching and confirms the phase purity of the bulk samples. [ABSTRACT FROM AUTHOR]

Due to the role of DNA methylation in causing cancer in the present study, an innovative and inexpensive method was designed for the sensitive detection of DNA methylation. The silver‐graphene quantum dots (Ag/GQDs) nano ink with high electrical conductivity was used as a substrate for genosensor fabrication toward identification of DNA hybridization. Also, poly (β‐cyclodextrin) (p[β‐CD]) has been used as a biointerface for the stabilization of Ag/GQD nano ink. The thiolated pDNA strand (5′‐SH‐TCCGCTTCCCGACCCGCACTCCGC‐3′) (as bioreceptor element) was fixed on the substrate and hybridized with methylated (5′‐GC(M)GGAGTGC(M)GGGTC(M)GGGAAGC(M)GGA‐3′) and unmethylated (5′‐GCGGAGTGCGGGTCGGGAAGCGGA‐3′) cDNAs, as target sequences were studied using electroanalysis methods. Under optimal conditions and using electrochemical techniques, the linear range was 1 am to 1 pm with LLOQ of 1aM. Finally, the designed DNA genosensor was used for detection of DNA methylation in human plasma samples and can be used to detect methylation in patient samples. It is expected that the designed DNA‐based biodevice will be used to early stage diagnosis of cancer using monitoring of DNA methylation. Also, this type of genosensor can be used for epigenetic studies in the near future. [ABSTRACT FROM AUTHOR]

In this study, a novel, low‐cost, and flexible paper‐based electrochemical immunosensor was developed for the bioanalysis of Cyfra 21.1 biomarker in human saliva samples by using stabilization of synthesis Ag nano‐ink on the surface of paper using pen‐on‐paper technology. The employed electrochemical techniques for the evaluation of immunoplatform performance were differential pulse voltammetry and chronoamperometry. Also, the prepared immunosensor showed great ability in the determination of Cyfra21.1 in human saliva specimens. Under the optimized conditions, the obtained linear range was from 0.0025 to 10 ng/mL, and the obtained LLOQ was 0.0025 ng/mL. The developed immunosensor is easy to prepare, sensitive, cost‐effective, portable, and simple. So proposed immunoplatform can be an accomplished biodevice in clinical laboratories. The proposed paper‐based immunosensor could be a hopefully new and cheap tool for the diagnosis of other biomarkers. Also, the prepared immunosensor showed great ability in the determination of Cyfra21.1 biomarker in human saliva specimens. [ABSTRACT FROM AUTHOR]

Monitoring of herbicides and pesticides in water, food, and the environment is essential for human health, and this requires low‐cost, portable devices for widespread deployment of this technology. For the first time, a wearable glove‐based electrochemical sensor based on conductive Ag nano‐ink was developed for the on‐site monitoring of trifluralin residue on the surface of various substrates. Three electrode system with optimal thicknesses was designed directly on the finger surface of a rubber glove. Then, fabricated electrochemical sensor used for the direct detection of trifluralin in the range of 0.01 μM to 1 mM on the surface of tomato and mulberry leaves using square wave voltammetry (SWV) and difference pulse voltammetry technique. The obtained LLOQ was 0.01 μM, which indicates the suitable sensitivity of this sensor. On the other hand, this sensor is portable, easy to use, and has a high environmental capability that can be effective in detecting other chemical threats in the soil and water environment. [ABSTRACT FROM AUTHOR]

In this study, a flexible glove‐based electrochemical sensor as a wearable point‐of‐use screening tool has been fabricated for defense and food security applications. To design the wearable glove‐based sensor, we drew conductive patterns on the fingers of a rubber glove via gold@silver‐modified graphene quantum dots (Au@Ag core‐shell/graphene quantum dots [GQDs]) nano‐ink with optimal thickness. Then, this platform is combined with a portable electrochemical analyzer for on‐site detection of trifluralin pesticide in the range of 10 nM to 1 mM with the low limit of quantification (LLOQ) of 10 nM. The high efficiency and distinction of the trifluralin at specified concentrations in real leaf and apple samples were performed by simply touching with the glove and in spikes solution by immersing of fingertips. With their high sensitivity, selectivity, rapid, and easy operation pesticide analysis, these glove‐embedded sensors can also be engaged in on‐site monitor of other chemical threats and can be expanded to water and environmental samples. [ABSTRACT FROM AUTHOR]

miRNAs are attractive factors in cancer research studies due to their important roles for regulating of gene expression. Because of miRNA‐21 expression surplus in many types of cancers, so accurate identification is important. Increasing efforts have caused different methods to improve the sensitivity and specificity of detection. Present study is an attempt to report a new electrochemical label‐free PNA‐based bioassay for detection of miRNA‐21. In this study, gold electrode was modified by gold nanoparticles to improve a functional PNA‐based biosensor. The EDS and field emission scanning electron microscope (FE‐SEM) were used to detect fabrication of biosensor. The electrochemical behavior of sensor was evaluated after inserting of acpcPNA probes and miRNA‐21 on the stucture of electrode and analyzed essential parameters such as various concentration of target miRNA, hybridization time, reproducibility, stability, and applicability. The results of study demonstrated that engineered biosensor was successfully fabricated. The findings showed the highest amount of current in 5 minutes hybridization time, with suitable reproducibility and stability. This innovative miRNA‐based biosensor presents a sensitive and specific method in fast and may be lab‐on chip assay in future. [ABSTRACT FROM AUTHOR]

Haemophilus Influenza leads to respiratory infections such as sinusitis, acute otitis media, pneumonia and bronchitis. In addition, it causes invasive infections such as cellulite, septic arthritis, and meningitis. Therefore, quick and sensitive detection of H. influenza is of great importance in medical microbiology. In this study, a novel DNA-based bioassay was developed to the monitoring of Haemophilus influenza genome in human plasma samples using binding of pDNA with cDNA. DNA hybridization strategy was used to investigation of DNAs binding. For this purpose, silver nanoparticle doped graphene quantum dots inks functionalized by D-penicillamine (Ag NPs-DPA-GQDs) were synthesized and deposited on the surface of glass carbon electrode (GCE). Also, gold nanoparticles functionalized with cysteamine (CysA-AuNPs) were deposited on the surface of the Ag-DPA-GQDs modified GCE. Afterward, thiolated DNA probe was immobilized on the surface of the modified electrode. DNA hybridization was monitored using square wave voltammetry (SWV) technique. Engineered genosensor indicated good performance with high specificity and sensitivity for detection of Haemophilus influenza genome. Under optimal conditions, linear range and low limit of quantitation (LLOQ) were obtained as target concentrations ranging from 1 pM–1 ZM and 1 ZM, respectively. The designed biosensor also showed high capability of discriminating one-base, two-base and three-base mismatched sequences. Also, the prepared genosensor could be easily regenerated and reused to evaluate hybridization process. Unlabelled Image [ABSTRACT FROM AUTHOR]

Ovarian cancer is the first and most important cause of malignancy death in women. Mucin 16 or MUC16 protein also known as carcinoma antigen 125 (CA 125) is the most commonly used glycoprotein for early stage diagnosis of ovarian cancer. In this work, a novel paper-based bio-device through hand writing of Ag/RGO (silver nanoparticles/reduced graphene oxide) nano-ink on the flexible paper substrate using pen-on-paper technology was developed. The prepared interface was used to the recognition of CA 125 protein in human biofluid. For this purpose, Ag/rGO nano-ink was synthesized by deposition of Ag nanoparticles onto graphene oxide sheets and the reduction of graphene oxide to rGO simultaneously. Conductivity and resistance of conductive lines were studied after drawing on photographic paper. Subsequently, to prepare a new and unique immuno-device, paper electrode modified by cysteamine caped gold nanoparticles (CysA/Au NPs) using electrochemical techniques. CysA is bonded by sulfur atoms with Au (CysA/Au NPs), and from the amine group with hydroxyl and carboxyl groups of Ag/RGO nano-ink deposited on the surface of paper-based electrodes (CysA/Au NPs/Ag-rGO). Then, anti-CA 125 antibody was immobilized on the electrode surface through Au NPs and CA 125 positively charged amine groups interaction. Atomic force microscopy, Transmission electron microscopy, Field emission scanning electron microscopy, and dynamic light scattering, were performed to identify the engineered immunosensor. Using chronoamperometry technique and under the optimized conditions, the low limit of quantitation (LLOQ) for the proposed immunoassay was recorded as 0.78 U/ml, which this evaluation was performed at highly linear range of 0.78–400 U/ml. The high sensitivity of the electrochemical immunosensor device is indicative of the ability of this immuno-device to detect early stages ovarian cancer. Unlabelled Image [ABSTRACT FROM AUTHOR]

Early stage diagnosis of breast cancer by monitoring the proteins in human biological fluids is the best method and the first section toward efficient therapy, delaying metastasis and hindrance mortality. In this study, graphite ink was synthesized and combined with CA 15-3 antibody in order to develop a novel immunosensor for detection of CA 15-3, breast cancer biomarker. Conductivity of bioink was examined by designing various conductive patterns on paper using a rollerball pen. Electrochemical behavior of engineered immunosensor was evaluated through employing sensitive diagnostic technique, DPV (differential pulse voltammetry). Under optimal conditions, the linear concentration range and low limit of quantification (LLOQ) of designed immunosensor was 15–250 U/mL and 15 U/mL, respectively. The process was successfully applied to assay of breast cancer biomarker (CA15-3) in unprocessed human plasma specimens. Unlabelled Image [ABSTRACT FROM AUTHOR]

The analogs of DNA are unique biomedical tools that are broadly utilized to develop different types of biosensors. Peptide nucleic acids (PNA) are an individual and notable class of nucleic acid analogs due to their unique, novel physicochemical and biochemical characteristics, stability and resistance to nuclease and protease enzymes, significant interactions with complementary strands and remarkable hybridization attributes. Therefore, they are employed in the preparation and fabrication of various types of functional biosensors. In other words, immobilization of PNA as an appropriate diagnostic probe on the surface of electrochemical and optical converters lead to the fabrication of PNA-based biosensors which could be applied for sensitive and selective determination of diverse analytes. In this article, we are purposed to demonstrate an overview of physicochemical and biochemical features, modifications of peptide nucleic acid backbone and its usages as a bio-receptor in the PNA-based biosensors in recognition of viruses, RNA, bacteria, DNA, SNP (single-nucleotide polymorphism) and etc. Application of Peptide Nucleic Acid as bioreceptor in biosensors development. Image 1 • Physicochemical and biochemical characteristics of peptide nucleic acid was explained. • The plus points of PNA over DNA-based biosensors were described. • Application of PNA in different biosensors such as electrochemical, optical, and microarrays was explained. • PNA as a bio-receptor in biosensors was utilized for viruses, RNA, bacteria, DNA, SNP, point mutations detection. [ABSTRACT FROM AUTHOR]

Abstract An enzyme conductive ink was synthesized and applied for the sensitive detection of l -proline in human biofluids. The nano-ink is a mixture of materials graphite (Gr), intermediates Methylene blue (MB), binding agents (Polyethylene glycol and chitosan), and Proline dehydrogenase (PRODH). The morphology of enzymatic ink composition was evaluated by using high-resolution field emission scanning electron microscope (FE-SEM). The results showed that the particle size of the proposed ink was below 100 nm. For electrochemical testing, the ink was fixed on the surface of copper electrode through utilization drop-casting technique via strong bonding between PEG and surface. The modified electrode was used as an electrochemical biosensor for the determination of l -proline in the alkaline solution. In optimal conditions, the concentration range and low limit of quantification (LLOQ) were 56 μM–1 mM and 56 μM, respectively. Graphical abstract Unlabelled Image Highlights • A novel enzyme conductive ink was synthesized based on graphite (Gr), Methylene blue (MB), Polyethylene glycol and chitosan, and proline dehydrogenase (PRODH). • Graphite leads to conductivity in the synthesized ink, Methylene blue acts as an electron transfer interface and improves the electrochemical detection of L-proline. • The "do-it-yourself" renewable proline sensor strips offer a "fresh," reproducible, low-cost biocatalytic sensor surface for each blood test. [ABSTRACT FROM AUTHOR]

[Display omitted] • The important protein kinases (PKs) in primary immunodeficiency disorders are presented. • Most recently developed biosensors for the detection of PKs are considered. • Various biosensors to distinguish different PKs were categorized. • Challenges of using biosensing for diagnosis of protein kinase-related disorders such as primary immunodeficiencies are proposed. Protein kinases act as a trigger for regulating a wide range of cellular processes including development, survival, apoptosis, control of metabolism, transcription signals, and beyond. These molecules play a vital role in the appropriate regulation of immune responses. Of note, different primary immunodeficiency disorders (PIDs) have been linked to protein kinase defects. Therefore, monitoring and inhibiting kinase activity are of particular importance in medical diagnosis and drug discovery. There are various methods for the detection of kinases that biosensors have attracted a lot of attention due to their unique features such as low cost, fast, and on-site detection. In this review, we discuss the critical role of various types of electrochemical, optical, photoelectrochemical, and electrochemiluminescence biosensors developed for the accurate detection of protein kinases. This review offers biosensing technology for fast and real-time identification of immunodeficiency disorders related to protein kinases will be possible. We briefly refer to the important protein kinases involved in the PID conditions to emphasize their pivotal roles, while (bio)sensors designed for them have not been regarded compared to the other protein kinases already detected by the different biosensors until now. It is anticipated that a promising future will happen for the detection of related functional anomalies by biosensors. [ABSTRACT FROM AUTHOR]

• Nano-colloid of AgNPr-GQDs was synthesised using a new two step procedure in aqueous solution. • A low cost and portable diagnostic tool (Nano-colloid of AgNPr-GQDs) towards analysis of feed additive was proposed. • Analytical validation of a novel flexible biosensor towards ractopamine monitoring in food samples was investigated. Due to the costly and time-consuming traditional techniques, providing a low-cost, portability and flexibility diagnostic tool with the ability to monitor and detect various animal feed additive is highly demanded. Over the years, paper-based biosensors have emerged as point of care (POC) diagnostic, easy-to-use and miniaturized tools. However, they have been suffered from low sensitivity. Aptamer as appropriate bioreceptor can overcome the most common disadvantage of paper based sensor by increasing selectivity and sensitivity. In this study, a novel paper-based electrochemical aptasensor was successfully developed to detection of ractopamine (RAC). RAC concentration was evaluated using a designed three-electrode paper based biodevice system. Under the optimal experimental conditions, the engineered aptasensor provided good sensitivity and selectivity for the detection of RAC. Using proposed flexible sensor RAC was determined in the range of 0.001 µM to 100 mM which the lower limit of quantitation (LLOQ) was obtained as 0.01 µM. Finally, aptasensor was used to the monitoring of RAC in untreated human plasma specimens which LLOQ and linear range were 0.01 µM and 0.01 µM to 10 mM, respectively. We hope that the exploitation of aptamer in electrochemical paper based sensor will be able to broaden our understanding for developing the application of low-cost and portable biodevices for the sensitive and selective paper-based sensor to identify other chemical and biological compounds. [ABSTRACT FROM AUTHOR]

[Display omitted] • Cu(II) and Pt(II) complexes were obtained of asymmetric tridentate NN'O ligands. • Complexes were synthesized in order to better understand the effect of structure, halogen substitution, metal ions and ligand flexibility on antiproliferative activity. • The composition and structure of the complexes were confirmed with several techniques: NMR and FT-IR spectroscopies, elemental analyses, X-ray crystallography and theoretical calculations. • All complexes induced moderate to high reduction in A2780 and HCT116 cancer cell viability. • Complex with higher cytotoxicity, I 2 -H 2 L 2 -Cu, was investigated to gain further information insights on the biological mechanisms. In order to better understand the effect of structure, halogen substitution, metal ions and ligand flexibility on antiproliferative activity, eight Cu(II) complexes and eight Pt(II) complexes were obtained of 2,4-X 1 ,X 2 -6-((pyridine-2-ylmethylamino)methyl)phenol and 2,4-X 1 ,X 2 -6-((pyridine-2-ylmethylamino)ethyl)phenol (where X is Cl, Br, or I) ligands. The compounds were characterized with various techniques, such as FT-IR, NMR, elemental analysis and single-crystal X-ray diffraction (SCXRD). The X-ray structures showed that ligand acts as a bidentate and tridentate donor in Cu(II) and Pt(II) complexes, respectively. This difference in structures is due to the use or non-use of base in the preparation of complexes. Also, complexation of Cl 2 - H 2 L 1 with CuCl 2 ·2H 2 O gives two different types of structures: polymer (Cl 2 -H 2 L 1 -Cupolymer) and dimer (Cl 2 -H 2 L 1 -Cudimer), according to the crystal color. In addition, 1H NMR spectrum for platinum complexes display two set of signals that can be attributed to the presence of two isomers in solution. All complexes induced moderate to high reduction in A2780 and HCT116 cancer cell viability. However, only complexes bearing iodo- substituted in ligands exhibited significantly low cytotoxicity in normal fibroblasts when compared with cancer cell lines. The antiproliferative effect exhibited by I 2 -H 2 L 2 -Cu complex in A2780 cell line was due to induction of cell death mechanisms, namely by apoptosis and autophagy. I 2 -H 2 L 2 -Cu complex does not cause DNA cleavage but a slight delay in cell cycle was observed for the first 24 h of exposition. High cytotoxicity was related with the induction of intracellular ROS. This increase in intracellular ROS was not accompanied by destabilization of the mitochondrial membrane which is an indication that ROS are being triggered externally by I 2 -H 2 L 2 -Cu complex and in agreement with an extrinsic apoptosis activation. I 2 -H 2 L 2 -Cu complex has a pro-angiogenic effect, increasing the vascularization of the CAM in chicken embryos. This is also a very important characteristic in cancer treatment since the increased vascularization in tumors might facilitate the delivery of therapeutic drugs. Taken together, these results support the potential therapeutic of the I 2 -H 2 L 2 -Cu complex. [ABSTRACT FROM AUTHOR]

[Display omitted] The reaction of potentially N,N,O-tridentate Schiff base ligands, Cl-LH, Br-LH, BrCl-LH and H-LH, with [VIVO(acac) 2 ] in 2:1 ratio in methanol gave the corresponding mononuclear and dinuclear oxidovanadium(IV) complexes, VO(Cl-L) 2 (1), VO(Br-L) 2 (2), [(BrCl-L) 2 (H 2 O)V(μ-O)VO(BrCl-L) 2 ] (3) and [(H-L) 2 (H 2 O)V(μ -O)VO(H-L) 2 ] (4), in good yields. The ligands and complexes were fully characterized by elemental analysis and FT-IR spectroscopy. The ligands were also characterized by 1H NMR spectroscopy. The oxidation state of V(IV)O with d1 configuration in all synthesized complexes was confirmed by EPR. Moreover, the structures of 2 and 3 were determined by X-ray diffraction (XRD) analysis which revealed them as mono- and dinuclear vanadium(IV) complexes, respectively, with the ligands coordinated as bidentate chelates. The structure of 3 represents the first example of dinuclear V(IV) complex with O → VIV = O → VIV = O core (Cambridge Structural Database (CSD)​, version 5.42, update of May 2021). The cytotoxicity of ligands and complexes was evaluated towards ovarian (A2780), breast (MCF7) and prostate (PC3) cancer cells at 48 h. While ligands showed modest IC 50 values (>42 μM), all complexes turned out to be effective in the range 3.9–17.2 μM. In particular, A2780 and MCF7 cell lines were the most sensitive to the newly synthesized V(IV)O complexes. [ABSTRACT FROM AUTHOR]

[Display omitted] • A novel genosensing for the sensing of H. influenzae was introduced. • Flexible and portablebiodevice towards identification of H. influenzae were fabricated. • Biomedical analysis of H. influenzae in human biofluids were investigated. Nowadays, different respiratory infections of Haemophilus Influenzae (H. influenzae) such as bronchitis, pneumonia, acute otitis media and sinusitis reveals the high demand for developing efficient, rapid and low-cost sensing platforms. In this concept, pDNA and cDNA were exploited in electrochemical biosensors for monitoring H. influenzae. Accordingly, the Ag ink and Au@Ag core–shell/GQDs nano-ink were synthesized and drawn on the surface of photographic paper for designing a three-electrode paper-based biodevice. The selectivity of the designed platform was evaluated by three mismatched. Under the optimal experimental conditions, due to the high affinity of cDNA toward pDNA, the fabricated electrochemical bioassay provided good selectivity and sensitivity for the monitoring of H. influenzae. The developed flexible sensor could detect cDNA with linear range and LLOQ (lower limit of quantitation) 100 ZM to 0.1 pM and 100 ZM, respectively. The main advantages of this paper-based DNA bio-electrochemical sensor include acceptable sensitivity, selectivity, easy and fast operation to clinical analysis and biomedicine. [ABSTRACT FROM AUTHOR]

Hyperbranched polymers (HBPs), as a subclass of dendrimers, have attracted the interest of polymer technologists and scientists around the world. These structures have special adjustable traits, unusual architectures, asymmetric random branches, and wide applications. Compared to dendrimers, branched polymers are easy to synthesize. The one-pot synthesis technique makes the scale-up production of these polymers possible and economically acceptable. In addition, the presence of modifiable functional groups in HBPs, biocompatibility, and biodegradability have made them a viable option in the field of biomedicine. Therefore, HBPs with three-dimensional structures are promising compounds in biomedicine. In this review, a summary of synthesis methods and traits of branched polymers as well as their applications in various biomedical fields including disease diagnosis, tissue engineering, drug/gene delivery, biomedical analysis, immuno/pharmacotherapy, biosensing, and transmission systems are investigated. Also, some of the challenges in biocompatibility and toxicity of HBPs are discussed. [Display omitted] • HBPs provide perfect properties for biomedical applications. • Recent improvements on the monitoring of biomarkers, bioimaging, drug delivery, immunodiagnosis and etc, using HBPs were refereed. • Some of challenges in biocompatibility and toxicity of HBPs were discussed. [ABSTRACT FROM AUTHOR]

• Cit-AgNPs was employed for bioconjugation with pDNA toward target sequences detection. • Synthesized probe of H. influenza was detected by hybridization with cDNA. • Haemophilus influenza was detected in low limit of quantification (LLOQ) = 1 ZM. A sensitive and specific approach was developed for the determination of Haemophilus influenza using DNA based bio-assay. In this study, citrate capped silver nanoparticle was synthesized and employed for bioconjugation with pDNA toward target sequences detection. In this study, synthesized probe (SH-5′-AAT TTT CCA ACT TTT TCA CCT GCA T-3') of Haemophilus influenza was detected with great sensitivity and selectivity after hybridization with cDNA (5′-ATG CAG GTG AAA AAG TTG GAA AAT T-3'). Regarding to the obtained results, the low limit of quantification (LLOQ) of DNA sample was 1 ZM using 15 μL of probe and 200 μL of Cit/AgNPs. According to ultra-sensitivity of the fabricated optical DNA-based bio-assay, it has potential for bacterial determination both in clinical and environmental specimens. To evaluate the selectivity of developed DNA based biosensor, three mismatch sequences were applied. Finally, the designed genosensor is a significant diagnostic strategy for detection of Haemophilus influenza with great selectivity. [ABSTRACT FROM AUTHOR]

The rapid and sensitive determination of riboflavin (RF) is important for the treatment of seborrheic and glossitis dermatitis, sunlight sensitivity, mucosal, and skin disorders. In this work, an electrochemical sensor was developed by electrodes modification using poly (chitosan) to sensitive detection of RF in commercial multivitamin. Electrodeposition of chitosan on the surface of glass carbon electrode was performed using cyclic voltammetry technique in the range of −1 to +1 V. The modified electrode surface morphology was characterized using a high‐resolution field emission scanning electron microscope. The modified electrode was used as an effective electrical interface for the detection of RF using cyclic, differential pulse, and square wave voltammetry techniques. Finally, the sensor was applied to determine RF in commercial multivitamins. In optimum conditions, the linear range for the standard sample of RF and commercial multivitamins 94 to 333μM and 24.6 to 176μM were obtained, respectively. Low limit of quantification (LLOQ) were obtained as 24.6μM. [ABSTRACT FROM AUTHOR]

Abstract In this work, a unique conductive nano-ink based on silver nanoparticle‑nitrogen doped graphene quantum dots (Ag/N-GQD) was synthesized and utilized for development of a novel, unique and sensitive biosensor for determination of alprazolam, chlordiazepoxide bis, diazepam, oxazepam and clonazepam. Electrochemical deposition, as a well-controlled synthesis procedure, has been utilized for subsequently layer-by-layer preparation of Ag/N-GQD nano-ink on a chitosan (CS) electropolymerized on the surface of gold electrode using cyclic voltammetry techniques in the regime of −1 to +1 V. The modified electrode appeared as an efficient electroactive interface for detection of selected benzodiazepines by using cyclic voltammetry, differential pulse voltammetry, and square wave voltammetry. The prepared sensor showed a noticeably good electro-activity for electrooxidation of alprazolam, chlordiazepoxide bis, diazepam, oxazepam and clonazepam than bare CS and Ag/N-GQD modified electrodes. Enhancement of peak currents is ascribed to the fast heterogeneous electron transfer kinetics that arise from the synergistic coupling between unique features of CS such as high permeability, excellent film-forming capability, good adhesion, cheapness, nontoxicity, and a susceptibility to chemical modifications, Ag/N-GQD nano-ink as high electrical conductivity. Finally, application of the new sensor for determination of selected benzodiazepine group drugs in unprocessed human plasma samples was studied. In general, the simultaneous attachment of Ag/N-GQD nano-ink to structure of CS provides new opportunities toward biomedical analysis and the personal healthcare. Highlights • A novel unique Ag/N-GQD nano-ink was synthesized and used for sensitive detection of benzodiazepines. • The method was applied to assay of benzodiazepine in unprocessed human plasma samples. • Advantages of the proposed sensor are cost-low, rapid sensing and being eco-friendly sensitive. [ABSTRACT FROM AUTHOR]

In this paper, free-radical polymerization inside magnetic mesoporous silica has been investigated in order to open a route to functional polymer-silica composite nanomaterials with well-defined mesoporosity. Proline monomers integrated with chitosan (CS) were electropolymerized into amino-functionalized magnetic mesoporous silica. The fabrication of polyproline-amino-functionalized magnetic mesoporous silica-CS nanohybrid on glassy carbon electrode (GCE) was performed using one step electrodeposition regime. Field emission scanning electron microscopy (FE-SEM) was confirmed as produced nanohybrid material containing polyproline (PPR) into the pores of magnetic (Fe3O mobile crystalline material-41 grafted with 3-aminopropyl groups (MMS) which leads to increase of surface coverage of PPR. The results indicate that PPR was successfully generated inside the pores of the amino-functionalized Mobil Composition of Matter No. 41 (nPrNH2-MCM-41) and that the amine group was capable of protonating the polymer, producing polyproline, the most conductive one, without the addition of another acid source during the polymerization step. Therefore, it was evaluated some electrochemical aspects of the prepared nanohybrid using cyclic voltammetry, differential pulse voltammetry and linear sweep voltammetry. Finally, the electroactivity of polyproline -Fe3O4-nPrNH2-MCM-41-chitosan nanohybrid (PPR-MMS-CS) modified GCE toward detection and determination of some clinically relevant small biomolecules was studied. [ABSTRACT FROM AUTHOR]

[Display omitted] • P(CS) modified by AgNPrs/GQDs-Cys A nano-ink was generated on the surface of GCE. • P(CS)-AgNPrs/GQDs-Cys A nano-ink was used as an advanced nano-interface for the efficient identification of micRNA-153 using electroanalysis regime. • P(CS)-AgNPrs/GQDs-Cys A nano-ink have well activity in quantification of micRNA-153 in human biofluids. Parkinson's disease (PD), as the world's second most common disabling age-related disease has caused motor and non-motor symptoms such as mental and behavioral changes, sleep problems, depression, memory difficulties. In recent years, several advantages of microRNAs (miRNAs), including resistance to RNAase digestion, stability, and extreme situations in circulating fluids, have led to received enormous attention for the detection of various diseases. miR-153 is one of the high potential related biomarkers of PDs which regulate α-Synuclein expression levels. Here, a sensitive and selective electrochemical biosensor was developed to recognize of miR-153 in human plasma samples. For the first time, the surface of the glassy carbon electrode (GCE) was decorated with poly-chitosan (CS) and silver nanoprisms/graphene quantum dots/ cysteamine A (AgNPrs/GQDs-Cys A) ink for the excellent immobilization of DNA towards sensitive and selective monitoring of micRNA-153. The designed novel electrochemical biosensor could detect miR-153 by differential pulse voltammetry with a linear range of 6.25 µM to 50 µM, which low limit of quantification is 6.25 µM. According to high selectivity, sensitivity, fast and easy operation this biodevice promising for clinical applications and high-throughput screening of PDs. [ABSTRACT FROM AUTHOR]

Haemophilus influenza (H. influenza) is a gram negative coccobacillus pathogenic microorganism. H. influenza produces beta-lactamases, and it is also able to modify its penicillin-binding proteins, so it has gained resistance to the penicillin family of antibiotics. In this work, a novel sensitive approach was established for the monitoring of H. influenza using DNA based bio-assay. For the first time, specific sequence of thiolated probe of Haemophilus influenza (SH-5′-AAT TTT CCA ACT TTT TCA CCT GCA T-3′) was immobilized on the surface of gold (Au) electrode. Square wave voltammetry (SWV) was carried out in toluidine blue (TB) solution for DNA hybridization and targeting of cDNA sequence of Haemophilus influenza. Field scanning electron microscope (FE-SEM) was applied to investigation of the electrode morphology and estimate of particle size. In the optimal conditions, the planned strategy could detect target DNA (5′-ATG CAG GTG AAA AAG TTG GAA AAT T-3′) down to 1 ZM with a linear range from 1 μM to 1 ZM. Moreover, engineered geno-assay selectively differentiates the complementary sequence from target sequences with one, double and three base mismatch sequences. Unlabelled Image [ABSTRACT FROM AUTHOR]

Legionella pneumophila is a causative agent of Pontiac fever and Legionaries' disease. L. pneumophila is a gram-negative, fastidious and hard to grow bacterium. Since severe growth of this pathogen, molecular diagnostics based on DNA can be very important. Mip gene is one of the strongest constructed in Legionella pneumophila that targeted in several molecular detection methods. Also, L. pneumophila is one of the threatening pathogens that has many challenges for its rapid and specific detection. This study is an attempt to identify Legionella pneumophila specific genes using a DNA-based bioassay. In this work, gold nanostructures supported by cysteamine (Cys A/AuNPs) were deposited on the surface of gold electrode to engineer an innovative DNA based biosensor. The Cys A/AuNPs interface provides a large surface area for the effective immobilization of ssDNA, as well as it ascertains the bioactivity and stability of immobilized of pDNA. Field emission scanning electron microscope (FE-SEM), and EDS photoelectron spectroscopies were used to monitor the sensor fabrication. Cyclic voltammetry (CV) and square wave voltammetry (SWV) were used for electrochemical characterization of DNA immobilization and hybridization by cDNA as complementary target sequence. Obtained results showed good sensitivity, selectivity and stability. Finally, target DNA was quantified at a linear range from 1 μM to 1 ZM and low limit of quantification (LLOQ) was 1 Zepto-molar. The results of this study indicate that nucleic acid based bioassay in the near future can be a good alternative to the detection of L. pneumophila. • Legionella pneumophila is a causative agent of Pontiac fever and Legionaries' disease. • Cys A/AuNPs was used a novel substrate for the immoblization of ssDNA and probing its hybridazation with cDNA. • Target DNA was quantified at a linear range from 1 μM to 1 ZM and low limit of quantification (LLOQ) was 1 Zepto-molar. [ABSTRACT FROM AUTHOR]

• A specific and sensitive approach was established for the detection of Acintobacter baumannii using DNA based bioassay. • Synthesized probe of Acinetobacter baumannii was detected in excelent selectivity and suitable sensitivity. • The low limit of quantification (LLOQ) of DNA sample was 1 fM. Acinetobacter baumannii is a non-motile, gram-negative member of the gamma proteobacteria. A specific and sensitive approach was established for the detection of Acintobacter baumannii via DNA based bio-assay. In this study, gold nano-star was synthesized and used for bio-conjugation with pDNA toward the detection of target sequences. Synthesized probe (5ʹ TTG TGA ACT ATT TAC GTC AGC ATG C3ʹ) of Acinetobacter baumannii was found with excellent sensitivity. After the hybridization of pDNA with cDNA, target DNA (5ʹ GCA TGC TGA CGT AAA TAG TTC ACA A 3ʹ) was easily measured. According to ultra-sensitivity of the engineered optical DNA-based bio-assay, it is potentially applied in the bacterial detection of the environmental and clinical specimens. Here, the selection of engineered biosensor in the presence of two mismatch sequences was investigated. The results indicated an acceptable choice for DNA-based assays. The low limit of quantification (LLOQ) of genosensor was obtained as 1 fM. The present study is a very important diagnostic examination to recognize Acinetobacter baumannii , which can be a best alternative to the traditional methods. [ABSTRACT FROM AUTHOR]

Chitosan (CS) as biocompatible and non-toxic polymer is derived from de-acetylation of chitin and consists of N -acetylglucosamine and glucosamine unites. The ability of CS to form solid deposits similar to hydrogels and the possibility of electrodeposition on the surface of the electrode as a thin film, makes it valuable for the preparation of micro-sensors and nano-biosensors. In this work, a novel method for the electrochemical branching of CS on the surface of glassy carbon was introduced. New modified copper electrodes were fabricated as electrochemical sensors for the determination of mefenamic acid and Indomethacin. Two types of modified copper electrodes; the first based on Cu nanocubes (NC) to identify mefenamic acid, and the other one based on chitosan modified by Cu NCs to detection of indomethacin. Electrochemical behavior and morphology of the copper nanocubes modified copper electrode CuNCs/CuE and chitosan modified copper nanocubics coated on copper electrode (CS-Cu NCs/CuE) were studied using differential pulse voltammetry (DPV) and cyclic voltammetry (CV). The results confirmed the presence of CS-Cu NCs/Cu NCs on the electrode surface. Also, using CV technique it has found that Cu NCs and PCS- Cu NCs led to increased oxidation peak current, by adsorption of indomethacin. However, the anodic peak current was increased by CuNCs for the mefenamic acid. There is a linear relationship between the anodic peak current and mefenamic acid/indomethacin concentration in the range of 1 nM to 10 mM, where the low limit of quantification (LLOQ) was 1 nM for the those drugs. Therefore, the prepared electrodes have many benefits such as high sensitivity, selectivity, and stability for the determination of mefenamic acid and indomethacin in human serums and pharmaceutical preparation. [ABSTRACT FROM AUTHOR]

• Legionella pneumophila is a causative agent of Pontiac fever and Legionaries' disease. • Cys-A/AuNPs modified Ag/GQDS nano-ink was used a novel substrate for the immobilization of ssDNA and probing its hybridization with cDNA. • Target DNA was quantified at a linear range from 1 µM to 1 ZM and low limit of quantification (LLOQ) was 1 Zepto-molar. Rapid screening of pathogenic microorganisms are widely demand in the last decade. According to fastidious and hard to grow nature, Legionella penumophila is important pathogen for bioassay and biomedical analysis. In this work a novel paper-based genoassay was developed for monitoring of L. penumophila. For the first time, silver-graphene quantum dots (Ag/GQDs) ink was synthesized and used for construction of new substrate for bioassay of L. penumophila. The prepared interface was modified by gold nanoparticles grafted by Cysteamine A (CysA/AuNPs) which is necessary for ssDNA immobilization and hybridization by cDNA. All of the genoassay fabrication steps were characterized by field emission scanning electron microscope (FE-SEM), Energy-dispersive X-ray spectroscopy (EDS), Atomic force microscopic (AFM) and also TEM (transmission electron microscopy). Using chronoamperometry technique, the measurement of target cDNA was performed successfully. Also, cDNA was determined in the linear rang of 1 µM to 1ZM which low limit of quantification was 1ZM. The results show that the designed bio-platform despite a simple structure with high sensitivity and specificity for the DNA based bioassay of L. penumophila genome. [ABSTRACT FROM AUTHOR]