Search

Objective: This study was conducted to estimate multi-trait genetic parameters for somatic cell score (SCS), milk yield and type traits in Nigerian Dwarf (ND) goats from the United States.Methods: Data from 1,041 ND goats in the United States with kiddings in 95 herds were used to estimate multi-trait genetic parameters for SCS, milk (MILK), fat (FAT), and protein (PROT) yields, and 14 type traits. An 18-trait mixed linear animal model for lactation mean SCS (Log2), MILK, FAT, PROT, and 14 type traits was applied. A factor analytic approach (FA1) in ASReml software was used to obtain convergence.Results: Averages for SCS were low (2.85±1.29 Log2), and were 314±110.6, 20.9±7.4, and 14±4.9 kg, respectively, for MILK, FAT, and PROT. Heritabilities for SCS, MILK, FAT, and PROT were 0.32, 0.16, 0.16, and 0.10, respectively. The highest heritabilities for type traits were for stature (0.72), teat diameter (0.49), and rump width (0.48), and the lowest estimates were for dairyness (0.003) and medial suspensory ligament (0.03). Genetic correlations of SCS with MILK, FAT, and PROT were positive but low (0.25, 0.18, and 0.23, respectively). Genetic and phenotypic correlations between MILK, FAT, and PROT were high and positive (≥0.66). Absolute values of genetic correlations involving SCS with type traits were generally low or no different from zero. Most of the phenotypic correlations involving SCS with type traits were low. No serious unfavorable genetic correlations between milk yield traits and SCS or between milk yield traits or SCS and type traits were found.Conclusion: Genetic variation exists in the ND breed for most studied traits. The development of selection programs based on these estimates may help accelerate favorable multitrait genetic changes in this breed.

Previous studies have suggested that arsenic crosses the placenta and affects the fetus development. The study under consideration aims to show comparative ameliorative effect of Moringa oleifera leaf and flower extracts against sodium arsenate induced fetus toxicity of mice. Pregnant mice (N=44) were kept in lab and divided into eleven group from (A to K) and were orally administered the doses 6 mg/kg, 12 mg/kg for sodium arsenate, 150 mg/kg and 300 mg/kg for Moringa oleifera leaf extracts (MOLE) and 150 mg/kg and 300 mg/kg for Moringa oleifera flower extracts (MOFE) comparing with control. The investigation revealed evident reduction in the fetuses weight, hind limb, fore limb, tail and snout length, crown rump and head circumferences well as malformations in tail, feet, arms, legs, skin and eyes in the negative control group (only administered with sodium arsenate). Co-administration of sodium arsenate with MOLE and MOFE ameliorate the reversed effect of sodium arsenate on the shape, length, body weight and DNA damage of fetus significantly at 95% confidence interval. However, Moringa oleifera leaf extract showed more significant results in comparison to Moringa oleifera flower extract. Hence concluded that Moringa oleifera leaf extract ameliorated the embryo toxic effects of sodium arsenate and can be used against environmental teratogens. Resumo Estudos anteriores sugeriram que o arsênio atravessa a placenta e afeta o desenvolvimento do feto. O estudo em consideração visa mostrar o efeito melhorador comparativo de extratos de folhas e flores de Moringa oleifera contra a toxicidade fetal induzida por arseniato de sódio em camundongos. Camundongos grávidas (N = 44) foram mantidos em laboratório e divididos em 11 grupos (de A a K) e foram administrados por via oral nas doses de 6 mg/kg, 12 mg/kg para arseniato de sódio, 150 mg/kg e 300 mg/kg para extratos de folhas de Moringa oleifera (MOLE) e 150 mg/kg e 300 mg/kg para extratos de flores de Moringa oleifera (MOFE) em comparação com o controle. A investigação revelou redução evidente no peso do feto, membro posterior, membro anterior, comprimento da cauda e focinho, coroa, nádega e circunferência da cabeça, bem como malformações na cauda, pés, braços, pernas, pele e olhos no grupo de controle negativo (apenas administrado com arseniato de sódio). A coadministração de arseniato de sódio com MOLE e MOFE melhora significativamente o efeito reverso do arseniato de sódio na forma, comprimento, peso corporal e dano ao DNA do feto, com intervalo de confiança de 95%. No entanto, o extrato da folha da Moringa oleifera apresentou resultados mais significativos em comparação ao extrato da flor da Moringa oleifera. Portanto, concluiu que o extrato da folha de Moringa oleifera melhorou os efeitos tóxicos do arseniato de sódio para o embrião e pode ser usado contra teratógenos ambientais.

Context In extensive grazing sheep systems, pregnant ewes undergo periods of undernutrition because gestation coincides with winter when natural pasture is of lowest quantity and poorest quality. The lamb’s weight and thermoregulatory capacity, and the ewe–lamb bond at birth, may be compromised. Maternal melatonin treatment during gestation may reverse these effects. Aim The aim was to determine the effects of melatonin treatment of single-lambing, undernourished ewes during the last third of gestation on lamb birthweights and body temperatures, and on ewe–lamb interactive behaviour after birth. Methods At Day 100 of gestation, 39 single-bearing ewes received a subcutaneous melatonin implant, and 54 ewes served as controls with no implant. Throughout gestation, the ewes remained under extensive conditions grazing on natural pasture. Measurements were made of lamb birthweight, body temperatures (surface temperature by infrared thermography and rectal temperature), and ewe–lamb behaviours during a handling test at 6–17 h after lambing. Key results There was no effect of melatonin treatment on lamb birthweight or rectal temperature, or on ewe–lamb interaction behaviours. Hip minimum surface temperature was greater in lambs from melatonin-treated ewes than lambs from control ewes (21.2°C ± 0.9°C vs 18.8°C ± 0.8°C; P = 0.05), and there was a similar trend for hip mean surface temperature (24.6°C ± 0.9°C vs 22.3°C ± 0.7°C; P = 0.06). Rump surface temperatures were greater in male than female lambs: maximum (27.9°C ± 1.2°C vs 22.9°C ± 1.2°C; P = 0.01), minimum (22.2°C ± 1.5°C vs 16.7°C ± 1.5°C; P = 0.02) and mean (25.4°C ± 1.3°C vs 20.5°C ± 1.3°C; P = 0.02). Conclusion Melatonin treatment during the last third of ewe pregnancy slightly enhanced the surface temperature of lambs at birth but did not influence ewe–lamb interaction behaviour after birth (i.e. after establishment of the ewe–lamb bond). Implications Further study in more depth is warranted into the possible effects of maternal supplementation with commercial melatonin implants on lamb development, thermoregulatory capacity, behaviour and survival rates in extensive grazing systems, including the effect on ewe–lamb behaviours immediately after birth for both singletons and twins.

This study evaluated how integrated crop–livestock–forestry systems affected the expression of sexual traits in Nellore heifers. The serum concentration of insulin-like growth factor type-I (IGF-I), follicular diameter, rump fat thickness (RFT), and weight gain were assessed in 48 prepubertal Nellore heifers (14–16 months old, initial average live weight of 270 ± 36 kg). Calf birth weight was assessed after parturition. Heifers were distributed into four production systems following a completely randomized block design, with 12 animals in each treatment: open pasture (OP); two silvopastoral systems (SPSs—single rows or SPSt—triple rows), and crop-livestock system (CL). Thermal comfort was evaluated using the black globe, as well as humidity index (BGHI) and radiant thermal load (RTL). Animals in all treatments were exposed for long periods to heat stress; however, thermal indexes got lesser values in the SPS treatments. Heifers from the SPSt achieved the greatest serum concentration of IGF-I, but the follicular diameter did not differ among systems, as initially expected. The greatest weight gain and RFT standards were found in heifers of the CL system. Calves born from females of exclusive livestock (OP) showed the smallest weight at birth. Therefore, we suggested the adoption of the SPS and CL systems for livestock beef ranches as Nellore heifers reached better zootechnical and physiologic parameters associated with sexual precocity.

Researches on the study of population-genetic parameters of linear type traits of cow’s firstborn of the Ukrainian Black-and-White dairy breed were conducted in the herd of a private enterprise of the Pidlisnivs’ka branch of PE "Buryns’ke" in Sumy district. Conformation type assessment of cows firstborn was performed according to the method by linear classification by the latest ICAR recommendations at the age of 2-4 months after calving according to two systems - 9-score scale, with a linear description of 18 conformation body parts and 100-score classification system taking into account four sets of selection traits that characterize: the severity of dairy type, body development, limbs condition and udder morphological qualities. The highest level of reliable positive relationship with the milk yield per lactation of cows firstborn was found according to the conformation group traits, characterizing the severity of the dairy type of cows (r = 0.451), body development (r = 0.434), qualitative indicators of udder morphological traits (r = 0.468) and by the final type score (r = 0.488). A positive relationship with milk yield was observed by a number of individual descrip-tive conformation traits: height at sacrum (r = 0.358), body depth (r = 0.413), angularity (r = 0.469), rump width (r = 0.431), pelvic limbs posture (r = 0.374), fore (r = 0.466) and rear (r = 0.347) udder attachment, central ligament (r = 0.258) and locomotion (r = 0.334). Body condition score negatively correlated with milk yield (r = 0.338). Sufficient for effective selection the level of heritability coefficients of cows linear traits was found in the vast majority of group traits that characterize the dairy type (0.356), body develop-ment (0.312), udder (0.415) and overall type assessment (0.487), and by descriptive traits : height at sacrum (0.284), chest width (0.144), body depth (0.347), angularity (0.436), rump width (0.274), pelvic limbs posture (0.322), fore (0.357) and rear (0.258) udder attachment and central ligament (0.233). The established significant and reliable correlation variability of group and descriptive con-formation body parts with milk yield during the first lactation confirmed the possibility and expediency of simultaneous selection by productivity and type.

OBJECTIVES To assess the usefulness of sonographically measured anogenital distance (AGD) in predicting fetal gender in Saudi fetuses during the first trimester and to provide normal reference centiles for AGD. METHODS A retrospective cohort study was conducted at King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia between November 2020 and May 2021. The ultrasound scans of 313 singleton pregnancies between 11-13 plus 6 gestational weeks and their gender-at-birth were collected. Anogenital distance was measured from the inferior base of the genital tubercle to the rump. Binominal logistic regression and receiver operating characteristic curves (ROC) evaluated the predictive performance of AGD for determining fetal gender. RESULTS There was a significant difference of approximately 15% in mean AGD between female (5.92 mm [95% CI= 6.70, 6.14]) and male (6.80 mm [95% CI= 6.61,7.00]) fetuses (p

Our objectives were to determine the effects of dam body condition score (BCS), age of dam, and calf sex on placental size and the relationships between dam body weight (BW) and calf size with placental size. Expelled placentas and calf size at birth were collected from crossbred beef heifers and cows during four experiments (n = 22 to 39/experiment). Placentas deemed complete by visual inspection were dissected; dry weights were determined for cotyledonary and intercotyledonary tissues. Mixed linear models were used to individually determine main effects of peripartum BCS category [Thin (

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.

Background and Aim: The Thalli sheep are the main breed of sheep in Pakistan, and an effective method to predict their body weight (BW) using linear body measurements has not yet been determined. Therefore, this study aims to establish an algorithm with the best predictive capability, among the Chi-square automatic interaction detector (CHAID), exhaustive CHAID, artificial neural network, and classification and regression tree (CART) algorithms, in live BW prediction using selected body measurements in female Pakistani Thalli sheep. Materials and Methods: A total of 152 BW records, including nine continuous predictors (wither height, body length [BL], head length, rump length, tail length, head width, rump width, heart girth [HG], and barrel depth), were utilized. The coefficient of determination (R2), standard deviation ratio, root-mean-square error (RMSE), etc., were calculated for each algorithm. Results: The R2 (%) values ranged from 49.28 (CART) to 64.48 (CHAID). The lowest RMSE was found for CHAID (2.61), and the highest one for CART (3.12). The most significant predictors were the HG of live BW for all algorithms. The heaviest average BW (41.12 kg) was observed in the subgroup of those having a BL of >73.91 cm (Adjusted p=0.045). Conclusion: Among the algorithms, CHAID provided the most appropriate predictive capability in the prediction of live BW for female Thalli sheep. In general, the applied algorithms accurately predicted the BW of Thalli sheep, which can be very helpful in deciding on the standards, available drug doses, and required feed amount for animals.

Context Cow survival measures the ability of cows to survive from the current to subsequent lactation. In addition to economic gain, genetic selection for survival could improve animal welfare by increasing the adaptability and resilience of the cows to both environmental and health challenges. However, survival is a complex trait because it results from a diverse range of reasons for culling of cows from the herd. Consequently, the accuracy of genetic predictions of direct survival are often low. Aims Our aim was to increase the accuracy of predictions of survival in Holstein and Jersey sires by including important predictor traits in multi-trait evaluation models. Methods Phenotypic and genetic correlations between survival trait deviations (TDs) and 35 routinely measured traits (including milk yield, fertility and type traits) were estimated using bivariate sire models. Survival TDs for 538 394 Holstein and 63 839 Jersey cows were used in our study; these cows or their close relatives also had milk, fertility and type traits records between 2002 and 2019. These genetic parameters were required to assess the potential usefulness of predictor traits for the prediction of survival. Key results Survival was genetically correlated with milk, fat and protein yields, overall type, composite mammary system and fertility TDs in both Holstein and Jersey. Further, most of the type traits related to feet and legs, and rump, were also correlated with survival TDs in Jersey. For sires, the accuracy of predictions for survival increased by 0.05 for Holsteins (from 0.54 to 0.59) and for Jerseys (from 0.48 to 0.53) through the use of multivariate models compared with univariate models. Conclusions Survival was genetically associated with traits affecting voluntary and involuntary culling and when included in multi-trait genetic evaluation models, they moderately improved the accuracy of genetic prediction of survival. Implications Predictor traits can be used to increase the accuracy of predictions of survival through the use of multi-trait models. The inclusion of breed-specific predictor traits should be considered, especially for Jerseys in genetic evaluations of survival.

In Kenya, meat value chain (MVC) is an important component of the food supply chain serving as a source of nutrients and income. However, information regarding processing practices, hygiene and equipment use as affecting meat quality still remains unclear despite its relevance for data and for assessment for development of meat quality in the meat trade. Therefore, a cross sectional survey of selected slaughterhouses and butcheries in Eastern region of Kenya was carried out to assess the postharvest handling practices and meat quality. Forty meat samples were collected from rump, neck, stomach and hind legs cuts of the carcass and analyzed for total viable counts, Staphylococcus aureus, Escherichia coli and Listeria monocytogenes. The findings indicate that over 50% of the meat handlers in slaughterhouses and butcheries have not received any formal training in good hygiene practices for meat handling. Total viable counts ranged from 2.159 to 2.736 log CFU/g, Staphylococcus aureus ranged from 1.112 to 1.324 log CFU/g, Escherichia coli ranged from 1.211 to 1.320 log CFU/g and Listeria monocytogenes ranged from 0.101 to 0.193 log CFU/g in the meat cuts. In conclusion, the study showed poor handling of meat which poses risks to consumers. Key words: Meat quality, post-harvest practices, meat value chain.

Body condition integrates the effects of habitat on individuals and consequently population performance of cervids. However, most condition data is likely to come from harvested males, which may not reflect absolute condition of, or habitat quality for, adult females because of basic ecological differences. To test whether condition of males reflected condition of females, we compared three indices of nutritional condition (rump body condition score, maximum subcutaneous fat thickness, and percent body fat) of adult male, lactating adult female, and dry adult female mule deer over multiple years in 2 sites in New Mexico, USA. Males consistently achieved significantly higher levels of condition than females for all indices of condition, regardless of whether indices for males were scaled for metabolic size or not. Because population productivity and rate-of-increase is driven by condition and consequent performance of females, population monitoring strategies that assess only condition of males may not reflect absolute condition of females and thus habitat quality as it fundamentally relates to population dynamics of cervids. Condition of males, however, can likely index relative habitat quality if not absolute.

Breeding practices and trait preferences are key to defining sound breeding objectives and designing genetic improvement programs at community level. The current study identifies these factors for village goats within a pilot community-based breeding program in Pella village, North West province, South Africa. Thirty-five farmers were interviewed using semi-structured questionnaire survey to characterize goat farmers’ production system. Breeding objectives were identified in 26 households using own flock ranking experiment and the body weight (kg) and linear measurements (cm) were collected for 10 best does and bucks. Majority of famers were males (83%) and literate (85.7%). Fifteen (43%) farmers owned a buck, and those that did not, relied on communal bucks. Average flock per household was 21±19. Farmer selling price for does was R1588.68±313.17 and bucks were sold for R1663.89±861.91. Body size traits were ranked high for both bucks (0.22) and does (0.10), followed by growth rate of 0.10 does and 0.08 for bucks. Average live body weight for all goats was 38±12 kg. Except for rump length, all linear body measurements studied were significantly correlated with body weight (p

This study was conducted at the college of agriculture – Al-Qasim Green University to investigate the effect of breed and age of dams on several growth traits of two sheep breeds, including 123 Iraqi Awassi and 78 Iranian Karakul breeds. Variables growth traits were examined in the present study, namely body weight (BW), body length (BL), wither height (WH), rump height (RH), and chest circumference (CC), and abdominal circumference (AC). Results indicated the absence of a significant effect between both breeds in all investigated growth traits in birth. Meanwhile, a significant (P

We morphologically characterized the creole pig of the Guamote canton located 44 km from the city Riobamba, belonging to the province of Chimborazo. The investigation lasted for 60 days, during which a descriptive methodology for the morphological characterization was performed in a population sample of 72 animals, measuring a 14 zoometric and seven phaneroptical variables. Additionally, seven proportional zoom indexes of male and female pigs over six months of age. Avcerages for the zoometric measurements of the Creole pigs of the Guamote canton were; LK 24.64 cm; LC 15.11 cm; AK 14.77cm; AO 15.71 cm; LO 19.56 cm; AC 59.54 cm; AG 65.92 cm; DL 81.61; SDD 31.40 cm; DB 26.94 cm; ANG 25.02 cm; LG 25.85 cm; PT 91.24 cm; PC 16.91 cm; and PV 59.61 kg. According to the panoptical variables and zoometric indexes, it is concluded that the Creole pig belonging to the Guamote canton is an animal with characteristics similar to the Iberian pig of the Gabana variety with a completely black coat without spots, dark mucous membranes, long and abundant hair, in profile sub-concave, dolichocephalic in which the length of its face predominates over the width, good depth of chest which determines its functionality and rusticity, with a rump of curved lines very good for reproduction, eumetrics or medium-sized with no lamellas and syndactyly, which is why it is recommended to guarantee the conservation of Creole pigs in the Guamote canton, since it constitutes a zoogenetic resource of great importance through the generation of genetic nuclei in the area, thus allowing new generations to inherit the great wealth and diversity of the genetic resources existing in Ecuador.

This study focuses on research of economically important traits of Ukrainian black-and-white dairy cows with different types of body constitution. The aim of the study was to differentiate dairy cows into constitution types and to identify the best types in terms of growth, exterior, milk productivity and reproductive capacity. The cows were differentiated into low-, mid- and high-capacity types of body constitution. Depending on their type the features of growth, exterior, milk productivity and reproduction capacity of primiparous have been studied. It has been established, that the intensity of growth of heifers from birth to 18 months depended on the type of their body constitution. Higher live weight, absolute and average daily gains were characteristic of heifers with low-capacity body constitution. Their live weight at the age of 18 months on average was 388.5 kg, it was on 30.9 kg and 60.3 kg (Р < 0.01) more than live weight of mid- and high-capacity heifers. The advantages of low-capacity heifers in average daily gain during the growing period were 60 g and 117 g, respectively. The results of the exterior evaluation have shown that primiparous with the high-capacity type of body constitution had greater size and larger measurements primarily of the chest and barrel (Р < 0.05–0.001).The higher values of linear evaluation were also observed in cows with the high-capacity type, which were characterized by well-developed chest, wide rump, desired rear view of rear legs, firm udder attachment and strong central ligament. The power of influence of the type of body constitution on linear type traits ranged from 0.5 % (rear teat placement) to 46.2 % (chest width). Higher milk productivity was a characteristic of mid-capacity cows (an advantage of 305-d milk yield – 340–662 kg, milk fat yield – 9.0–21.0 kg, milk protein yield – 9.8–19.8 kg).The best results of reproduction capacity have been observed in cows with the high-capacity type of body constitution (calving percentage – 87.5 %)

Objectives: The objective of this study was to assess the relationship between pelvic measurements viz pelvic width (PW), pelvic height (PH) and pelvic area (PA), and linear body measurement traits viz body weight (BW), shoulder height (SH), chest depth (CD), Hindquarters width (HW), rump length (RL), hip height (HH), body length (BL) and also calve birth weight (CBW) under different calving ease scores viz no assistance, gently pull and hard pull. Material and methods: A total number of fifty-one first calf Sussex heifers at 24 months old, weighing approximately 450 kg were used for this study. A number of two, two-year-old bulls, weighing approximately 800 kg were used for mating the fifty-one heifers with a bull to cow ratio of (1:30 and 1:21). The fertility of bulls was assessed by a private veterinarian before the mating season. Calving ease was scored as follows: 1 = no assistance during parturition (normal), 2 = heifer assistance as gently pull, 3 = heifer assistance as hard pull, 4 = heifer cannot calf, 5 = heifer calved a dead calf, and 6 = heifer calf with abnormal position. Results: Descriptive statistics indicated that PH (p < 0.01) and RL (p < 0.05) were significant different among calving ease scores. Correlation findings for no assistance score revealed that CBW was positively significantly correlated (p < 0.05) PH and low significant (p < 0.01) with HW, HH, RL, PW, CD and SH, respectively. CART results demonstrated that HH and PH play an important role in predicting calving ease on Sussex heifers. Conclusion: The findings suggest that there is a relationship between pelvic areas and linear body measurements. This study might help farmers during breeding to lower incidents of dystocia during parturition. However, further studies need to be done in CART modelling with the main aim of reducing dystocia in Sussex heifer or larger sample size. [J Adv Vet Anim Res 2021; 8(1.000): 164-172]

Objective: This study was designed to determine the ossification time and pattern of the mandible. Methodology: Three hundred and fifty (350) wasted fetuses consisting of 70 Balami, 140 each of Uda and Yankasa breeds whose crown vertebral rump length ranged from 3.0-15 cm were used. The fetuses were processed using the Alizarin technique and the mandible was dissected from the head for stereography. Result: The result revealed that the first part of the mandible to develop was the body and mental foramina at the 42 nd –44 th days of gestation while the coronoid process, rami, and condyloid process develop later at different time points. In addition, the mandibular foramina remained undeveloped in all age groups. Interestingly, the mandibular canal began ossification earlier in the Yankasa breed compared to other breeds. It was shown to arise from a cartilaginous tissue at the medial and lateral surfaces of the body and dorsally remained opened and undifferentiated from the teeth alveoli of the lower jaws in the 7 age groups. Conclusion: It was therefore concluded that the mandible arises from three ossification centres at the body, rami, and coronoid process. These segments develop at different time intervals in the three breeds of sheep with Yankasa mandible ossifying and progressing faster than in Balami and Uda. Doi: 10.28991/SciMedJ-2021-0301-3 Full Text: PDF

Estrus traits have economic value in dairy production systems and could be incorporated into genetic selection indices. In an effort to further understand selection responses, 2 studies were performed to estimate the intra- and interclass correlation coefficients for estrus traits. Holstein-Friesian cows (n = 1,197; study 1) across 5 pasture-based grazing dairy herds were fitted with a capacitive touch sensing (CTS) device on the rump (FlashMate, Farmshed Labs Limited, Hamilton, New Zealand). The daily number of rump touches were subjected to a peak detection program to objectively identify periods of increased rump touches above baseline (indicative of estrus). The number of times touched and the sum of the touch duration were used to compare farms and estimate the intraclass correlation (repeatability). For study 2, postpartum Holstein (n = 85) and Guernsey (n = 5) cows in a confinement-style dairy were used. Cows were fitted with an IceQube accelerometer (IceRobotics Ltd., Edinburgh, United Kingdom) to measure steps taken per hour and a CTS device was applied to both rumps. The interclass correlation for the number of rump touches and number of steps taken during estrus was calculated. Data collected from 5 herds (study 1) demonstrated a 2- to 3-fold difference between herds in the number of rump touches and total touch time during estrus. The intraclass correlation (repeatability; estimates of maximum heritability) for rump touches during estrus was 0.22. For study 2, the number of steps and the number of rump touches during estrus increased in a synchronous manner. The intraclass correlation (repeatability) for number of steps during estrus was 0.26. The interclass correlation (r) for the number of rump touches and the number of steps was 0.46 (R2 = 0.21). Based on the R2, at least 20% of the variation in the number of steps during estrus was explained by the number of touches to the rump of the cow. Selecting cows for the number of steps taken during estrus could increase the number of rump touches (mounts, chin rests, and so on, received from other cows) if a genetic correlation exists for the phenotypic correlation that we observed.

A study was conducted to determine the interdependence among conformation traits of 178 West African Dwarf sheep and to predict body weight from their independent scores using principal components analysis. Body weight and nine morphostructural traits: height at withers, body length, heart girth, rump height, hip width, chest depth, fore canon bone length, tail length, and ear length were measured. Phenotypic correlation coefficients between body weight and body dimensions ranged from 0.78 to 0.79. Anti-image correlations of the body shape characters showed that partial correlations were low. Two principal components were extracted from the factor analysis with varimax rotation of the inter-correlated traits which accounted for 69.50% of the total variance. The first principal component (PC1) explained 57.70% and second principal component (PC2) contributed 11.70% of the variance. Both PC1 and PC2 could be considered in the selection programme to obtain animals with better conformations using minimal number of measurements.

This research aimed to determine the growth performance and various body measurement values of lambs in Qaradolaq sheep reared in Azerbaijan. Lambs were weighed in 15-day intervals until the weaning age of 90 days in this study. In addition, withers height, chest depth, body length, rump height was determined using a measuring cane and hind shank cannon bone circumferences were determined by using measuring tape at the aforementioned intervals. The mean body weight of lambs at birth was 3.23 kg, while the 90-day weaning weight was 23.49 kg. The mean wither height, breast depth, body length, rump height and posterior cannon bone circumference of lambs at weaning age were 53.00 cm; 23.35 cm; 51.88 cm; 52.51 cm and 8.81 cm, respectively. As a result, in addition to the growth performance and various body size measurements of Qaradolaq lambs, the feeding performance, meat quality and milk yield characteristics would complete the information about this sheep type and shed light on future breeding works.

A study was conducted to evaluate the effect of linear measurements and linear type traits in two breeds of cattle in Nigeria. Observations on linear type traits of 142 cows consisting of 89 Bunaji and 53 Sokoto Gudali breeds were scaled and scored thrice within a period of May to July, 2017. Live weight and nine body linear measurements (Height at Rump-HR, Height at Withers-HW, Body Length-BL, Length of Hip-LH, Rump Length-RL, Width of Hips-WH, Width of Pins-WP, Chest Depth-CD, and Chest Width-CW) and eight linear type traits scores (Stature-ST, Body Depth-BD, Rump Width-RW, Teat Length-TL, Udder Depth-UD, Body Condition Score-BCS, Rear Legs Set (side view), and Fore Udder Attachment) were also measured. Result showed significant (p

The objective of this study was to provide information on the morphological structure and body indices of Bunaji cattle and their crosses. Body weight and eight (8) morphological traits of 72 Bunaji and 60 Friesian x Bunaji cows were measured. The morphological parameters were used to calculate nine body indices. The analyzed morphological traits showed that the crossbred cows were heavier with larger morphological structure than the pure breed; however, both animals slightly slope forward although not very unbalanced. The correlation coefficients amongst the morphological traits in Bunaji were all positive and significant (P< 0.05 – 0.01) except for correlation of Rump Width (RW) with Body Depth (BD: r = 0.352) and Body Length (BL: r =0.210). However, the correlation coefficients amongst the morphological traits in the crosses were generally weak. The strongest correlation was observed between BW and HG (0.926) and between BW and RW (r = 0.946) in Bunaji and their crosses, respectively. The Principal Component Analysis (PCA) of the morphometric traits extracted one component with total variance of 67.67% in Bunaji and two components with total variance of 74.30% in the crosses. The first factor in each case had higher loadings for variables relating to body size, while the second PC in the crosses had high association with traits that reflect the body shape of the animal. The HG and RW were the single most informative morphological traits for estimation of BW in Bunaji and Friesian x Bunaji, respectively. In Conclusion, the Bunaji cattle are medium size animals, although they are used for both meat and milk production (multipurpose) there morphology showed some resemblance to milk type animal, thus suggesting a possible genetic improvement of these animals for dairy purpose.

[EN] Generally, in recent times across the breeding spectrum, rabbits of giant, medium, small and dwarf breeds have been reared. The largest representation among breeders at most breeding exhibitions held in central European countries is amongst giant and medium breeds. The aim of this work was to evaluate the qualities and exterior faults in selected giant and medium rabbit breeds in different colour varieties according to a current book of rabbit standards. Of 1779 rabbits from 11 exhibitions held in the territory of the Czech and Slovak Republics, 646 giant rabbits weighing 5.5 kg and over and 1133 medium rabbits between 3.25 to 5.5 kg of different breeds and colour varieties were selected. Giant (large) breeds population included 210 of Giant, 187 of Giant Papillon and 249 of Lop. In the medium weight category, 308 of Big Light Silver, 184 of Chinchilla Giganta and 641 of Vienna group breeds were selected. The qualities and exterior faults of typical breed traits were evaluated in six positions: weight, shape, type, coat, top colour or markings and undercolour. The results of the work show that the most common exterior faults in these categories were in the shape, type and coat positions. In the shape position, significant exterior faults were found, such as slightly protruding hips with slanting rump, worse legs position with bowed or splayed limbs and loose skin on the body. Especially observed in the type position in all selected breeds were narrow chest, body too lean or too long and a more delicate head with finer structure of ears. The coat was usually thick and less elastic with the lighter undercolour at the base of the skin and non-sharply defined intermediate colour. The data obtained are ground-breaking, representing a new approach to assist in the characterisation of giant and medium rabbit breeds included in a study and to select individuals with the best exterior properties with a view to improving the breed quality., This work was supported by projects KEGA no. 006UVLF-4-2020: Implementation of new scientific knowledge in teaching and improving the practical training of students in breeding technology from the Animal husbandry subject (Slovak) and the Cultural heritage of small homelands project, no. PPI-APM-2018-1-00010-U-001 (Poland)

The research was carried out in the aspect of estimating first-calf cows of the Holstein breed (Ukrainian Black-and-White dairy breed with a conditional Holstein bloodline above 93.75%) by the conformation type. Estimation of the conformation type of cows was performed according to the method of linear classification according to the latest ICAR recommendations at the age of 2–4 months after calving by two systems: 9-score, with a linear description of 18 conformation body parts and 100-score system taking into account four sets of breeding traits, that characterize: expression of dairy type, body development, legs condition and morphological qualities of udder. Each conformation complex was estimated independently having its own weight in the final score of the animal: dairy type – 15%, body – 20%; legs – 25% and udder – 40%. The research base was the herd of breeding farm of the company "Ukrlandfarming" PE "Buryns'ke" Pidlisnivskyi branch in Sumy region. The obtained indicators of linear classification of first-born cows according to the 100-score system showed that within the four sets of traits the average level of assessment was within the range of "good with plus". Experimental animals were characterized by good development of group traits of dairy type (83.5 score), body condition (82.8 score), limbs (83.6 score), udder (83.8 score) and the final assessment (83.5 score). The level of estimates for development of 18 main descriptive conformation traits of first-born cows, provided by the method of linear classification, differed in significant intra-herd variability (16.5–38.1%). The estimated animals of the pedigree farm were characterized by well-defined height (6.7 score), body depth (7.2 score), angularity (7.5 score), rump angle (5.2 score) and width (6.6 score), pelvic limbs posture (7.5 score), fore (7.3 score) and rear (7.2 score) udder parts attachment, central ligament (7.5 score), udder depth (6.8 score) and locomotion (7.3 score). In general, conformation type of first-born cows had a fairly good characteristic of the descriptive traits that determine their dairy type of productivity. The use of the method of linear classification in the selection process of dairy cattle will be a very effective means of objective determination of the breed characteristics of the conformation type of cows. The presence of relationship between the final type assessment and the level of milk productivity will facilitate effective breeding in the selection of animals for this trait.

Finding out the genetic mechanism of growth and development traits and the development of related molecular markers can help improve the breeding of livestock. The long-chain acyl coenzyme A synthase 1 (ACSL1) gene plays a major role in lipid synthesis and fatty acid catabolism. However, there are few studies on the ACSL1 gene polymorphism of Dezhou donkeys. This study analyzed the expression level of the ACSL1 gene in different tissues of young and adult Dezhou donkeys, as well as association analysis of four gene polymorphic loci in 450 individuals. The results showed that expression levels of the ACSL1 gene are higher in heart, liver, spleen, lung, renal, gastric and muscle tissues of adult donkeys than in those of young donkeys. In the association analysis between genotype and body size traits, the wild genotype DD at the ACSL1-1 locus in female and male donkeys was greater than the mutant genotype II (P

O controle de dados é fundamental para o sucesso dos sistemas de produção. No entanto, a criação de cabras nas regiões semiárida e tropical produz principalmente derivados artesanais, lácteos ou produtos de carne como embutidos e salame. Apesar da importância, o peso corporal (PC) geralmente não é medido por pequenos e médios produtores devido à falta de balanças, estruturas de baias e instalações rurais inadequadas. O principal objetivo deste estudo foi de estabelecer equações para estimar o PC de caprinos Saanen e Anglo Nubian. Foram coletados 125 dados de animais constituídos por 65 cabras Saanen e 60 cabras anglo-nubianas de diferentes faixas etárias. As medidas foram feitas para a altura da cernelha, altura da garupa; comprimento corporal, profundidade do peito, perímetro torácico (PT), comprimento da garupa, largura da garupa (LG), circunferência abdominal e PC. Para todas as relações avaliadas entre PC (kg) e medidas morfométricas (cm), o efeito do sexo foi significativo (P 0,01). A LG apresentou as maiores correlações (R2 = 0,92) com o PC para as fêmeas, enquanto as medidas do PT apresentaram as maiores correlações (R2 = 0,92) com o PC dos machos. As seguintes equações foram ajustadas: PC fêmeas = 0,1188 × LG2 + 0,5732 × LG - 5,5888; e PC machos = 0,0127 × PT2 - 0,6611 × PT + 11,261. Além disso, para estimar o PC considerando a idade em dias (t): PC = 36.5674 × exp (-2.2404 exp (-0.0046t)) para machos e PC = 27.2616 × exp (-2.4151 exp (-0.00775t)) para as fêmeas.

The objective of the present study was to determine the best model to describe and quantify the changes in live body weight, height at withers, height at rump, body length and chest girth of Holstein cows raised under Korean feeding conditions for 50 months. The five standard growth models namely polynomial linear regression models, regression of growth variables on the first and second-order of ages in days (model 1) and regression of growth variables on age covariates from first to the third-order (model 2) as well as non-linear models were fitted and evaluated for representing growth pattern of Holstein cows raised in Korean feeding circumstances. Nonlinear models fitted were three exponential growth curve models; Brody, Gompertz, and von Bertalanffy functional models. For this purpose, a total of 22 Holstein cows raised in Korea used in the period from April 2016 to May 2020. Each model fitted to monthly growth curve records of dairy cows by using PROC NLIN procedure in SAS program. On the basis of the results, nonlinear models showed the lower root mean square of error (RMSE) for live body weight, height at withers, height at rump, body length and chest girth (12.22, 1.95, 1.55, 4.04, 2.06) with higher correlation coefficiency (R2) values for live body weight, height at withers, height at rump, body length and chest girth (0.99, 0.99, 0.99, 1.00, 1.00). Overall, the evaluation of the different growth models indicated that the Gompertz model used in the study seemed to be the most appropriate one for standard growth of Holstein cows raised under Korean feeding system.

The study was carried out to investigate the magnitude of non-genetic factors influencing linear type traits and to estimate phenotypic correlations among these traits in Simmental cows. The 16 linear type traits were recorded for 148 Simmental cows reared in a private farm in Eastern Turkey. A statistical model used in this research included fixed effects of stage of lactation, parity, season at time of classification and classifier. The age at time of classification was included to the statistical model as co-variable. Parity, stage of lactation, season at time of classification and classifier effect was significant (P

Objective: The teeth play important roles in food mastication, prehension and defense against predators. Although several studies demonstrated the development of teeth in different mammalian species, no data are, to our knowledge, available in Egyptian buffalos. Therefore, the present investigation was conducted to study the development of incisor teeth in buffaloe. Design: Descriptive study. Animals: seventeen buffalo embryos and fetuses of both sexes were used. Their crown vertebral rump lengths (CVRL) ranged from 2 to 46 cm (equivalent to 38 - 177 days old). Procedure: Embryos and fetuses were fixed in 10% neutral buffered formalin and decalcified by 14% EDTA solution for several weeks. The samples were dehydrated, cleared and embedded in paraffin wax using standard techniques. Sections were cut on Leitz microtome and mounted on uncoated slides. For general histological structure, a selection of slides was routinely stained with haematoxylin–eosin and examined by the light microscope. Result: The present study reported for the first time that the prenatal development of incisors in buffalo passes through three sequential stages: the bud, cap and bell stages. Although each stage was easily differentiated based on its form and its distinct developmental features, the three stages were overlapped with each other’s. Generally, the bud stage was observed in 11 cm CVRL buffalo fetuses, meanwhile the cap and bell stages were detected in 23 cm and 30 cm CVRL fetuses respectively. Conclusion and clinical relevance: These results can be used as inductive index for determination of the ages of buffalo embryos and fetuses.

In this study, a morphometric investigation was carried out on the Akbash Turkish shepherd dog breed using 30 exterior parameters. The study consisted of 96 dogs (54 males and 42 females) ranging in age from 2 to 9 years. All dogs were bred in the West Anatolia region of Turkey, around the city of Eskisehir. The following exterior parameters were measured and their means were obtained: height at withers (65.22±3.99 cm), height at mid-back (62.24±4.24 cm), height at rump (64.97±4.16 cm), height at base of tail (58.2±5.01 cm), height to elbow (36.07±4.06 cm), height to knee (35.83±4.96 cm), height to hock (17.08±3.21 cm), height to tip of sternum (45.12±4.30 cm), body length (70.58±5.58 cm), chest depth (29.58±3.23 cm), chest width (21.02±3.18 cm), breast width (16.86±3.41 cm), chest circumference (77.86±7.05 cm), pastern circumference (13.27±1.67 cm), rump length (19.21±3.27 cm), pelvic width (8.65±2.18 cm), rump protuberance width (7.58±3.02 cm), head length (27.20±2.85 cm), skull length (16.58±1.92 cm), muzzle length (10.30±2.35 cm), skull width (14.06±1.96 cm), muzzle width (7.60±1.26 cm). According to the obtained morphological characteristics the dog has a rectangular body format, and the rump is somewhat higher than the height at the withers. According to its craniological characteristics it belongs to the group of mesaticephalic dogs. The width of the skull is smaller than its length. Angles of the hind legs are more open than angles of the front legs.

The aim of this study was to estimate different body measurements and derive prediction equation for live weight of Jamuna basin sheep using different body measurement. A total of 520 individual records of sheep (47 males and 473 females) including all temporary at nine-month age (320), first pair permanent at 1.6 year age (161) and 2nd pair permanent at two years age (39) were collected from two Upazila of Sherpur district. Body weight (BW) was taken using a weighing scale and different measurements were taken using the tailor's tape measure and measuring stick while animals were on standing position. Data were analyzed with the help of SPSS-v-20 computer package program. Average BW, wither height(WH), rump height(RH), body length(BL), sternum height(SH), body depth(RD), bi-costal diameter(BD), ear length(EL), rump width(RW), head width(HW), rump length(RL), head length(HL), heart girth(HG), cannon bone circumference(CC) and muzzle diameter(MD) were 12.28±2.75 kg, 49.42±3.78, 54.04±3.88, 49.38±4.57, 28.06±3.00, 53.09±4.40, 15.07±2.58, 8.66±3.32, 15.72±2.33, 12.87±2.20, 14.30±2.29, 18.23±2.30, 55.02±4.71, 9.22±1.01, and 16.65±1.73cm, respectively. According to sex BW, WH, RH, SH, RD and CC were found significant (p

Non-invasive tracking the on-shore occurrence of the atypically pigmented animals and determination of land residency duration of leucistic seals would help us find out more about the rotation of the migrating population. During seven austral summer seasons (2011–2018), by counting the animals every 10 days at the Cape Lions Rump shore, King George Island, South Shetlands, in the Antarctic Specially Protected Area No. 151 and the adjacent ice-free land (31.52 km2) we registered fourteen leucistic individuals per a total of 43,919 animals. Moreover, daily monitoring of local fauna resulted in further 33 leucistic animals (together 47, in all seasons). Whilst the results of 10-day censuses of the total population were similar inter-seasonally, a tendency for increased occurrence of leucistic individuals in successive seasons was revealed. Generally, the number of animals increased significantly as season progressed. Since leucistic individuals stayed on-shore for 1–2 days usually, it can be hypothesised that the observation of migrating Antarctic fur seals every 3 days does not involve the same individuals. Also, additional every 5-day censuses taken in one season in ASPA 151 resulted in a higher seasonal number of animals, which proves that more frequent counts help us estimate population abundance more efficiently. Thus, every 5-day counts are proposed as a feasible and justified method of population monitoring.

Least square (LS) method is a common method used to estimate the coefficients in multiple regression models. The least square multiple regression models produce biased regression coefficients when the multicollinearity is encountered in the studied data sets. Multicollinearity problem can be solved by using some methods. As one of the methods, Ridge Regression (RR) is a biased estimation method that enables to obtain models having more reliable coefficient of determination (R2). This study was conducted on 40 Saanen kids in order to determine some morphological measurements (withers height, rump height, body length, chest width, chest girth and chest depth) affecting body weight. In this study, usability of ridge regression method in the presence of multicollinearity was evaluated. Variance Inflation Factor (VIF) values higher than 10 were detected for withers height and rump height. Coefficient of determination (R2) was obtained as 0.88 from LS method and R2 was obtained 0.875 with k=0.0136 from RR method. As a result, the model obtained from RR is more reliable than that obtained from LS.

Background: Meat goat breeding programs should prioritize the identification and selection of genetically superior animals for traits related to meat quality and carcass yield in order to increase the value of the final product. Objective: To estimate (co)variance components and genetic parameters for ultrasound-measured carcass traits, body size and body weight in Anglo- Nubian breed goats raised in the Mid-North region of Brazil. Methods: (Co)variance components and genetic parameters were estimated using the single and two-trait animal model analyses via Bayesian inference for loin eye dimensions (area, length, and depth), sternal fat thickness, rump height, chest circumference and depth, leg perimeter, and body weight. Results: Heritability estimates were higher when two-trait analyses were used. This finding implies that it is possible to recover part of the additive genetic variance included in the residual variance due to the correlation between traits. Genetic correlations between carcass and body size traits showed different magnitudes. On the other hand, genetic correlations between the traits related to muscularity showed high magnitudes. Conclusions: Body weight was not a good indicator of muscularity; therefore, it is not recommended as a criterion for indirect selection to improve carcass traits of Anglo-Nubian goats. Leg perimeter and chest circumference may be important to construct selection indexes in meat goat breeding programs. Resumen Antecedentes: los programas de mejoramiento de caprinos de carne deben priorizar la identificación y selección de animales genéticamente superiores para características relacionadas con la calidad de la carne y rendimiento de la canal, con el fin de agregar valor al producto final. Objetivo: estimar los componentes de (co)varianza y parámetros genéticos para características de canal obtenidas por ultrasonografía, características de tamaño y peso corporal en caprinos de la raza Anglonubiana, criados en la región medio-norte de Brasil. Métodos: los componentes de (co)varianza y parámetros genéticos fueron estimados mediante un modelo animal usando análisis uni y bi-carácter vía metodología Bayesiana para las dimensiones del ojo de lomo (área, profundidad y longitud), grosor de la grasa esternal, altura de la grupa, circunferencia y profundidad torácica, perímetro de la pierna y peso corporal. Resultados: las estimativas de heredabilidad obtenidas a partir del análisis bi-carácteristico fueron mayores que las obtenidas a partir del análisis uni-carácteristico. Este supuesto implica que es posible recuperar parte de la variancia genética aditiva incluida en la variancia residual, debido a la correlación entre las características. Las correlaciones genéticas entre las características de canal y las medidas corporales presentaron diferentes magnitudes. Por otro lado, las correlaciones genéticas entre las características relacionadas con musculatura presentaron alta magnitud. Conclusiones: el peso corporal no fue un buen indicador de musculatura; por eso no es recomendado como criterio de selección indirecta para mejorar la canal de caprinos Anglonubianos. El perímetro de la pierna y la circunferencia del pecho pueden ser importantes para la construcción de índices de selección en programas de mejoramiento de carne caprina. Resumo Antecedentes: programas de melhoramento de caprinos de corte devem priorizar a identificação e seleção de animais geneticamente superiores para características relacionadas à qualidade da carne e rendimento de carcaça, para aumentar o valor ao produto final. Objetivo: estimar componentes de (co)variância e parâmetros genéticos para características de carcaça obtidas por ultrassonografia, características de tamanho e peso corporal em caprinos da raça Anglo-Nubiana criados na região Meio-Norte do Brasil. Métodos: os componentes de (co)variância e parâmetros genéticos foram estimados usando análises uni e bicaracterísticas de um modelo animal via metodologia Bayesiana para área, profundidade e comprimento de olho de lombo, espessura da gordura esternal, altura da garupa, circunferência e profundidade torácica, perímetro da perna e peso corporal. Resultados: as estimativas de herdabilidade obtidas a partir das análises bicaracterísticas foram maiores que as obtidas a partir das análises unicaracterísticas. Esse resultado implica que é possível recuperar parte da variância genética aditiva incluída na variância residual devido à correlação entre as características. As correlações genéticas entre as características de carcaça e as medidas corporais apresentaram magnitudes variáveis. Por outro lado, as correlações genéticas entre as características relacionadas à musculosidade apresentaram altas magnitudes. Conclusões: o peso corporal não se mostrou um bom indicador de muscularidade, de modo que não é recomendado como critério de seleção indireta para melhorar a carcaça de caprinos Anglo-Nubiano. O perímetro de perna e a circunferência torácica podem ser importantes para a construção de índices de seleção em programas de melhoramento de carne caprina.

The aim of the study is to characterize Begait cattle using morphometric and qualitative traits. The breed was kept under farm and ranch management systems in Western Tigray, Ethiopia. A total of 368 Begait cattle which included 24 male Begait cattle were selected using simple random sampling method and the data were analyzed using statistical packages for social sciences and statistical analysis software. Begait cows exhibited chest girth of 152.8±0.40 cm, height at withers of 129.1±0.28 cm, backline length (loin length + back length) of 88.4±0.26 cm and tail length of 96.2±0.44 cm. Whilst Begait breeding males showed chest girth of 170.7±1.35 cm, height at withers of 145.1±1.18 cm, backline length of 90.0±1.13 cm and tail length of 108.2±1.29 cm. The skeletal measurements of Begait cattle are good indicators of the breed as a potential dual-purpose breed and the gene could be improved through selection. Humera ranch should own superior male Begait cattle for genetic improvement of the breed. The correlation was significant (P

SPARC is a cysteine-rich acidic secreted protein. It is a non-collagen component of bone, which is widely distributed in humans and animals and plays an important role. SPARC has been found in a variety of human cancers (breast cancer, stomach cancer, ovarian cancer, etc.) and diabetes-related research. Especially the muscle and fat metabolism are closely related. In this study, we used a DNA pool to detect a new SNP site (g.12454T > C). A total of 616 samples of four breeds of Qinchuan cattle (QC, n=176), Xianan cattle (XN, n=160), Pinan cattle (PN, n=136) and Jiaxian cattle (JX, n=144) were analyzed and identified with ARMS-PCR. In addition, we correlated SNP with growth traits and showed significant correlation with growth traits such as rump length, hip width, and body length (p

The objective of this study was to evaluate the effects of nutritional strategies on productive and nutritional performance, metabolic profile, and ovarian activity in heifers under grazing in the tropics in Brazil. Forty Nellore heifers averaging 8.5 ± 0.06 months and 248.6 ± 3.3 kg body weight (BW) were distributed in a completely randomized 2 × 2 factorial design with four treatments and ten replicates. The evaluated strategies consisted of different amounts of energetic-protein supplement: (1) 4 g/kg of BW of supplement in the pre-weaning and post-weaning; (2) 4 g/kg of BW of supplement pre-weaning and 6 g/kg in the post-weaning; (3) 6 g/kg of BW of supplement in the pre-weaning and 4 g/kg of BW in the post-weaning and; (4) 6 g/kg of BW of supplement in the pre-weaning and post-weaning. Crude protein (CP) and organic matter (OM) intake were increased (P

Se propuso tipificar fenotípicamente a las cabras de la provincia de Santa Elena, Ecuador, y probar si existían diferentes fenotipos. Se muestrearon 344 animales en distintos tipos de sistemas productivos y se observaron las siguientes variables: a) morfológicas: patrón y color de capa (PCA, CCA); pelaje y características del pelaje (PEL, CPEL); pigmentación de piel, mucosas y pezuñas (PPI, PMU, PPE); tamaño y disposición de orejas (TOR, DOR); perfil craneal (PCR); mamelas (MAM); barba (BAR); tipo y orientación de cuernos (TCU, OCU); grupa (GRU); b) morfo-estructurales: longitud y ancho de cabeza (LCB, ACB); largo de cara (LCA); longitud de oreja (LOR); ancho de hombros (AHO); profundidad y perímetro del tórax (PRT, PET); perímetro de caña (PC); longitud del cuerpo (LCR); altura a la cruz (ACR); longitud y ancho de grupa (LGR, AGR). Los análisis multivariados mostraron 3 grupos: 1) animales pequeños; CCA: colorada (35%), variada (33%); PMU (43%); BAR (44%); PCR recto (83%); TOR pequeñas (89%); DOR: horizontal (47%), hacia adelante (42%); TCU arqueados (68%); GRU semiplana (89%). 2) animales más anchos y largos; altura mediana; CCA: negra (38%), colorada (35%); PCR: recto (55%), subconvexo (34%); TOR: pequeñas (37%), medianas (38%); DOR: horizontal, hacia adelante y caídas (84%); TCU: arqueados (58%), curvos (38%); GRU semiplana (71%). 3) animales más altos; mayor LGR y PC; PMU (25%); BAR (19%); CCA: colorada (42%), negra (36%); PCR: subconvexo (58%), recto (39%); TOR: largas (51%), caídas (64%); TCU: arqueados (45%), rectos (43%); GRU semiplana (75%). El Grupo 1 correspondió al biotipo más antiguo de Santa Elena que representaría el fenotipo Criollo, los otros dos, serían el resultado de cruzamientos debidos a introducciones de otras razas procedentes principalmente de Loja (sur de Ecuador) y Perú.

The experiment was conducted with the duration of six months at ABIS (Aamir Bahadur Sultan Ali) Buffalo Dairy Farm, Gormara, Rajnandgaon (Chhattisgarh) to investigate the variability of skin thickness in relation to milk production. A total of 120 milking Murrah buffaloes were selected for the experiment. The Murrah buffaloes were selected in a range of first to sixth parity and each parity containing 20 buffaloes. All the selected Murrah buffaloes of the present investigation were kept under similar housing system i.e. loose housing system with one shelter along one side of the paddock and provided green fodder and total mix ration as per their requirement. Drinking water was made available ad lib to whole day. The milking was done by milking machine in milk parlour in morning and evening. Daily milk yield and total milk yield were recorded from the records. The correlation between skin thickness of neck, chest, abdomen, rump, hind quarter, udder and flank and total milk yield were -0.377, -0.498, -0.355, -0.282, -0.207, 0.073 and -0.072 respectively. Correlation between lactation length and different site of skin thickness was found significantly positive. However, negative correlation was observed for daily milk yield. On the other hand, regression coefficient of skin thickness and milk yield indicated that an increase in skin thickness of neck, chest, rump and hind quarter could decrease in average total milk.

This study evaluated the effects of offering growing bulls a diet with 40% modified wet distillers grains plus solubles (MWDGS; dry matter [DM] basis) on growth, composition, hoof scores, and reproductive performance. Simmental × Angus bulls (n = 28) were stratified by body weight (BW; 316 ± 29 kg), sire, and day 0 semen production (Y/N) and assigned into one of six pens. Pens were randomly assigned to one of two dietary treatments (n = 3 pens/treatment): 1) offered free-choice access to a corn-based diet with no MWDGS (CON) or 2) offered free-choice access to a diet with 40% MWDGS (DST; DM basis). Bulls were offered treatments for 140 d and, then, switched to a free-choice, common, low-energy diet for an additional 70 d. Bull BW, body condition score (BCS), hip height (HH), ultrasound (rump fat depth [RF], 12th rib fat thickness [BF], marbling score [MS], and longissimus muscle depth [MD]), hoof evaluations, breeding soundness examination (BSE), and semen evaluations were performed on days 0, 28, 56, 84, 112, 140, 175, and 210. There was a tendency (P