Search

Reactive oxygen species (ROS) have been extensively studied as damaging agents associated with ageing and neurodegenerative conditions. Their role in the nervous system under non-pathological conditions has remained poorly understood. Working with the Drosophila larval locomotor network, we show that in neurons ROS act as obligate signals required for neuronal activity-dependent structural plasticity, of both pre- and postsynaptic terminals. ROS signaling is also necessary for maintaining evoked synaptic transmission at the neuromuscular junction, and for activity-regulated homeostatic adjustment of motor network output, as measured by larval crawling behavior. We identified the highly conserved Parkinson’s disease-linked protein DJ-1β as a redox sensor in neurons where it regulates structural plasticity, in part via modulation of the PTEN-PI3Kinase pathway. This study provides a new conceptual framework of neuronal ROS as second messengers required for neuronal plasticity and for network tuning, whose dysregulation in the ageing brain and under neurodegenerative conditions may contribute to synaptic dysfunction.

A two-step formal (4 + 1) annulation-dehydration reaction offers a convenient route to C2-arylated indoles and benzofurans. This reaction exploits the bifunctional reactivity of electron-deficient benzyl chlorides with N -sulfonyl-2-aminobenzaldehydes or salicylaldehyde derivatives. The reaction tolerates both electron-withdrawing and donating groups on the substituted aldehydes, as well as variation of electron-withdrawing groups at the para position of the benzyl chloride reagent. This work also identifies interesting byproducts resulting from the self-reaction of these benzyl chlorides under basic conditions.

A G4C2 hexanucleotide repeat expansion in C9orf72 is the most common cause of amyotrophic lateral sclerosis and frontotemporal dementia (C9ALS/FTD). Bidirectional transcription and subsequent repeat-associated non-AUG (RAN) translation of sense and antisense transcripts leads to the formation of five dipeptide repeat (DPR) proteins. These DPRs are toxic in a wide range of cell and animal models. Therefore, decreasing RAN-DPRs may be of therapeutic benefit in the context of C9ALS/FTD. In this study, we found that C9ALS/FTD patients have reduced expression of the AAA+ family members RuvBL1 and RuvBL2, which have both been implicated in aggregate clearance. We report that overexpression of RuvBL1, but to a greater extent RuvBL2, reduced C9orf72-associated DPRs in a range of in vitro systems including cell lines, primary neurons from the C9-500 transgenic mouse model, and patient-derived iPSC motor neurons. In vivo, we further demonstrated that RuvBL2 overexpression and consequent DPR reduction in our Drosophila model was sufficient to rescue a number of DPR-related motor phenotypes. Thus, modulating RuvBL levels to reduce DPRs may be of therapeutic potential in C9ALS/FTD., (© 2024 Webster et al.)

To achieve malaria eradication, new preventative agents that act differently to front-line treatment drugs are needed. To identify potential chemoprevention starting points we screened a sub-set of the CSIRO Australia Compound Collection for compounds with slow-action in vitro activity against Plasmodium falciparum. This work identified N,N-dialkyl-5-alkylsulfonyl-1,3,4-oxadiazol-2-amines as a new antiplasmodial chemotype (e.g., 1 96 h IC 50 550 nM; 3 96 h IC 50 160 nM) with a different action to delayed-death slow-action drugs. A series of analogues were synthesized from thiotetrazoles and carbomoyl derivatives using Huisgen 1,3,4-oxadiazole synthesis followed by oxidation of the resultant thioethers to target sulfones. Structure activity relationship analysis of analogues identified compounds with potent and selective in vitro activity against drug-sensitive and multi-drug resistant Plasmodium parasites (e.g., 31 and 32 96 h IC 50 <40 nM; SI > 2500). Subsequent studies in mice with compound 1, which had the best microsomal stability of the compounds assessed (T 1/2 >255 min), demonstrated rapid clearance and poor oral in vivo efficacy in a P. berghei murine malaria model. These data indicate that while N,N-dialkyl-5-alkylsulfonyl-1,3,4-oxadiazol-2-amines are a novel class of slow-acting antiplasmodial agents, the further development of this chemotype for malaria chemoprophylaxis will require pharmacokinetic profile improvements., Competing Interests: Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Katherine Andrews, Tina Skinner-Adams, Oliver Hutt, John Ryan, Andrew Riches reports financial support was provided by National Health and Medical Research Council of Australia. Anjana Rai reports financial support was provided by Griffith University GUIPRS and GUPRS PhD scholarships. Katherine Andrews reports equipment, drugs, or supplies was provided by Australian Red Cross Lifeblood. Katherine Andrews reports writing assistance was provided by Monash Institute of Pharmaceutical Sciences Centre for Drug Candidate Optimisation. Katherine Andrews reports equipment, drugs, or supplies was provided by Compounds Australia, Griffith University. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Giardia duodenalis is the causative agent of the neglected diarrhoeal disease giardiasis. While often self-limiting, giardiasis is ubiquitous and impacts hundreds of millions of people annually. It is also a common gastro-intestinal disease of domestic pets, wildlife, and livestock animals. However, despite this impact, there is no vaccine for Giardia currently available. In addition, treatment relies on chemotherapies that are associated with increasing failure rates. To identify new treatment options for giardiasis we recently screened the Compounds Australia Scaffold Library for new chemotypes with selective anti-Giardia activity, identifying three compounds with sub-μM activity and promising selectivity. Here we extended these studies by examining the anti-Giardia activity of series CL9569 compounds. This compound series was of interest given the promising activity (IC 50 1.2 μM) and selectivity demonstrated by representative compound, SN00798525 (1). Data from this work has identified an additional three thieno [3,2-b]pyrrole 5-carboxamides with anti-Giardia activity, including 2 which displayed potent cytocidal (IC 50  ≤ 10 nM) and selective activity against multiple Giardia strains, including representatives from both human-infecting assemblages and metronidazole resistant parasites. Preclinical studies in mice also demonstrated that 2 is well-tolerated, does not impact the normal gut microbiota and can reduce Giardia parasite burden in these animals., Competing Interests: Declarations of competing interest CJS Hart, AG Riches, JH Ryan, and TS Skinner-Adams, are inventors on a PCT application that covers small molecule compounds derived from the compounds discussed in this manuscript., (Copyright © 2023 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Background: Contraceptive choice is central to reproductive autonomy. The internet, including social networking sites like Reddit, is an important resource for people seeking contraceptive information and support. A subreddit dedicated to contraception, r/birthcontrol, provides a platform for people to post about contraception., Objective: This study explored the use of r/birthcontrol, from the inception of the subreddit through the end of 2020. We describe the web-based community, identify distinctive interests and themes based upon the textual content of posts, and explore the content of posts with the most user engagement (ie, "popular" posts)., Methods: Data were obtained from the PushShift Reddit application programming interface from the establishment of r/birthcontrol to the start date of analysis (July 21, 2011, to December 31, 2020). User interactions within the subreddit were analyzed to describe community use over time, specifically the commonality of use based on the volume of posts, the length of posts (character count), and the proportion of posts with any and each flair applied. "Popular" posts on r/birthcontrol were determined based on the number of comments and "scores," or upvotes minus downvotes; popular posts had 9 comments and a score of ≥3. Term Frequency-Inverse Document Frequency (TF-IDF) analyses were run on all posts with flairs applied, posts within each flair group, and popular posts within each flair group to characterize and compare the distinctive language used in each group., Results: There were 105,485 posts to r/birthcontrol during the study period, with the volume of posts increasing over time. Within the time frame for which flairs were available on r/birthcontrol (after February 4, 2016), users applied flairs to 78% (n=73,426) of posts. Most posts contained exclusively textual content (n=66,071, 96%), had comments (n=59,189, 86%), and had a score (n=66,071, 96%). Posts averaged 731 characters in length (median 555). "SideEffects!?" was the most frequently used flair overall (n=27,530, 40%), while "Experience" (n=719, 31%) and "SideEffects!?" (n=672, 29%) were most common among popular posts. TF-IDF analyses of all posts showed interest in contraceptive methods, menstrual experiences, timing, feelings, and unprotected sex. While TF-IDF results for posts with each flair varied, the contraceptive pill, menstrual experiences, and timing were discussed across flair groups. Among popular posts, intrauterine devices and contraceptive use experiences were often discussed., Conclusions: People commonly wrote about contraceptive side effects and experiences using methods, highlighting the value of r/birthcontrol as a space to post about aspects of contraceptive use that are not well addressed by clinical contraceptive counseling. The value of real-time, open-access data on contraceptive users' interests is especially high given the shifting landscape of and increasing constraints on reproductive health care in the United States., (©Elizabeth Pleasants, Julia Holmes Ryan, Cheng Ren, Ndola Prata, Anu Manchikanti Gomez, Cassondra Marshall. Originally published in the Journal of Medical Internet Research (https://www.jmir.org), 30.06.2023.)

On an annual basis the flagellate protozoan, Giardia duodenalis, is responsible for an estimated one billion human infections of which approximately two hundred million cause disease. However, the treatment of Giardia infections is reliant on a small group of chemotherapeutic classes that have a broad spectrum of antimicrobial activity and increasing treatment failure rates. To improve this situation, we need new drugs. In this study we screened the Compounds Australia Scaffolds Library for compounds with potent and selective activity against these parasites. Unlike previous drug discovery efforts that have focused on drug repurposing, this library is comprised of commercially available synthetic compounds arranged into lead-like scaffolds to facilitate structure activity relationship assessments and de novo drug discovery. A screen of 2451 compounds in this library identified 40 hits (>50% inhibitory activity at 10 µM, over 48 h). Secondary testing identified three compounds with IC50 values <1 μM and >50-fold selectivity for parasites over mammalian cells and a hit series, CL9406, comprising compounds with potent (lowest IC50 180 nM) and selective activity for Giardia parasites. The most promising compound in this series, SN00797640, displayed selective activity against assemblage A, B, and metronidazole resistant parasites which was parasiticidal (minimum lethal concentration 625 nM) and synergistic with albendazole. SN00797640 was well-tolerated when administered to mice at doses of 50 mg/kg daily for three days paving the way for pre-clinical in vivo activity assessment.

We examined men's influence on women's interest in biomedical HIV prevention during pregnancy and breastfeeding through structured questionnaires and focus group discussions with currently or recently pregnant and breastfeeding (P/BF) women ( n = 65), men with P/BF partners ( n = 63) and mothers/mothers-in-law of P/BF women ( n = 68) in eastern and southern Africa. Data were transcribed, coded and summarised into analytical memos. Men were depicted by most participants as joint decision-makers and influencers of women's use of HIV prevention. Cultural and religious norms depicting men as heads, breadwinners and protectors of the family were cited to legitimise their involvement in decision-making. Male partner education and engagement were recommended to garner their support in women's HIV prevention. This study elucidates how P/BF women's ability to prevent HIV is shaped by traditional and contemporary gender norms in social settings and locations where the study was conducted. Findings may aid intervention design to engage men for P/BF women's effective use of microbicide and oral PrEP.

Women who acquire HIV during the pregnancy and breastfeeding periods have a higher risk of transmitting the virus to their child than women who become infected with HIV before pregnancy. We explore the context of sexual beliefs and practices that may shape both HIV risk and willingness to use HIV prevention products during pregnancy and postpartum in Malawi, South Africa, Uganda and Zimbabwe. Twenty-three single sex focus group discussions and 36 in-depth interviews took place between May and November 2018 with recently pregnant or breastfeeding women, men, mothers and mothers-in-law of pregnant or breastfeeding women, and key informants. Participants across study groups and sites (N = 232) reported various perceived benefits and harms of sex during pregnancy and postpartum. Participants discussed reasons why men might seek sex outside of the relationship. There is a critical need for alternative prevention options to protect pregnant and breastfeeding women from HIV., (© 2021. The Author(s).)

Introduction: Women in sub-Saharan Africa spend a substantial portion of their reproductive lives pregnant and/or breastfeeding (P/BF), yet they have limited options to prevent HIV during these maternal stages. In preparation for phase 3b prevention trials in P/BF women, we explored attitudes about using a vaginal ring or oral pills for pre-exposure prophylaxis (PrEP), perceptions of HIV risk during P/BF and key influences on future PrEP use., Methods: In 2018, we conducted 16 single-sex focus group discussions (FGDs) with community- and clinic-recruited HIV-uninfected women, currently or recently P/BF, aged 18 to 40, and men with (currently or recently) P/BF partners, aged 18+. Participants completed a behavioural questionnaire, viewed an educational video and handled prototype placebo products. FGDs were conducted in local languages and transcribed, coded and analysed, using a socio-ecological framework, for key influences on willingness to use products, HIV risk perceptions and opinions on product attributes., Results: Of the 128 participants (65 women, 63 men) 75% lived with their partner and 84% had a child. Women reported the most important influencers when P/BF were partners, and all stated that health decisions when P/BF are typically made jointly (e.g. medication use; ante/postnatal and baby care). There was consensus that P/BF women are at high risk for HIV, primarily because of their partner's infidelities, and new prevention options were welcomed. Participants valued multiple options and stated that woman's personal preference would be key to product choice. Anticipated concerns about products included risk of miscarriage, impact on infant development, complications during delivery and adequate production or taste of breastmilk. Specific perceived disadvantages emerged for the ring (e.g. vaginal discomfort, difficulty inserting/removing) and for pills (e.g. nausea/vomiting) that may be exacerbated during pregnancy. Health care providers' (HCPs) knowledge and approval of product use during P/BF was needed to mitigate anticipated fears., Conclusions: Participants perceived pregnancy and breastfeeding as high HIV risk periods and valued new prevention options. HIV protection of the mother-child dyad, safety of the baby, and ultimately, health of the family were paramount. Endorsement by HCPs and support from partners were key to future product acceptance. Participants recommended involving partners and HCPs in sensitization efforts for future trials., (© 2020 The Authors. Journal of the International AIDS Society published by John Wiley & Sons Ltd on behalf of International AIDS Society.)

Giardia duodenalis, the most prevalent human intestinal parasite causes the disease, giardiasis. On an annual basis G. duodenalis infects ~1 billion people, of which ~280 million develop symptomatic disease. Giardiasis can be severe and chronic, causing malnutrition, stunted growth and poor cognitive development in children. Current treatment options rely on drugs with declining efficacy and side-effects. To improve the health and well-being of millions of people world-wide, new anti-Giardia drugs with different modes of action to currently used drugs are required. The Medicines for Malaria Venture's Pathogen Box, a collection of bio-active compounds specifically chosen to stimulate infectious disease drug discovery, represents an opportunity for the discovery of new anti-Giardia agents. While the anti-Giardia activity of Pathogen Box compounds has been reported, this work failed to identify known anti-Giardia controls within the compound set. It also reported the activity of compounds previously screened and shown to be inactive by others, suggesting data may be inaccurate. Given these concerns the anti-Giardia activity of Pathogen Box compounds was re-assessed in the current study. Data from this work identified thirteen compounds with anti-Giardia IC 50 values ≤2 μM. Five of these compounds were reference compounds (marketed drugs with known anti-microbial activity), or analogues of compounds with previously described anti-Giardia activity. However, eight, including MMV676358 and MMV028694, which demonstrated potent sub-μM IC 50 s against assemblage A, B and metronidazole resistant parasites (0.3 μM and 0.9 μM respectively), may represent new leads for future drug development. Interestingly, only four of these compounds were identified in the previously reported Pathogen Box screen highlighting the importance of assay selection and design when assessing compounds for activity against infectious agents., Competing Interests: Declaration of competing interest None., (Copyright © 2020 The Author(s). Published by Elsevier Ltd.. All rights reserved.)

Protein-based drug discovery strategies have the distinct advantage of providing insights into the molecular mechanisms of chemical effectors. Currently, there are no known trehalose-6-phosphate phosphatase (TPP) inhibitors that possess reasonable inhibition constants and chemical scaffolds amenable to convenient modification. In the present study, we subjected recombinant TPPs to a two-tiered screening approach to evaluate several diverse compound groups with respect to their potential as TPP inhibitors. From a total of 5452 compounds tested, N-(phenylthio)phthalimide was identified as an inhibitor of nematode TPPs with apparent K i values of 1.0 μM and 0.56 μM against the enzymes from the zoonotic roundworms Ancylostoma ceylanicum and Toxocara canis, respectively. Using site-directed mutagenesis, we demonstrate that this compound acts as a suicide inhibitor that conjugates a strictly conserved cysteine residue in the vicinity of the active site of nematode TPPs. The anthelmintic properties of N-(phenylthio)phthalimide were assessed in whole nematode assays using larvae of the ascaroids T. canis and T. cati, as well as the barber's pole worm Haemonchus contortus. The compound was particularly effective against each of the ascaroids with an IC 50 value of 9.3 μM in the survival assay of T. cati larvae, whereas no bioactivity was observed against H. contortus.

Aminobenzaldehydes bearing a pendant 3,5-dinitrophenyl group react thermally with N-substituted α-amino acids to form unprecedented benzoazepine-fused isoindolines. The reaction proceeds via a dearomatization/rearomatization sequence involving an intramolecular (3 + 2)-cycloaddition between the in situ formed azomethine ylide and the dinitroarene. Various glycine derivatives are tolerated as well as branched substrates based on cyclic, α-mono-, and α,α-disubstituted amino acids, giving single diastereomers in many cases. The method is scalable and gives products with a nitro group ready for further manipulation.

Atovaquone-proguanil (Malarone®) is used for malaria prophylaxis and treatment. While the cytochrome bc1-inhibitor atovaquone has potent activity, proguanil's action is attributed to its cyclization-metabolite, cycloguanil. Evidence suggests that proguanil has limited intrinsic activity, associated with mitochondrial-function. Here we demonstrate that proguanil, and cyclization-blocked analogue tBuPG, have potent, but slow-acting, in vitro anti-plasmodial activity. Activity is folate-metabolism and isoprenoid biosynthesis-independent. In yeast dihydroorotate dehydrogenase-expressing parasites, proguanil and tBuPG slow-action remains, while bc1-inhibitor activity switches from comparatively fast to slow-acting. Like proguanil, tBuPG has activity against P. berghei liver-stage parasites. Both analogues act synergistically with bc1-inhibitors against blood-stages in vitro, however cycloguanil antagonizes activity. Together, these data suggest that proguanil is a potent slow-acting anti-plasmodial agent, that bc1 is essential to parasite survival independent of dihydroorotate dehydrogenase-activity, that Malarone® is a triple-drug combination that includes antagonistic partners and that a cyclization-blocked proguanil may be a superior combination partner for bc1-inhibitors in vivo., Competing Interests: The authors declare no competing interests.

A trans-diastereoselective Pd-catalyzed dearomative [3 + 2] cycloaddition between vinylcyclopropane dicarboxylates and 3-nitroindoles has been developed. The reaction provides densely functionalized cyclopenta[b]indolines with versatile vinyl and nitro-groups. The addition of a halide additive was found to be critical for the diastereoselectivity of the reaction, which is proposed to be a result of a rapid π-σ-π interconversion between the intermediates allowing for Curtin-Hammett control. A switch in diastereoselectivity to afford products with the vinyl and nitro groups cis to each other is observed with a 4-substituted 3-nitroindole.

Giardia duodenalis is an intestinal parasite that causes giardiasis, a widespread human gastrointestinal disease. Treatment of giardiasis relies on a small arsenal of compounds that can suffer from limitations including side-effects, variable treatment efficacy and parasite drug resistance. Thus new anti-Giardia drug leads are required. The search for new compounds with anti-Giardia activity currently depends on assays that can be labour-intensive, expensive and restricted to measuring activity at a single time-point. Here we describe a new in vitro assay to assess anti-Giardia activity. This image-based assay utilizes the Perkin-Elmer Operetta ® and permits automated assessment of parasite growth at multiple time points without cell-staining. Using this new approach, we assessed the "Malaria Box" compound set for anti-Giardia activity. Three compounds with sub-μM activity (IC 50 0.6-0.9 μM) were identified as potential starting points for giardiasis drug discovery., (Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Pyrethrum is a natural insecticide extracted from Tanacetum cinerariifolium. Six esters, the pyrethrins, are responsible for the extract's insecticidal activity. The oxidative degradation of pyrethrins through contact with aerial oxygen is a potential cause of pyrethrin losses during pyrethrum manufacture. Described here is the first investigation of the autoxidation chemistry of the six pyrethrin esters isolated from pyrethrum. It was found that pyrethrins I and II, the major pyrethrin esters present in pyrethrum, undergo autoxidation more readily than the minor pyrethrin esters, the jasmolins and cinerins. Chromatographic analysis of pyrethrin I and II autoxidation mixtures showed some correlation with a similar analysis performed on extracts from T. cinerariifolium crop, which had been stored for 12 weeks without added antioxidants. Two pyrethrin II autoxidation products were isolated, characterized, and shown to be present in extracts of stored T. cinerariifolium crop, confirming that autoxidation of pyrethrin esters does occur during crop storage.

We provide a comprehensive account of the 1,3-dipolar cycloaddition reactions of azomethine ylides with carbonyl dipolarophiles. Many different azomethine ylides have been studied, including stabilized and non-stabilized ylides. Of the carbonyl dipolarophiles, aldehydes including formaldehyde are the most studied, although there are now examples of cycloadditions with ketones, ketenes and carboxyl systems, in particular isatoic anhydrides and phthalic anhydrides. Intramolecular cycloadditions with esters can also occur under certain circumstances. The oxazolidine cycloadducts undergo a range of reactions triggered by the ring-opening of the oxazolidine ring system.

Fragment-based drug discovery (FBDD) is contingent on the development of analytical methods to identify weak protein-fragment noncovalent interactions. Herein we have combined an underutilized fragment screening method, native state mass spectrometry, together with two proven and popular fragment screening methods, surface plasmon resonance and X-ray crystallography, in a fragment screening campaign against human carbonic anhydrase II (CA II). In an initial fragment screen against a 720-member fragment library (the "CSIRO Fragment Library") seven CA II binding fragments, including a selection of nonclassical CA II binding chemotypes, were identified. A further 70 compounds that comprised the initial hit chemotypes were subsequently sourced from the full CSIRO compound collection and screened. The fragment results were extremely well correlated across the three methods. Our findings demonstrate that there is a tremendous opportunity to apply native state mass spectrometry as a complementary fragment screening method to accelerate drug discovery.

The intramolecular nitrone dipolar cycloaddition of in situ-generated nitrones such as compound 26 has been used for the synthesis of cyclic isoxazolidines 27 and 29. The regioselectivity of the intramolecular cycloaddition depends on the nature of the terminal substituent on the dipolarophile. The influence of the substituent on the regioselectivity of the cycloaddition has been examined using several model systems and two methods of nitrone formation. These studies demonstrated that the cyano-substituent plays a special role in favouring the formation of the 6,6,5-ring fused adduct 27 under thermodynamically controlled conditions. The utility of the cyclo-adduct 57 (see Scheme 12) as a precursor for the naturally occurring histrionicotoxins is illustrated by the synthesis of three "unsymmetrical" (i.e. with each side chain bearing different functional groups) members of the histrionicotoxin family HTX-259A, HTX-285C and HTX-285E (2, 3 and 4 respectively).

A fragment-based screen against human immunodeficiency virus type 1 (HIV) integrase led to a number of compounds that bound to the lens epithelium derived growth factor (LEDGF) binding site of the integrase catalytic core domain. We determined the crystallographic structures of complexes of the HIV integrase catalytic core domain for 10 of these compounds and quantitated the binding by surface plasmon resonance. We demonstrate that the compounds inhibit the interaction of LEDGF with HIV integrase in a proximity AlphaScreen assay, an assay for the LEDGF enhancement of HIV integrase strand transfer and in a cell based assay. The compounds identified represent a potential framework for the development of a new series of HIV integrase inhibitors that do not bind to the catalytic site of the enzyme.

Background: HIV-1 integrase is a clinically validated therapeutic target for the treatment of HIV-1 infection, with one approved therapeutic currently on the market. This enzyme represents an attractive target for the development of new inhibitors to HIV-1 that are effective against the current resistance mutations., Methods: A fragment-based screening method employing surface plasmon resonance and NMR was initially used to detect interactions between integrase and fragments. The binding sites of the fragments were elucidated by crystallography and the structural information used to design and synthesize improved ligands., Results: The location of binding of fragments to the catalytic core of integrase was found to be in a previously undescribed binding site, adjacent to the mobile loop. Enzyme assays confirmed that formation of enzyme-fragment complexes inhibits the catalytic activity of integrase and the structural data was utilized to further develop these fragments into more potent novel enzyme inhibitors., Conclusions: We have defined a new site in integrase as a valid region for the structure-based design of allosteric integrase inhibitors. Using a structure-based design process we have improved the activity of the initial fragments 45-fold.

A nonstabilized azomethine ylide reacts with a wide range of substituted isatoic anhydrides to afford novel 1,3-benzodiazepin-5-one derivatives, which are generally isolated in high yield. The transformations involve 1,3-dipolar cycloaddition reactions of the ylide with the anhydrides to give transient, and in a representative case spectroscopically observable, oxazolidine intermediates that undergo ring-opening-decarboxylation-ring-closing reaction cascades to yield the 1,3-benzodiazepin-5-one products.

The total synthesis of the spiropiperidine alkaloid (-)-perhydrohistrionicotoxin (perhydro-HTX) 2 has been accomplished on a gram scale by employing both conventional batch chemistry as well as microreactor techniques. (S)-(-)-6-Pentyltetrahydro-pyran-2-one 8 underwent nucleophilic ring opening to afford the alcohol 10, which was elaborated to the nitrone 13. Protection of the nitrone as the 1,3-adduct of styrene and side-chain extension to the unsaturated nitrile afforded a precursor 17, which underwent dipolar cycloreversion and 1,3-dipolar cycloaddition to give the core spirocyclic precursor 18 that was converted into perhydro-HTX 2. The principal steps to the spirocycle 18 have successfully been transferred into flow mode by using different types of microreactors and in a telescoped fashion, allowing for a more rapid access to the histrionicotoxins and their analogues by continuous processing.

A high yielding, batch mode synthesis of diaryl ethers and sulfides by an S(N)Ar fluoride-mediated process in scCO(2) has been developed; the use of a polymer-supported imidazolium fluoride reagent in batch mode led to the development of a fixed-bed continuous flow process, with high conversions.

Starting from commercially available ( S)-glycidol, and via a common intermediate, the total synthesis of (-)-histrionicotoxin 285A and (-)-perhydrohistrionicotoxin has been achieved. Key to this synthesis was the efficient construction of a six-membered, chiral, cyclic nitrone.

The synthesis of a family of O-silylcarbamates from the corresponding silylamines has been achieved simply by heating the silylamine in supercritical carbon dioxide (scCO2), and these O-silylcarbamates have been shown to be effective precursors for the synthesis of a range of symmetrical and unsymmetrical ureas.

Background: The Birch reduction of electron rich pyrroles does not occur readily. However, dissolving metal reduction with zinc under acidic conditions gives 3-pyrrolines (2,5-dihydropyrroles) in reasonable yield. This dissolving metal reduction was first reported by Knorr and Rabe in 1901 but since then has only been reported for the reduction of electron rich pyrroles., Results: The partial reduction of bicyclic alpha-ketopyrrole derivatives has been performed under dissolving metal conditions with zinc and hydrochloric acid to give excellent yields of hexahydroindolizidines. This reduction method has been utilised for the diastereoselective synthesis of 5-alkylindolizidines and the stereoselectivity obtained is opposite to that of catalytic hydrogenation., Conclusion: An efficient stereoselective synthesis of indolizidine alkaloids has been developed from alpha-ketopyrrole intermediates using a modified version of Knorr and Rabe's pyrrole reduction.

A powerful method for validating a scientific result is to confirm specific results utilizing independent methodologies and processing pathways. Thus, we have designed, developed and validated an automated allele concordance analysis system (CompareCalls, patent pending) that performs comparisons between two independent DNA analysis platforms to ensure the highest accuracy for allele calls. Application of this system in a quality assurance role has shown the potential to eliminate greater than 90% of the STR analysis required of a DNA data analyst. While this system is broadly applicable for use with any two independent STR analysis programs, either prior to or following human data review, we are presenting its application to data generated with the ABI Prism Genotyper software system versus data generated with the SurelockID system. With the automated allele concordance analysis system, the GeneScan DNA fragment data generated from an ABI 377 gel image are analyzed in two independent pathways. In one analysis pathway, the GeneScan data are imported into Genotyper software where STR labels are assigned to the fragment data based upon the criteria of the Kazam 20% macro. The "Kazam" macro provided with the Genotyper program works by labeling all peaks in a category (or locus) and then filtering (or removing) the labels from peaks, such as those in stutter positions, that meet predefined criteria. In the second pathway, the GeneScan data are imported into the SurelockID analysis platform where STR labels and error messages are assigned to the fragment data based upon hard-coded allele calling criteria and quality parameters. The resulting STR allele calls for each analysis platform are then compared, utilizing the automated allele concordance analysis system. Any differences in the STR allele calls between the two systems are flagged in a discordance report for further review by a qualified DNA data analyst. The automated allele concordance analysis system guides the DNA data analyst to the discordant data generated by either analysis platform. Additionally, the analyst is also directed to data that are of less than pristine quality which may have an increased potential for errors in interpretation by either analysis platform or by a human DNA data analyst. Implementation of an automated allele concordance analysis system will yield high-quality data for CODIS and free the human DNA data analyst to perform other critical duties within the laboratory.

Mitochondrial DNA (mtDNA) analysis of highly degraded skeletal remains is often used for forensic identification due largely to the high genome copy number per cell. Literature from the "ancient DNA" field has shown that highly degraded samples contain populations of intact DNA molecules that are severely restricted in size (1-4). Hand et al. have demonstrated the targeting and preferential amplification of authentic human DNA sequences with small amplicon products of 150 bp or less (1,2). Given this understanding of ancient DNA preservation and amplification, we report an improved approach to forensic mtDNA analysis of hypervariable regions 1 and 2 (HV1/HV2) in highly degraded specimens. This "mini-primer set" (MPS) amplification strategy consists of four overlapping products that span each of the HV regions and range from 126 to 170 bp, with an average size of 141 bp. For this study, 11 extracts representing a range of sample quality were prepared from nonprobative forensic specimens. We demonstrate a significant increase in MPS amplification success when compared to testing methods using approximately 250 bp amplicons. Further, 16 of 17 independent amplifications previously "unreported" due to mixed sequences provided potentially reportable sequence data from a single, authentic template with MPS testing.

The reaction of bicycloalkenylbis(phenyliodonium) triflates 1a or b (available via the Diels-Alder reaction of bis[phenyl[(trifluoromethanesulfonyl)oxy]iodo]acetylene with cyclopentadiene or furan, respectively) with alkynylstannanes 2a-g at room temperature in DMF in the presence of catalytic amounts of trans-benzyl(chloro)bis(triphenylphosphine)palladium(II) and copper(I) iodide proceeds smoothly and with selectivity to afford good to excellent yields of bicyclic enediynes 3a-k.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.

We have characterized a Rep binding sequence which is within the A stem region of the adeno-associated virus terminal repeat (TR) and compared its affinity with that of the complete hairpinned TR for pure Rep68. Both the A stem and the complete TR substrates produced a complex pattern of protein-DNA complexes in which at least six different bound species could be distinguished. Competition experiments suggested that the dissociation constant for the A stem sequence is approximately 125-fold higher than that for the complete TR. The competition experiments also suggested that the average number of Rep molecules per TR substrate molecule under conditions of saturating substrate is 3.7:1, while for the A stem substrate, the ratio is 10:1. In spite of the apparent difference in protein-to-DNA ratio in the complexes, no major difference was seen in the mobility or the pattern of the protein-DNA complexes with the two kinds of substrates, suggesting that the difference in protein-to-DNA ratio was due to the lower stability of the A stem complex rather than the actual number of Rep molecules per DNA molecule. At least some of the difference in stability of the two kinds of complexes was due to the fact that the dissociation rate of the A stem substrate from the protein-DNA complexes was approximately fourfold faster than that of the complete TR. The dissociation rate curves for both substrates, however, were complex, suggesting that substrate was being released from at least two different kinds of protein-DNA complexes at different rates. In addition, we have analyzed binding to several substitution mutants within the A stem of the TR. A five-base mutant near the terminal resolution site (trs site) had little effect on binding. Two other mutants produced seven- or five-base substitutions within the 25-bp sequence of the A stem that had been identified in the accompanying report (D. M. McCarty, D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka, J. Virol. 68:4988-4997, 1994) as essential for binding. Each of these mutants eliminated some but not all of the repeating GAGC motifs in the 25-bp A stem region. Both of these mutants completely abolished binding to the A stem substrate but only partially reduced binding in the context of the complete hairpinned TR. Furthermore, neither mutant altered the pattern of Rep-DNA complexes produced.(ABSTRACT TRUNCATED AT 400 WORDS)

We have used baculovirus-expressed Rep68 that has been purified to homogeneity to reexamine the binding properties of the Rep protein. We find that Rep68 is capable of binding to a linear DNA sequence that is contained within a 25-bp sequence of the A stem of the adeno-associated virus (AAV) terminal repeat proximal to the B and C palindromes. This has been shown conclusively by demonstrating that Rep68 could specifically bind to a synthetic oligonucleotide containing the 25-bp region in the absence of the other sequences within the terminal repeat. Rep78 was also capable of binding the A stem recognition element, as demonstrated by the fact that a DNA affinity column containing the 25-bp sequence can be used to purify Rep78. The ability to recognize the linear DNA sequence within the A stem provides a mechanism by which the Rep protein can be oriented on the terminal repeat so that only the correct strand is cut at the terminal resolution site (trs site) during terminal resolution. In addition, computer analysis suggests that sequences similar to the A stem element are present within the three AAV promoter regions. Electrophoretic mobility shift experiments clearly demonstrate that the p5 promoter contains a Rep binding sequence. DNase protection experiments indicate that the Rep binding sequence within the p5 promoter is located between the YY1 initiator sequence and the TATA binding site. This position immediately suggests a mechanism by which the Rep protein could act as a repressor or a transactivator of p5 transcription by interacting with either YY1 or TBP. In addition, gel shift experiments suggest that the p19 promoter also contains a Rep binding site. The presence of Rep binding sites upstream of both promoters suggests that these sites may be involved in coordinate regulation of AAV transcription. In addition, we have identified a heterologous Rep binding sequence within pBR322 DNA. A comparison of the sequences within the A stem, p5, and pBR322 binding sites suggests that a repeating GAGC motif is at least part of the Rep recognition sequence. In the accompanying report (D. M. McCarty, J. H. Ryan, S. Zolutukhin, X. Zhou, and N. Muzyczka, J. Virol. 68:4998-5006, 1994), we examine the relative affinity of Rep to the A stem site and the complete terminal repeat. Finally, we also have reexamined the ability of Rep68 and Rep78 to cut at the trs site in substrates that do not contain the B and C palindromes or any apparent secondary structure.(ABSTRACT TRUNCATED AT 400 WORDS)

Three related studies were completed to test the predictive relation among identity status, personality, and conformity behavior. The investigations were undertaken to replicate the earlier research findings of Toder and Marcia (1973). As predicted in Study 1, personality differences were found for both sexes. However, no relation was observed between identity status and conformity on the Asch task. Study 2 was completed to confirm the reliability of the identity status measure. Finally, in Study 3 four measures of conformity behavior (peer assessments, an experimental task, two self-report scales) were completed by college students of diffusion, foreclosure, moratorium, and identity-achievement statuses. Diffusion students were most influenced by peer pressure conformity, whereas identity-achievement students were most likely to report engaging in conformity behavior for achievement gains. Although earlier research by Toder and Marcia (1973) was not replicated via the Asch conformity task, the third study does support a predicted relation between identity and conformity behavior.